ID: 1133194424

View in Genome Browser
Species Human (GRCh38)
Location 16:4158832-4158854
Sequence AAGGAGGAGAAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133194418_1133194424 11 Left 1133194418 16:4158798-4158820 CCTGTCTCAAAAAAAGAAGAAGG No data
Right 1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG No data
1133194417_1133194424 12 Left 1133194417 16:4158797-4158819 CCCTGTCTCAAAAAAAGAAGAAG No data
Right 1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133194424 Original CRISPR AAGGAGGAGAAGAAAGAGGA AGG Intergenic
No off target data available for this crispr