ID: 1133187904

View in Genome Browser
Species Human (GRCh38)
Location 16:4113863-4113885
Sequence ATGGAGCAGCTGGGAGTGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 1, 2: 9, 3: 71, 4: 504}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133187904_1133187909 -10 Left 1133187904 16:4113863-4113885 CCGGCCACTCCCAGCTGCTCCAT 0: 1
1: 1
2: 9
3: 71
4: 504
Right 1133187909 16:4113876-4113898 GCTGCTCCATGAGATTGGCCAGG 0: 1
1: 0
2: 1
3: 6
4: 166
1133187904_1133187911 3 Left 1133187904 16:4113863-4113885 CCGGCCACTCCCAGCTGCTCCAT 0: 1
1: 1
2: 9
3: 71
4: 504
Right 1133187911 16:4113889-4113911 ATTGGCCAGGTTCACATCGTTGG 0: 1
1: 0
2: 0
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133187904 Original CRISPR ATGGAGCAGCTGGGAGTGGC CGG (reversed) Exonic
900212304 1:1462148-1462170 ATGGAGCAGGCGGCAGTGGAGGG - Intronic
900342941 1:2197289-2197311 ATGGGGGAGCCGGGAGGGGCTGG - Intronic
900523009 1:3115260-3115282 ATGGGACAGCTGGGGCTGGCTGG - Intronic
901357239 1:8661549-8661571 AAGCAGCAGCTGGGAAGGGCTGG + Intronic
901736363 1:11314739-11314761 ATGGGGCTGCTGGCAGGGGCAGG + Intergenic
901924961 1:12560357-12560379 AAGGCACTGCTGGGAGTGGCAGG - Intergenic
902609347 1:17588156-17588178 CTGGAGCAGCTGGGGGTGGAGGG + Intronic
902953824 1:19910716-19910738 GTGGAGCAGCTGGAGCTGGCTGG + Exonic
903124683 1:21239639-21239661 CTGGTGCAGCTGGGTGTGGACGG - Intronic
903319408 1:22533384-22533406 TCAGAGCAGCTGGGAGTGGTGGG - Intergenic
903382286 1:22905696-22905718 CTGGAGCAGCTGAGACTGTCAGG - Intronic
903682278 1:25104970-25104992 ATGGAGAGGCTGGCAGGGGCTGG - Intergenic
903817570 1:26075950-26075972 CTGGAGCAGTTGGCAGAGGCAGG + Intergenic
904022823 1:27480892-27480914 AGGGAGGAGCTGGGAGTAGCTGG - Intronic
906026188 1:42676171-42676193 AGAGAATAGCTGGGAGTGGCCGG + Intronic
906479983 1:46193502-46193524 ATGGAGCAGCAGTGATTGCCAGG - Intronic
907403434 1:54239631-54239653 ATGGGGCAGGAGGGAGAGGCAGG + Intronic
907418740 1:54332355-54332377 AGGGAGCTGCTGGGAGGGGTGGG + Intronic
907865541 1:58396236-58396258 CTGGAGCCCCTGGGAATGGCTGG - Intronic
912174656 1:107141144-107141166 ATTAAGCGGCGGGGAGTGGCGGG + Intronic
913564204 1:120055631-120055653 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
913633920 1:120737934-120737956 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914284792 1:146214979-146215001 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914363007 1:146952272-146952294 AATGAGCAGCTGACAGTGGCTGG + Intronic
914545823 1:148665718-148665740 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914620740 1:149404948-149404970 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914836565 1:151211679-151211701 CCCGAGCAGCTGGGAGTAGCTGG - Intronic
914919207 1:151836338-151836360 AGGCAGCAGCTGGCAGTGGGGGG + Intergenic
915605581 1:156948113-156948135 GAGGAGCAGCTGGGTGTGGATGG + Intronic
915906191 1:159879070-159879092 AAGGTGTAGCTGGGAGAGGCTGG - Intronic
917796837 1:178538770-178538792 AGGGGGAAGCTGGGAATGGCTGG - Intronic
918464554 1:184808060-184808082 ATGCAGGAGGTGGGTGTGGCAGG - Exonic
920500360 1:206481430-206481452 ATGGGGCAGCTGGGAGGTGGAGG + Intronic
920717665 1:208355993-208356015 AGGGAGCAGCTTGGGGTGGGAGG + Intergenic
921383962 1:214551437-214551459 ATGGCTCAGCTGGGAGGGGAAGG + Intronic
921552324 1:216553158-216553180 AAGGAGCAGCTGTGAGTTCCTGG - Intronic
922474600 1:225898587-225898609 TTGGTGAAGCCGGGAGTGGCTGG - Intronic
922595725 1:226811301-226811323 CTGGAGCTCCTGGGATTGGCTGG - Intergenic
922785957 1:228282332-228282354 CTGCAGCAGCTGGGGGAGGCAGG - Intronic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
923037092 1:230291970-230291992 GTGGTGAAGCGGGGAGTGGCAGG + Intergenic
1062896373 10:1106306-1106328 ATGGAGGAGCGAGGAGCGGCCGG - Intronic
1063101025 10:2950400-2950422 CTGTAGCAGGTGGGAGTGCCTGG - Intergenic
1066646447 10:37615810-37615832 CTGGTGCAGCTGGGAGGGTCTGG - Intergenic
1067440645 10:46307631-46307653 ATGGTGCAGGTGGGTGAGGCTGG + Intronic
1067723919 10:48751832-48751854 ATGCAGCTGCTGTGGGTGGCAGG + Intronic
1067793937 10:49307345-49307367 GTGGAGCAGCTGGCAGTGCCAGG + Intronic
1067854577 10:49781072-49781094 AGGGAGCAGCTGGGGGTGTTGGG - Intergenic
1069712195 10:70496933-70496955 AGGCTGCAGCTGGGAGTGGGAGG - Intronic
1069961042 10:72079671-72079693 ATGGAGAAGCTGGGAGAGATTGG - Intronic
1070288859 10:75102022-75102044 GTGGACAAGTTGGGAGTGGCAGG - Intronic
1070432652 10:76356872-76356894 ATGGAGGAGTTGGCAGTGGGTGG + Intronic
1071347590 10:84707384-84707406 ATGCAGTACCTGGGACTGGCGGG + Intergenic
1071384306 10:85104225-85104247 ATGGAGCAGCAGGGAGGGGCTGG - Intergenic
1071765549 10:88660667-88660689 AAGGAGCAGATGGGAGTGGGAGG - Intergenic
1072484337 10:95840653-95840675 ATGCAGCAGCTCAGAGTAGCAGG - Intronic
1072524188 10:96257132-96257154 AGTGAGCAGCTGAGAGTGTCAGG + Intronic
1073358113 10:102873181-102873203 ATTGAGAAGTTGGGAGAGGCTGG + Exonic
1074101904 10:110360309-110360331 ATGGAGAGGCTGGGAGGGGCAGG - Intergenic
1074189102 10:111120729-111120751 CTGGAGAAGCTGGGAGTTGCAGG - Intergenic
1075121319 10:119666898-119666920 CTGGAGGAGATGGTAGTGGCTGG - Intronic
1075155729 10:119974542-119974564 AAGGAGCAGCAGGGAGTTGGAGG + Intergenic
1075179476 10:120196901-120196923 CTGGCTCAGCTGGGATTGGCTGG - Intergenic
1075336642 10:121613563-121613585 AGGGAGCACCAGGGAGTGCCAGG - Intergenic
1075857097 10:125638752-125638774 AGGGAGCAGGTTGGGGTGGCAGG - Intronic
1076330109 10:129657834-129657856 ATGGAGATGCTGGGAATGGGAGG + Intronic
1076422303 10:130340103-130340125 CTGCAGCAGCTGGAACTGGCTGG + Intergenic
1076493346 10:130879148-130879170 ATGGAGCAGAAGGGAGTGGAAGG + Intergenic
1077074579 11:694586-694608 GTGGAGCAGGTGTGAGGGGCAGG + Intronic
1077482855 11:2824688-2824710 AGGAAGCAGCTGGGGGTGGCGGG + Intronic
1078616126 11:12867831-12867853 GGGGAGCAGAGGGGAGTGGCAGG + Intronic
1078854681 11:15197436-15197458 ATGCAGGAGCTGGGAGTCCCTGG + Intronic
1079340336 11:19606510-19606532 CTGAAGCAGTTGGGAGGGGCAGG - Intronic
1080254155 11:30270135-30270157 ATGGGGCAGCTAGGATTTGCAGG - Intergenic
1081413356 11:42785575-42785597 ATGGAGCATCGGGCAGTGGCAGG + Intergenic
1081616574 11:44594897-44594919 AAGGACCAGCTGGGAATGGCAGG - Intronic
1081647889 11:44802574-44802596 ATGGAGCAGATGGGAGTGGGGGG + Intronic
1081852814 11:46285463-46285485 CAGGAGAAGCTGGGAGAGGCAGG + Intronic
1083890398 11:65592935-65592957 AGGAAGCAGCCAGGAGTGGCTGG - Exonic
1084168987 11:67391477-67391499 TTGCAGCAGCCGGGAGTGGGAGG - Intronic
1084428127 11:69096696-69096718 ACGGAGCCACTGGGACTGGCTGG - Intergenic
1084938169 11:72598350-72598372 AGGGGGCAGGTGTGAGTGGCAGG + Intronic
1085295641 11:75430220-75430242 GCGGAGCGGCTGGGCGTGGCGGG - Exonic
1085391500 11:76184599-76184621 GCTGAGCAGCTGGGAGTTGCAGG + Intergenic
1086338780 11:85826282-85826304 TGGCTGCAGCTGGGAGTGGCTGG + Intergenic
1086453350 11:86938501-86938523 CAGGAGGAGCTGGAAGTGGCTGG + Intronic
1089345117 11:117786080-117786102 AAAGAGCTGCGGGGAGTGGCTGG - Intronic
1089365992 11:117921487-117921509 ATGGGGCAGCTGGGGCTGGATGG - Intronic
1089454449 11:118617892-118617914 ATAGAGCAGCAAGGAGAGGCAGG + Intronic
1089493753 11:118898587-118898609 ATGAAGCAGCGGGGCGTGGGGGG - Exonic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1089733022 11:120531362-120531384 ATGGAGCAGGTGCCTGTGGCAGG - Intronic
1089749722 11:120642394-120642416 ACGGAGCAGCTGGGAGATGCGGG + Intronic
1089777929 11:120851906-120851928 ATGGTGGAGCTGGGGGTGCCTGG + Intronic
1090401802 11:126453881-126453903 AAGCAGGAGCTGGGAGGGGCAGG - Intronic
1090621971 11:128568313-128568335 CTGGCCCAGCTGAGAGTGGCGGG - Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091697156 12:2635517-2635539 ATGGAGGAGCTGGGGGTGGTGGG - Intronic
1091746691 12:2997382-2997404 GTGGAGCACCTGGGGGTGCCTGG + Intronic
1091811880 12:3406198-3406220 ATGGAGCAGCTGGGATTCAGGGG + Intronic
1091863311 12:3806341-3806363 ATGGCACAGATGGGTGTGGCTGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092533812 12:9367507-9367529 ATGGAACAGCAGGGAGGGGGAGG + Intergenic
1092701934 12:11241558-11241580 AAGGAGCAGAAGGGAGTGCCAGG - Intergenic
1094355135 12:29569510-29569532 GTGGAGCAGCTGGGAGGGAGAGG + Intronic
1095485954 12:42684917-42684939 TTGGAGCAGATGGGAGATGCTGG - Intergenic
1095977336 12:47948797-47948819 ATGGAGCAGGTAGGAGGTGCGGG - Intergenic
1097183628 12:57184758-57184780 CTGGGGCAGCAGGGAGTGCCTGG - Intronic
1099933595 12:89100641-89100663 AAGGGCCAGCTGGGAGTGGCTGG - Intergenic
1100371579 12:93973572-93973594 TTGGACTAGCTGGGAGTGGGAGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1101253688 12:102957582-102957604 CTGCAGCAGCGGGGAGTGGGGGG + Intronic
1101803569 12:108043849-108043871 GTGGAGCAGCTGACAATGGCTGG + Intergenic
1102391559 12:112552996-112553018 ATGGACCAGGTGGGAGCAGCGGG - Intergenic
1102563848 12:113781688-113781710 GTGGGGCAGCAGGGAGTGACAGG + Intergenic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1102945050 12:116979474-116979496 AGGGAGCAGGTGGGAGTGCCAGG + Intronic
1103561570 12:121795649-121795671 AGGGAGGAGCTGTGACTGGCTGG + Intronic
1104057643 12:125242790-125242812 ATGGAGCAGTGGGCAGTGGGAGG - Intronic
1104152411 12:126096301-126096323 ATGGAGCCTCTGAGAGTGGAGGG - Intergenic
1104233665 12:126910579-126910601 CTGGATCAGCTGGGCTTGGCGGG + Intergenic
1104947851 12:132424820-132424842 GTGGAGGAGCTGGTCGTGGCAGG - Intergenic
1105040739 12:132958756-132958778 AAAAAGTAGCTGGGAGTGGCTGG - Intergenic
1105439016 13:20400450-20400472 ATGGAGCAGGAGAGAGTGACAGG - Intergenic
1105889533 13:24672607-24672629 ATGGAGGAGCAGGGCCTGGCTGG - Intergenic
1108190392 13:47932462-47932484 ATGGAGCAGCTTTGGGTGGAGGG - Intergenic
1109737335 13:66504088-66504110 ATGACTCAGCTGGGAGAGGCAGG - Intronic
1110897355 13:80771572-80771594 TTGGAGTAGCTGGGACTAGCTGG - Intergenic
1113297297 13:108973023-108973045 ATGGAGCATCTGGGAGCAGGTGG + Intronic
1113871168 13:113560740-113560762 AGGCAGAAGCTGGGAGGGGCTGG + Intergenic
1114402505 14:22422806-22422828 ATGGAGCACCTGAGGGTGGCAGG - Intergenic
1114479573 14:23024168-23024190 AGGGTGCTGCGGGGAGTGGCTGG + Intronic
1115896222 14:38090731-38090753 ATGGAACAGCTGGGGCTGGCTGG - Intergenic
1116421033 14:44732500-44732522 ATGGGGCAGCAAGGAATGGCAGG - Intergenic
1117623773 14:57614726-57614748 ATGGGGCAACAGGGAGTGGTGGG + Intronic
1118337031 14:64862263-64862285 AGAGAGCCGCTGAGAGTGGCTGG - Intronic
1118720014 14:68587276-68587298 AAGGAGGGGCTGGGAGAGGCTGG - Intronic
1118900608 14:69982471-69982493 ATGGAGCAGCTCTGAGGGGCAGG + Intronic
1119484019 14:74976839-74976861 AAAGAGCAGCTGTGAGTGGCAGG + Intergenic
1119944503 14:78678433-78678455 CTGGAGTAGCTGGGTGTGGTGGG - Intronic
1120884786 14:89443359-89443381 ATGGAGCCCCTGGGACAGGCAGG + Intronic
1121102999 14:91262982-91263004 ACGGGGCAGCGGGGAGGGGCGGG + Intergenic
1121590516 14:95103209-95103231 AGGGAGCAGCTGTGCTTGGCCGG + Intronic
1121619620 14:95337158-95337180 AAGGAGCTGCTGGGACAGGCAGG - Intergenic
1121958904 14:98240579-98240601 AGGGAGCAGCTGGGGAAGGCTGG + Intergenic
1122345078 14:101053637-101053659 ACCGAGCTGCTGGGAGTCGCTGG + Intergenic
1122406528 14:101504295-101504317 AAGGGCCAGCTGGGAGAGGCAGG + Intergenic
1122878253 14:104678642-104678664 AGAGAGCAGCTGGGGGTGCCGGG - Intergenic
1124247752 15:28085267-28085289 AGGCAGCAGCTGGGAGTGAAAGG - Intronic
1126849212 15:52787386-52787408 AATGAGAAGCTGGGGGTGGCAGG - Intronic
1127613315 15:60658032-60658054 AAGGAAAAGCGGGGAGTGGCGGG + Intronic
1128389826 15:67175327-67175349 ATGGGGCAGCTTGGAGTGAGAGG + Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128669948 15:69567449-69567471 ATGGAGCAGGTGGGAGGCTCAGG + Intergenic
1128808990 15:70556238-70556260 TGGGAGCAGCGGGGAGTGGCAGG - Intergenic
1128834755 15:70800203-70800225 CTGGAGCAGCTGTGGGTGGCAGG + Intergenic
1129332531 15:74835103-74835125 ATTGAGAAGATGGGAGGGGCTGG - Intergenic
1129518589 15:76171645-76171667 AGGGAGCTGCTGGCAGGGGCTGG + Intronic
1130149103 15:81297835-81297857 AAGGAGCAACTAGTAGTGGCAGG + Intronic
1131387134 15:92017269-92017291 TTGGAGGAGCTGGGATTGGGGGG + Intronic
1131539501 15:93264455-93264477 ATGGAGCAGAAGTGACTGGCTGG - Intergenic
1132292801 15:100714895-100714917 ATGGGGATGCTGGGGGTGGCAGG + Intergenic
1132463016 16:64673-64695 ATGGAGCAGCTGGGCGGTGTTGG + Intronic
1132663878 16:1073030-1073052 ATGGAGCTGCTGGGAGTGGATGG - Intergenic
1132718000 16:1301597-1301619 GTGGAGCAGCTGGGAGGGGCAGG - Intergenic
1132718888 16:1306331-1306353 ATGGAGCAGGTGGGGGTGAGGGG - Intergenic
1132864424 16:2086470-2086492 CTGGAGCAGGTGGGGGTGCCAGG - Intronic
1133187904 16:4113863-4113885 ATGGAGCAGCTGGGAGTGGCCGG - Exonic
1133232308 16:4372478-4372500 AGGGAGGGGCGGGGAGTGGCTGG + Intronic
1133638536 16:7694699-7694721 ATTGAATTGCTGGGAGTGGCAGG + Intronic
1134241459 16:12509892-12509914 TTGGAGCAGCTGCCTGTGGCAGG - Intronic
1135958314 16:26975087-26975109 ATGGAGCTGATGGGATTTGCTGG - Intergenic
1136059900 16:27719206-27719228 ATGAAGCAGTAGGGAGTGGTGGG + Intronic
1136080978 16:27852505-27852527 ATATAGCAGCTGAGAGTGGAAGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1136396778 16:29996724-29996746 ATGGGCCAGCTGGGAGGGACAGG + Intronic
1137257114 16:46785124-46785146 AGGGAGAAGCTGGGAGTTGGGGG - Intronic
1137369935 16:47895870-47895892 AGGGAGCAGATGTGAGAGGCTGG + Intergenic
1137610684 16:49815250-49815272 GTGGAGCAGCTGGGGGTATCAGG - Intronic
1138138421 16:54544933-54544955 ATGGAGTAGCGTGGAGTTGCTGG + Intergenic
1138141110 16:54569275-54569297 ATACAGCAGGTGGGAGTGCCTGG - Intergenic
1138195147 16:55046425-55046447 ATGGAGAAGCTGGAAGTCTCTGG - Intergenic
1139604070 16:68005447-68005469 AGGCAGCAGCTGGAAGTGGAGGG - Intronic
1141548608 16:84789080-84789102 ATGGAGCAACAGGGACGGGCTGG + Intergenic
1141644587 16:85360403-85360425 AGGGAGCAGCTGGCAGACGCAGG - Intergenic
1142149264 16:88505544-88505566 AGGGAGGAGGTGGGAGGGGCCGG + Intronic
1142210488 16:88806201-88806223 CGGGAGAAGCTGTGAGTGGCAGG - Intronic
1142215399 16:88827266-88827288 CAGGAGCAGCTCCGAGTGGCTGG + Intronic
1142386753 16:89770172-89770194 ACGGAGCAGCTGGCAGAGCCGGG + Exonic
1143161500 17:4874687-4874709 ATGGAGCATCTGGGTGGGGAGGG + Intronic
1143323393 17:6082413-6082435 AAGGACCCGCTGGAAGTGGCAGG + Intronic
1144119836 17:12141225-12141247 ATGGGAGAGCTGGGAGTAGCTGG - Exonic
1144178276 17:12729321-12729343 TTGGAGCGTGTGGGAGTGGCGGG + Intronic
1144943045 17:18954481-18954503 CTGGCCCAGCTGGGAGCGGCTGG + Intronic
1145251070 17:21297337-21297359 AGCCAGCAGCAGGGAGTGGCGGG + Intronic
1146919737 17:36702681-36702703 ATGGAGCAGCAGGGTTGGGCAGG + Intergenic
1146941041 17:36844780-36844802 AAGGAGCAGCTGGGAGAGTCAGG + Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147600174 17:41740303-41740325 GGGAAGCAGCTGGGAGTGGGGGG + Intergenic
1148342492 17:46881652-46881674 ATTGAGCAGCTGGAGGTGGAGGG - Intronic
1148787425 17:50152151-50152173 AGGAAGCAGCTGGGAGTGGGGGG - Intergenic
1149586004 17:57787320-57787342 GTAGAGCAGCTGTGAGTGGTGGG + Intergenic
1150437590 17:65166006-65166028 CTGGAGCAACTGGGGCTGGCTGG + Intronic
1150526135 17:65924947-65924969 ATGGAGGGGCTGGGAGGGGAAGG - Intronic
1151516624 17:74600633-74600655 ATGGAGCAGCTCAGAGTTACAGG + Intergenic
1151571550 17:74928451-74928473 ATGGATCAGATGGGAGAGCCCGG + Intronic
1151947795 17:77329025-77329047 CTGGGGAAGGTGGGAGTGGCTGG + Intronic
1152376676 17:79922221-79922243 ATGGGGCTGGTGGGAGGGGCTGG - Intergenic
1152551190 17:81031169-81031191 TGGGAGCAGCTGGGCCTGGCCGG - Intergenic
1152661966 17:81546659-81546681 CAGGAGCAGCTGGGAGAGGGAGG + Intronic
1152750238 17:82059235-82059257 ATGAGGCAGCTGGGAGAGGCAGG - Intronic
1152789955 17:82273530-82273552 ATTGAGGCGCTGGGAGCGGCGGG - Exonic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1152946277 17:83199169-83199191 CAGGAGCAGCTGGGAGAGGAGGG - Intergenic
1155056137 18:22185412-22185434 ACTGAGAAGCTGGGAGTGGCTGG + Intronic
1156278610 18:35610148-35610170 ATTGGGCAGCTGGGAGTGGTTGG + Intronic
1156432047 18:37085519-37085541 ATGGGGGAGATGGGAGGGGCAGG + Intronic
1156498090 18:37538972-37538994 AGGGAGCTGCTGGGAGCAGCAGG - Intronic
1157265071 18:46211611-46211633 ATGGTCCAGTTGGGTGTGGCAGG + Intronic
1157523386 18:48360816-48360838 ATGCAGCAGCTGGTGGTGGTGGG + Intronic
1157584642 18:48793247-48793269 AGGGAGAAGCAGGGAGGGGCAGG + Intronic
1158890590 18:61868356-61868378 CAGGATCAGCTGGGGGTGGCTGG - Intronic
1160378120 18:78429439-78429461 ACAGAGCAGATGGGAGAGGCTGG - Intergenic
1160515679 18:79478125-79478147 AGGGAGCACCTGGGGGTGGGCGG - Intronic
1160871062 19:1278266-1278288 AGGGAACAGCAGGGAGCGGCCGG + Intronic
1161385034 19:3986847-3986869 AGGGAGCAGATGGGAGCGCCCGG + Intergenic
1161399848 19:4062372-4062394 TCGGAGCAGCTGGGGGAGGCTGG + Intronic
1161502239 19:4622780-4622802 CTGGAGAAGGTGGGAGAGGCTGG + Intergenic
1161933528 19:7356944-7356966 AGGGAGCAGATGGGAGTGCCAGG + Intronic
1162788745 19:13052253-13052275 AGGCAGCAGCTGGCAGAGGCAGG - Intronic
1163013736 19:14441167-14441189 CTAGAGCAGCTGGGCCTGGCCGG + Exonic
1163609241 19:18292497-18292519 CTGGAGGAGCTGGGAGGGGGCGG - Intergenic
1163715434 19:18870012-18870034 GTGGAGGAGCTGGGGGTCGCCGG - Exonic
1163738605 19:18996978-18997000 AGGGGACAGGTGGGAGTGGCTGG + Intronic
1165286568 19:34847615-34847637 CTAGAGGAGCTGAGAGTGGCTGG - Intergenic
1165742477 19:38211999-38212021 ATTGAGGAGCTCGGAGAGGCAGG + Exonic
1165743403 19:38216843-38216865 AGGGTGCAGTTGGGAGTGGCTGG - Intronic
1165879604 19:39032644-39032666 AGGGAGCAGGCGGGAGGGGCTGG - Intronic
1166059568 19:40317560-40317582 CTGGAGCAGCTGGGAGGTGGAGG + Intergenic
1166114000 19:40641580-40641602 ATGGAGAATCTGGGAGGCGCAGG + Intergenic
1166438977 19:42793945-42793967 ATGGAGCAGCTGAGAATTTCTGG - Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1166947100 19:46404097-46404119 AGGGGGCAGGTGGGCGTGGCGGG + Intergenic
1167096943 19:47379664-47379686 AGGGAGTAGGTGGGAGGGGCAGG - Intronic
1167217470 19:48174073-48174095 ATGAGGCAGCAGAGAGTGGCAGG - Intronic
1167286908 19:48603549-48603571 ATGGAGCGGCTGGGCCGGGCCGG + Exonic
1168321317 19:55511723-55511745 CTGGAGAAGCTGGCAGGGGCTGG + Intronic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925070979 2:965962-965984 TGGGAGCAGCTGGGAGGAGCCGG - Intronic
925310795 2:2880168-2880190 ATGGAGCAGCTAAGATTGGTAGG - Intergenic
925764275 2:7215614-7215636 ATGGGGCAGGTGGGAGCGACAGG + Intergenic
925894416 2:8460322-8460344 ATGGAGCAGCGGGGGGTGGAGGG - Intergenic
926018450 2:9474546-9474568 ATGGAGCAGCCGGGCGGGGCGGG - Exonic
926459416 2:13110349-13110371 ATGCAGCAGGTGGGTGGGGCAGG - Intergenic
926806767 2:16718366-16718388 ACAGAGCATCTGGGAGGGGCAGG - Intergenic
927711340 2:25328326-25328348 ATGATGCAGCTGGGAGAGGTGGG - Intronic
930232358 2:48856337-48856359 ATAGACCAGTTCGGAGTGGCCGG - Intergenic
930999646 2:57764923-57764945 ATGGAGGAGCTGGGAGGTGGAGG - Intergenic
931823025 2:65971597-65971619 TGGGAGCAACTGGGAGTGTCTGG + Intergenic
932417907 2:71584739-71584761 GGGGAGAAGCTGGGAGAGGCTGG + Intronic
932432616 2:71685028-71685050 AGGGTGCAGCTGGCAGGGGCTGG - Intronic
933857423 2:86429262-86429284 GTGGAGTTGCTGGCAGTGGCAGG - Intergenic
934680661 2:96281590-96281612 ATTCAGCAGCTGGGAGAGGTAGG - Intronic
934708174 2:96499319-96499341 ATCCAGCACCTGGGAGTGGAGGG - Intronic
935213172 2:100955690-100955712 CTGAAGCAGCAGTGAGTGGCTGG + Intronic
935698527 2:105790477-105790499 ATGGGGCAGGCGGGGGTGGCCGG - Intronic
937911129 2:127076073-127076095 GGGGAGCAGCTGGGAGGGCCTGG - Intronic
938308558 2:130270055-130270077 TTGGGGCAGCTGGGAGAGGCAGG + Intergenic
938446772 2:131386781-131386803 TTGGGGCAGCTGGGAGAGGCAGG - Intergenic
938537092 2:132256291-132256313 AGGGAGCAGCTTGGGGTGGTGGG + Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
940463288 2:153995811-153995833 AGGGAGAAGGTGGGAGTGGTAGG - Intronic
940905012 2:159161082-159161104 ATGGAGCAGCTGAGGATGGCTGG - Intronic
941014135 2:160335305-160335327 ATGGAGTAGCTGGGAGAAGGAGG + Intronic
941064239 2:160882956-160882978 AAGGAGCAGCTGGGGGTAGAGGG + Intergenic
941517133 2:166493874-166493896 ATGGGGCAGGTGGGAGTGGATGG + Intronic
944090509 2:195904700-195904722 AGGGAGCAGCAAGGTGTGGCAGG + Intronic
947604758 2:231478803-231478825 AGGGGGCAGTTGGGAGTGGCTGG - Intronic
948447636 2:238045347-238045369 ATTGAACAGCTGAGAGGGGCTGG + Intronic
948461711 2:238132850-238132872 ATGGCCCAGCAGGGAGTGGCAGG + Exonic
948596584 2:239083291-239083313 AGGGAGCAGGTAGGAGTGCCTGG - Intronic
948652381 2:239456383-239456405 ATGATGCAGTTGGGACTGGCTGG - Intergenic
948678258 2:239611800-239611822 CAGCAGCAGCTGGGACTGGCAGG - Intergenic
948699969 2:239753358-239753380 ATGGAGCAGCAGGGAAGGGGTGG - Intergenic
1168805099 20:667964-667986 TTGGAGGAGCTGGGAGTGGAGGG - Intronic
1169142340 20:3233629-3233651 ATGGTACAGCTGGCAGGGGCGGG + Exonic
1169450522 20:5706849-5706871 ATGGGTCAGATGGGAGTGGCTGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1171400278 20:24868712-24868734 ATGAAGCAGGAGGGAGTGACAGG - Intergenic
1171866005 20:30488070-30488092 AGGGAGCAGCTCGGGGTGGTGGG + Intergenic
1172764378 20:37343480-37343502 ATTGTGCAGTTGGGAGTTGCTGG - Intergenic
1172809868 20:37639752-37639774 CTGGAGCAGCTGGAAGATGCTGG + Intergenic
1172842759 20:37911934-37911956 ATGGAGCTGGTGGGAGTGGTAGG + Intronic
1173188614 20:40859781-40859803 CTGGAGCTGCTGGTAGTGGTGGG - Intergenic
1173342131 20:42162111-42162133 AGAGAGCAGCTGGGAGGGTCAGG - Intronic
1173707658 20:45124336-45124358 ATGGTGGAGCTGGGTGGGGCTGG - Intronic
1174218995 20:48937293-48937315 ATGGAGGGGCTGGGAGAGGGCGG - Intronic
1175631525 20:60542143-60542165 GGGGAACAGCTGGGAGTAGCTGG - Intergenic
1175656096 20:60772516-60772538 ATGCAGCAGCTAGGAGCAGCAGG + Intergenic
1175935598 20:62512546-62512568 AAGGAGCAGCAGGGGGTGGGTGG - Intergenic
1176110873 20:63410167-63410189 ATGGAGGAGATGGGAGTCCCTGG + Intronic
1176124557 20:63469701-63469723 CTGGGGCAGCCGGGAGTGGGGGG - Intronic
1176304010 21:5114104-5114126 GAGAAGCAGCTGGGAGTGGTGGG + Intergenic
1176304025 21:5114144-5114166 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304038 21:5114184-5114206 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304050 21:5114224-5114246 ATGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176304063 21:5114264-5114286 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304076 21:5114304-5114326 GTGGAGGAGCTGGGAGTGGTGGG + Intergenic
1176304088 21:5114344-5114366 GTGGAGCAGCTGGGAGTGGTGGG + Intergenic
1176304100 21:5114384-5114406 GTGGAGCAGCTGGGAATGGTGGG + Intergenic
1176304115 21:5114443-5114465 GTGGAGCAGCTGGGAGTGCTGGG + Intergenic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1178174895 21:30085588-30085610 TTGGTGTAGCTGGGAGCGGCAGG + Intergenic
1178570207 21:33728876-33728898 ATGGGGCAGGGGGGAGTGGGGGG - Intronic
1179396790 21:41047337-41047359 GTGGAGCATATGGAAGTGGCTGG - Intergenic
1179852941 21:44147587-44147609 GTGGAGCAGCTGGGAGTGCTGGG - Intergenic
1179852956 21:44147646-44147668 GTGGAGCAGCTGGGAATGGTGGG - Intergenic
1179852968 21:44147686-44147708 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179852981 21:44147726-44147748 GTGGAGCAGCTGGGAGTGGTGGG - Intergenic
1179852993 21:44147766-44147788 GTGGAGGAGCTGGGAGTGGTGGG - Intergenic
1179853006 21:44147806-44147828 GTGGAGGAGCTGGGAGTGGTAGG - Intergenic
1179853020 21:44147846-44147868 GAGAAGCAGCTGGGAGTGGTGGG - Intergenic
1179936857 21:44611581-44611603 ATGGAACAGGTAGGGGTGGCAGG + Intronic
1180071299 21:45436954-45436976 GGGGAGCAGCTGGCTGTGGCAGG + Intronic
1180077184 21:45468816-45468838 CTGGAGCAGCTGGGATGGGGTGG + Intronic
1180163001 21:46006436-46006458 ATGAGGCAGCTGAGAGAGGCTGG - Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180900530 22:19368913-19368935 ATGGGGCATCTGGCAGAGGCAGG - Intronic
1181035812 22:20169332-20169354 GTGGAGCAGCCGGTGGTGGCTGG + Intergenic
1181171262 22:21011554-21011576 GAGAACCAGCTGGGAGTGGCAGG - Intronic
1181178083 22:21048965-21048987 GAGAACCAGCTGGGAGTGGCAGG + Exonic
1181484138 22:23219870-23219892 AAGGAGCGGCTGAGAGCGGCCGG - Intronic
1181537974 22:23556490-23556512 GAGGAGCAGCTGGGAGCAGCAGG + Intergenic
1181779955 22:25185349-25185371 ATGTAGCAGGTGGCAGTGGGCGG - Intronic
1182619093 22:31608665-31608687 ATGGAGGAGCTTGGGGTGGTTGG + Intronic
1183093444 22:35539063-35539085 ATGGGGCAGGTGGGGGTGGAGGG - Intergenic
1183530089 22:38348675-38348697 ATGGAGGAGGTGGGACTGGTAGG - Intronic
1183650040 22:39148564-39148586 TTCTAGCAGCTGGGTGTGGCGGG + Intronic
1184215931 22:43067235-43067257 ATGAAGCATCTGGGAGGAGCCGG - Intronic
1184675713 22:46041911-46041933 CTGGAGTAGCTGGGAGTTACAGG + Intergenic
1184947241 22:47812205-47812227 CAGGAGGAGCTGGGAGAGGCAGG + Intergenic
1185411334 22:50684495-50684517 AAGGAGCAGCTGGGGCTGGCTGG + Intergenic
1203310302 22_KI270736v1_random:138046-138068 ATGGAGTAGATTGGAGTGGAAGG + Intergenic
949184641 3:1175503-1175525 ATGAGGCAGCAGGGAGAGGCAGG + Intronic
949900943 3:8814365-8814387 AGGGAGCATCTGGGAGAGGAGGG - Intronic
950025869 3:9819577-9819599 AAGGAACAGCTTGGAGTGGAGGG + Intronic
950335169 3:12187559-12187581 GTGGAGCAGCCAGGGGTGGCTGG - Exonic
950365428 3:12480248-12480270 AGGGAGGAGCTGGGCCTGGCCGG - Intergenic
950453472 3:13078797-13078819 CTGGGGCAGCTGGGAGAGGGAGG - Intergenic
951675071 3:25229857-25229879 ATGGATGAGCTGGGTGTGACAGG + Intronic
952878771 3:37969972-37969994 ATGGAGCAGGTGAGAATGGCAGG - Intronic
953183759 3:40619851-40619873 AAGGAGGAGGTGGGTGTGGCAGG - Intergenic
954005619 3:47588211-47588233 AAGGAGCAGCTGAGGCTGGCGGG + Exonic
954455798 3:50599249-50599271 CTGGGGCAGCTGGCAGTGGGTGG - Intergenic
956020401 3:64927760-64927782 ATGGTGCAGGTGGGGGTGGGAGG - Intergenic
960330653 3:116356432-116356454 ATGGAGGTGGTGGGAGTGGGTGG + Intronic
960754925 3:121001106-121001128 ATGCATGTGCTGGGAGTGGCAGG + Intronic
961078147 3:124000904-124000926 ATGAAGCAGTTGGCAGTGGTTGG - Intergenic
961620578 3:128220883-128220905 ATGGCACAGCTGGCAGTGCCAGG + Intronic
962467019 3:135670044-135670066 ATGGTGAGGCTGGGAGTGGGAGG - Intergenic
963833133 3:150030136-150030158 AAGGAGCAGCTGGGAGCAGGGGG + Intronic
964626753 3:158767115-158767137 ATGGAGGAGCTGGAAATTGCAGG - Intronic
966722672 3:183079965-183079987 CTGGAGCAGCTGGGACTGAGGGG + Intronic
967115231 3:186331614-186331636 GTGGGGGAGCTGGGAGTGGCTGG + Intronic
967150070 3:186640404-186640426 GTGGAGCTGCAGGGACTGGCTGG - Exonic
968525062 4:1052514-1052536 ATGGAGCAGCAGAGACTGGCAGG - Intergenic
968775308 4:2536600-2536622 AAGGAGCAGCGGGGAGGGGGAGG - Intronic
968902111 4:3436680-3436702 CCAGAGCAGCTGGCAGTGGCTGG + Intronic
968933553 4:3597374-3597396 CTGGAGCAGAAGGGAGGGGCGGG + Intergenic
968984994 4:3870165-3870187 ATGGAGCAGAAGGGACGGGCCGG + Intergenic
969284783 4:6196348-6196370 GTGGATCAGCAGGGAGGGGCAGG - Intronic
969472627 4:7398270-7398292 TTGGAGCAGCTGTGAGTGGGTGG - Intronic
969583871 4:8080891-8080913 CTGGGGCAGCCGGGAGGGGCGGG + Intronic
969644174 4:8416942-8416964 GTGGACCAGCTGGCACTGGCTGG - Intronic
969711812 4:8849052-8849074 ATGGAGCAGCGGGCAGGGGGAGG - Intronic
970764756 4:19534238-19534260 ATTCTGCAGCTGGGAGTGGAAGG + Intergenic
972099110 4:35390397-35390419 CTGGAGCAGCTGGGACTTACAGG - Intergenic
973324531 4:48845182-48845204 ATGAGGCAGTTGGGAGTAGCTGG - Intronic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
974691822 4:65306153-65306175 ATGAAGCATATGGGAGTTGCGGG - Intergenic
974839292 4:67282863-67282885 ATGGAGCAGGGGGCAGTGCCTGG + Intergenic
976793916 4:88911294-88911316 ACGGAGCAGCTCAAAGTGGCTGG + Intronic
977878462 4:102176765-102176787 TTGGAGCTGCTGGGAGTGTTAGG - Intergenic
979116323 4:116829316-116829338 GTAGAGCAGCTGGGATGGGCTGG - Intergenic
980552340 4:134355513-134355535 ATGGAGGAGCTGAGAGTCGATGG + Intergenic
980994430 4:139766597-139766619 AGAAAGCAGCTGGGTGTGGCCGG - Intronic
984405082 4:179319061-179319083 ATGTAGCAGTTAGGTGTGGCGGG + Intergenic
985639621 5:1057635-1057657 GTGGATCAGCTGGGCCTGGCGGG + Exonic
986067768 5:4252228-4252250 ATGGAGCAGCTGATAGGCGCAGG - Intergenic
986253325 5:6081269-6081291 ATGGAGAGGCTGGGAGGCGCAGG - Intergenic
986788711 5:11139877-11139899 ATGTAGAAGCTGGGAAAGGCAGG - Intronic
988484161 5:31654617-31654639 ATGAAGCATCTGGAAGGGGCAGG - Intronic
988628325 5:32900953-32900975 ACAGAGCAGCTGGGGGTGGGAGG + Intergenic
992436526 5:76760317-76760339 ATGAAGCAGGAGGGATTGGCAGG + Intergenic
993086292 5:83367701-83367723 GTGGAGAAGATGGGAGAGGCTGG + Intergenic
994183334 5:96791457-96791479 ATAGAACAGTTGGGAATGGCAGG + Intronic
995319640 5:110818971-110818993 ATGGAGCAAATAGGAGAGGCTGG - Intergenic
995394436 5:111672645-111672667 GTGGAGCAGCTGGGGGCGGTGGG - Intronic
996804821 5:127442746-127442768 ATGTAGCAGCTGAAAGTGTCAGG + Intronic
997372499 5:133370862-133370884 ATGGAGCAACAGGGAAAGGCAGG + Intronic
997739718 5:136242983-136243005 AATGAGAATCTGGGAGTGGCCGG + Intronic
998102914 5:139449166-139449188 GTGGAGCAGCTGGGGGAGGAAGG + Exonic
998171070 5:139872297-139872319 ATGGTGGACCAGGGAGTGGCTGG + Intronic
998262628 5:140642908-140642930 ATGGAGCTGCTGGCAGAAGCAGG - Exonic
998664988 5:144287067-144287089 GGGGAGGAGCTGGGAGTGGCTGG + Intronic
998830492 5:146152586-146152608 ATGGACCAGCAGGGTGTGGTAGG - Intronic
999198976 5:149802684-149802706 ATGGGGCAGCTGGGGCTGGGAGG + Intronic
999879657 5:155847729-155847751 CTGGAACAGGTGGGACTGGCTGG - Intergenic
1000048445 5:157541155-157541177 ATGGGGCAGCTGGGCTGGGCCGG - Intronic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001567080 5:172706819-172706841 CTGGAGCAGCTGAGTGTTGCTGG - Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1003124653 6:3346653-3346675 ATGGTGCAGCTGGGAGTAGCTGG - Intronic
1003660522 6:8056499-8056521 CTGGAGAAGGTGGCAGTGGCGGG - Intronic
1003793502 6:9574235-9574257 CAGGAACCGCTGGGAGTGGCAGG + Intergenic
1006313078 6:33275145-33275167 CTGCATCAGCTTGGAGTGGCAGG + Intronic
1006720294 6:36145668-36145690 AAGGAGCTGCTGGGTGTGCCCGG + Intergenic
1006928729 6:37674432-37674454 CTGGAGCTTCTGGGAGAGGCTGG + Intronic
1010134264 6:72532091-72532113 AGGGAGCCACAGGGAGTGGCAGG - Intergenic
1010629074 6:78175481-78175503 GTGGAGCTGCTGTCAGTGGCTGG - Intergenic
1011008083 6:82670670-82670692 ATGGTGCTGCTGGTGGTGGCGGG + Intergenic
1012213328 6:96551221-96551243 ATGGAGCAGGTGGGAGGAGCAGG + Intronic
1012387603 6:98700183-98700205 CTGGAACAGCTAGGACTGGCCGG - Intergenic
1013731198 6:113169484-113169506 TGGGAGCAGAAGGGAGTGGCTGG + Intergenic
1013971798 6:116029026-116029048 ATGGAGGAGCTTGGTGTGGCTGG - Intronic
1014397349 6:120942019-120942041 ATAGAGAAGCTGGGAGAGACTGG + Intergenic
1015311608 6:131773032-131773054 ATGGATCAGCTGGCACTGCCAGG - Intergenic
1016942672 6:149496424-149496446 ATGGAGGAGGTGGGAGGGGGCGG - Intergenic
1017061685 6:150490787-150490809 AAGGAGCACCTGGGAGGGGAGGG + Intergenic
1017935957 6:159005476-159005498 ATGGGGGATCTGGGAGTGGGAGG - Intergenic
1018670305 6:166171529-166171551 CTAGAGCAGCAGGGAGGGGCCGG - Intergenic
1018856076 6:167676368-167676390 AGGAAGCAGCTGGGAAAGGCTGG + Intergenic
1019373184 7:674209-674231 TTGGAGTAGCTGGGTGTGGCTGG - Intronic
1019373193 7:674256-674278 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019373206 7:674351-674373 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019373211 7:674389-674411 ATGGAGTAGCTGGGCATGACTGG - Intronic
1019373251 7:674643-674665 CTAGAGTAGCTGGGTGTGGCTGG - Intronic
1019781364 7:2942179-2942201 ATGGTGCAGAAGGGAGTGGAAGG - Intronic
1020550745 7:9601177-9601199 AGGGGGCAGGTGGGAGTGGATGG + Intergenic
1021922302 7:25497531-25497553 TGGAAGAAGCTGGGAGTGGCAGG - Intergenic
1024676027 7:51638558-51638580 ATGGGGCAGCTGGAACTGCCAGG - Intergenic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1025257606 7:57395779-57395801 CTGGAGCCCCTGGGAGGGGCGGG + Intergenic
1026470276 7:70689244-70689266 TGGGAGTAGCTGGGAGTAGCTGG - Intronic
1026566166 7:71491294-71491316 ATTGAGTAGCTGGCAGTGACGGG + Intronic
1026766060 7:73160577-73160599 GAGGAGCATCTGGGTGTGGCTGG + Intergenic
1026878550 7:73893820-73893842 AGTGTGCAGCTGGGAGTGGAGGG + Intergenic
1027042535 7:74970273-74970295 GAGGAGCATCTGGGTGTGGCTGG + Intronic
1027081108 7:75232084-75232106 GAGGAGCATCTGGGTGTGGCTGG - Intergenic
1027432922 7:78132940-78132962 ATGGGGCTGTTGGGGGTGGCTGG + Exonic
1028117425 7:87015710-87015732 TGGGAGTAGCTGGGAGTAGCTGG - Intronic
1028117427 7:87015720-87015742 TGGGAGCAGTTGGGAGTAGCTGG - Intronic
1028999202 7:97135340-97135362 TTGGAGCAGCTAAGAGAGGCAGG - Intronic
1029354105 7:100038354-100038376 ACGGAGCAGCGGGGAGAGGAAGG + Exonic
1029846719 7:103419357-103419379 AGGGAGCAGGGGGCAGTGGCAGG - Intronic
1030069794 7:105688806-105688828 ACGGAGCAGGTGTGAGTAGCTGG + Intronic
1030172669 7:106619724-106619746 CTTGAGCAGCTGGGAGGGGCAGG - Intergenic
1032054430 7:128673043-128673065 ATGGGGCCACTGGGAGTGGAAGG + Intronic
1032384664 7:131513391-131513413 CTGGAGCAGAAGGGAGTGGTGGG + Intronic
1032453691 7:132056006-132056028 ATGGAGCAGGTGGCCCTGGCTGG - Intergenic
1032613616 7:133442694-133442716 ATGGAGGAGGTGGGAGTAGATGG + Intronic
1034959347 7:155355358-155355380 ATGCAGAAGATGGGAGGGGCTGG + Intergenic
1035328664 7:158082457-158082479 ATGGAGGAGCTGGCCCTGGCTGG - Intronic
1035459896 7:159032144-159032166 AGGGGGCAGCTGGGTGTGGGAGG + Intronic
1036029997 8:4959514-4959536 ATGGAGCAGCTGGAAGTTGTTGG - Intronic
1036495066 8:9262821-9262843 ATGGGGCAGCCAGGAGTGGTGGG - Intergenic
1036658705 8:10693801-10693823 AAGGAGCAGATCTGAGTGGCAGG - Intronic
1037501097 8:19486272-19486294 AGGCAGCAGGTGAGAGTGGCTGG - Intronic
1037537864 8:19843701-19843723 AGGGAGCAGATGGGAGTAGGTGG - Intronic
1038933843 8:32225565-32225587 ATGGAGCATTTGGGGGTGCCAGG + Intronic
1039058736 8:33556867-33556889 AGGTAGCACCTGGGAGTGGTGGG + Intronic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1040496546 8:47970617-47970639 CTGCAGCAGCTGGGACTTGCTGG - Exonic
1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG + Intergenic
1041097735 8:54366184-54366206 AGGGAGCAGCAGGGAGTGAAGGG - Intergenic
1041468572 8:58183161-58183183 ATAGAGCAACTGGGCCTGGCTGG + Intronic
1043059523 8:75482358-75482380 ATGGAGCAGAAGGGAGGGGAGGG - Intronic
1043929084 8:86069697-86069719 AAAGAGCAGCTGCGAGGGGCGGG + Exonic
1044345276 8:91097611-91097633 CTGGAGCAGGAGGGAGTGGGGGG + Intergenic
1044385930 8:91588247-91588269 ACTGAGTAGCTGGGAGAGGCTGG - Intergenic
1044604829 8:94039501-94039523 ATGGATTAGATGGAAGTGGCAGG + Intergenic
1044632119 8:94290139-94290161 ATGAGGCAGCTGGGCATGGCAGG + Intergenic
1045404141 8:101848257-101848279 ACGGAGCAGCAGGGAGTTACAGG + Intronic
1045539241 8:103066850-103066872 ATGGCGTAGCTGGGCGTGGTGGG + Intronic
1045549914 8:103162418-103162440 ATGGAACAGCTGGGACTGGTTGG + Intronic
1046875623 8:119251731-119251753 ATTGAGCAGCTCTGGGTGGCTGG + Intergenic
1046915998 8:119678981-119679003 ATGGCCCAGCTGGGACAGGCTGG - Intergenic
1047448093 8:124937751-124937773 ATGGAGAAGCCGGGCTTGGCTGG - Intergenic
1048173317 8:132129329-132129351 ATGGAGCCGCTGGGCGTGAAGGG + Exonic
1049111440 8:140646773-140646795 CTGGCGCAGCTGCGTGTGGCTGG - Intergenic
1049416981 8:142499761-142499783 ATGGAATAGCTGGGGGTAGCGGG + Intronic
1049832199 8:144708628-144708650 AGGGAGCAGCTGGCAATAGCAGG - Intergenic
1049953971 9:674271-674293 AAGGATCAGCAGGGAGTGGATGG + Intronic
1051089478 9:13389263-13389285 ATGGAGCAGGGGGGATTGGGGGG + Intergenic
1051106583 9:13587667-13587689 ATGGAGCAGAAGGGGGTGGATGG - Intergenic
1051225630 9:14896175-14896197 ATGGTGCTGGTGGGAGTGGGAGG - Intronic
1051372438 9:16370064-16370086 CTGGAGAAGCTGGGAATGGGTGG + Intergenic
1051628657 9:19122829-19122851 ATGGACCAGCAGGGGGTGGGTGG - Intronic
1052728933 9:32262717-32262739 ATGGAGCAGCAATGAGGGGCAGG - Intergenic
1053517910 9:38747186-38747208 ATGGAGCAGGGGGCCGTGGCTGG + Intergenic
1056848344 9:90059394-90059416 GTGGAGGGGCTGGGAGAGGCAGG + Intergenic
1056933878 9:90900776-90900798 ATGGAGCAGGAGGGGGTGGGAGG - Intergenic
1057226139 9:93294306-93294328 CTGGAGCTGCTGGGAGAGGCAGG + Intronic
1060035756 9:120254349-120254371 AGGGAGCGGCTGGGGGTGGGAGG - Intergenic
1060297890 9:122355508-122355530 GAGGAGAAGCTGGGAGTGGGTGG - Intergenic
1060830278 9:126709403-126709425 ATGTAGGAGCTGGGATTGGGAGG + Intergenic
1060936917 9:127521464-127521486 CTGGAGCAGCTGGGGGTGGCAGG - Intronic
1061244014 9:129392072-129392094 GAGGAGCAGCTGGGAGCAGCAGG - Intergenic
1061538827 9:131266398-131266420 CTGCAGCAGCTGAGAATGGCTGG - Intronic
1061708997 9:132474598-132474620 ATGGAGCTGCTGGGGGTTGGTGG + Intronic
1061733966 9:132639468-132639490 ATGTGGCACCTGGGACTGGCAGG + Intronic
1061785179 9:133023501-133023523 ATGCAGCGGCTGGGGTTGGCAGG + Intergenic
1062287030 9:135777898-135777920 AGGGAGGAGCTGGGAGTGAGGGG - Intronic
1203775134 EBV:68682-68704 CTGGAGTGGCTGGGAATGGCAGG - Intergenic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1186192016 X:7075695-7075717 ATGGAGGTGCTGGGAGGGTCAGG + Intronic
1186297053 X:8161007-8161029 ATGGAACAGCTGGGAGAGCTGGG - Intergenic
1186354948 X:8781566-8781588 ATGGAACAGCTGGGAGAGCTGGG + Intergenic
1186377092 X:9015927-9015949 ATGGAACAGCTGGGAGAGCTGGG + Intergenic
1187069781 X:15877145-15877167 ATGGAGAAGTTGGAAGGGGCAGG + Intergenic
1187383208 X:18824143-18824165 TTTGAAAAGCTGGGAGTGGCCGG + Intronic
1191898986 X:66022121-66022143 CTGGAGCCGCTGGGAGTCACTGG - Exonic
1192705447 X:73524968-73524990 ATGGGAAAGCTGGGAGTAGCTGG + Intergenic
1193512677 X:82424328-82424350 TTGGAGCAGCTGTGAGTGTATGG + Intergenic
1194917260 X:99721867-99721889 ATGGCCCACCTGGGAGTGGCAGG + Intergenic
1195218976 X:102728484-102728506 ATGGAGCAGCTGGGTTTTCCAGG + Intronic
1195716741 X:107825913-107825935 CTGGGGGAGCTGGGAGTGGCGGG + Exonic
1196868171 X:120087895-120087917 CCAGAGCAGCTGGGGGTGGCAGG - Intergenic
1197275284 X:124471930-124471952 GGGGAGCAGGTGGGAGTGGTTGG + Intronic
1197297497 X:124737036-124737058 CTGGAGCAGCTGGGCTGGGCTGG + Exonic
1197710964 X:129667032-129667054 ATGGAGCAGAGGGGAGGGGCTGG - Intergenic
1197710988 X:129667102-129667124 ATGGAGGAGAGGGGAGGGGCTGG + Intergenic
1198728509 X:139702130-139702152 ATGGAGCATATGGGAGTAGGGGG - Intronic
1200131577 X:153851162-153851184 ATTGAGGAGATGGCAGTGGCGGG - Intergenic
1200259031 X:154602250-154602272 ATGGAGGGGCTGGGGGAGGCTGG + Intergenic
1202610654 Y:56675941-56675963 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202611312 Y:56681494-56681516 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202611732 Y:56685078-56685100 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202612145 Y:56688636-56688658 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202612570 Y:56692215-56692237 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202612991 Y:56695774-56695796 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202613406 Y:56699353-56699375 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202613831 Y:56702932-56702954 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202614253 Y:56706501-56706523 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202614661 Y:56710015-56710037 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202615081 Y:56713599-56713621 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202615498 Y:56717173-56717195 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202615916 Y:56720718-56720740 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202616335 Y:56724306-56724328 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202616760 Y:56727900-56727922 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202617179 Y:56731482-56731504 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202617599 Y:56735056-56735078 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202618014 Y:56738600-56738622 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202618435 Y:56742179-56742201 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202618853 Y:56745758-56745780 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202619275 Y:56749348-56749370 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202619685 Y:56752822-56752844 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202620109 Y:56756386-56756408 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202620523 Y:56759935-56759957 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202621356 Y:56767058-56767080 ATGGAGTAGATGGGATTGGATGG + Intergenic
1202621775 Y:56770646-56770668 ATGGAGTAGATGGGATTGGATGG + Intergenic