ID: 1133198126

View in Genome Browser
Species Human (GRCh38)
Location 16:4184842-4184864
Sequence CGCTGTGTGTGGCGGGGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133198126_1133198132 -1 Left 1133198126 16:4184842-4184864 CCTTATCCCCGCCACACACAGCG No data
Right 1133198132 16:4184864-4184886 GGTCTTCCCTTGTCTGCGTCTGG No data
1133198126_1133198133 0 Left 1133198126 16:4184842-4184864 CCTTATCCCCGCCACACACAGCG No data
Right 1133198133 16:4184865-4184887 GTCTTCCCTTGTCTGCGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133198126 Original CRISPR CGCTGTGTGTGGCGGGGATA AGG (reversed) Intergenic
No off target data available for this crispr