ID: 1133188483

View in Genome Browser
Species Human (GRCh38)
Location 16:4116472-4116494
Sequence CCGCGCGTGCGCGCTGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133188483_1133188488 4 Left 1133188483 16:4116472-4116494 CCAGCCGCAGCGCGCACGCGCGG No data
Right 1133188488 16:4116499-4116521 CGCTCGCCGCCACCGCCTCCTGG No data
1133188483_1133188490 10 Left 1133188483 16:4116472-4116494 CCAGCCGCAGCGCGCACGCGCGG No data
Right 1133188490 16:4116505-4116527 CCGCCACCGCCTCCTGGCCCCGG No data
1133188483_1133188496 23 Left 1133188483 16:4116472-4116494 CCAGCCGCAGCGCGCACGCGCGG No data
Right 1133188496 16:4116518-4116540 CTGGCCCCGGACACGCGCACGGG No data
1133188483_1133188495 22 Left 1133188483 16:4116472-4116494 CCAGCCGCAGCGCGCACGCGCGG No data
Right 1133188495 16:4116517-4116539 CCTGGCCCCGGACACGCGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133188483 Original CRISPR CCGCGCGTGCGCGCTGCGGC TGG (reversed) Intergenic
No off target data available for this crispr