ID: 1133187416

View in Genome Browser
Species Human (GRCh38)
Location 16:4109962-4109984
Sequence CCTGTGCTTCTCTGTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133187416_1133187427 11 Left 1133187416 16:4109962-4109984 CCGCCCCCACAGAGAAGCACAGG 0: 1
1: 0
2: 3
3: 41
4: 337
Right 1133187427 16:4109996-4110018 CCCACCTCTCCGCTCTGCCCTGG 0: 1
1: 0
2: 4
3: 44
4: 497
1133187416_1133187433 30 Left 1133187416 16:4109962-4109984 CCGCCCCCACAGAGAAGCACAGG 0: 1
1: 0
2: 3
3: 41
4: 337
Right 1133187433 16:4110015-4110037 CTGGTGCTCTTCTGTCCACCTGG 0: 1
1: 0
2: 0
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133187416 Original CRISPR CCTGTGCTTCTCTGTGGGGG CGG (reversed) Intronic