ID: 1133198854

View in Genome Browser
Species Human (GRCh38)
Location 16:4190109-4190131
Sequence CAAGAACACCCGAGGTTCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133198854_1133198860 -9 Left 1133198854 16:4190109-4190131 CCCTGGAACCTCGGGTGTTCTTG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1133198854_1133198864 16 Left 1133198854 16:4190109-4190131 CCCTGGAACCTCGGGTGTTCTTG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1133198864 16:4190148-4190170 CTCCACAAAGCCAAACGCAACGG 0: 1
1: 0
2: 1
3: 17
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133198854 Original CRISPR CAAGAACACCCGAGGTTCCA GGG (reversed) Exonic
900009612 1:94298-94320 CACGAAGACCTGATGTTCCAGGG - Intergenic
900025722 1:270875-270897 CACGAAGACCTGATGTTCCAGGG - Intergenic
900301595 1:1980735-1980757 CATGAACAGCCGAGGGTCCTTGG - Intronic
901117237 1:6856998-6857020 CAGGGACACCCTAGTTTCCAAGG - Intronic
902937886 1:19777676-19777698 CAAGAAATCCCAAGGTTCCAGGG - Intronic
910842922 1:91578122-91578144 AAAGGACACCCTGGGTTCCAAGG + Intergenic
917793283 1:178513481-178513503 CAAGACCACTCATGGTTCCACGG + Intronic
920232378 1:204479295-204479317 CCAGTTCACCCCAGGTTCCAAGG + Intronic
922258025 1:223910192-223910214 CACGAAGACCTGATGTTCCAGGG - Intergenic
922607911 1:226902406-226902428 CCAGAACACCCCAGGGCCCACGG - Intronic
1062830044 10:599452-599474 CAAGAACAAACCAAGTTCCATGG + Intronic
1066263174 10:33748759-33748781 CAAGAACACCTGCACTTCCATGG + Intergenic
1068725098 10:60291912-60291934 CAAGAACAGCCTGGGTTACAAGG - Intronic
1073136509 10:101223393-101223415 CAAGACCATCCGAGGTCCCCGGG + Intergenic
1080897938 11:36461693-36461715 AAAGAACAGGCTAGGTTCCATGG - Intronic
1083954011 11:65972802-65972824 CAAGAAACCCACAGGTTCCATGG + Intronic
1084428377 11:69097832-69097854 CAAGAACACCTGAGGCTGCTGGG - Intergenic
1089791358 11:120946933-120946955 CTAGAACACCCGAGACTCCCTGG + Intronic
1091257626 11:134204045-134204067 CAAATACTCCCGAAGTTCCAAGG - Exonic
1094398260 12:30032317-30032339 CAATAGCACCCCAGGGTCCATGG - Intergenic
1096189739 12:49608649-49608671 GAAGAACACCCTAGGTCTCAGGG + Intronic
1096803722 12:54127675-54127697 CAGGAACACCCCGGGCTCCAGGG - Intergenic
1105270157 13:18865669-18865691 CAAGACCACCCCAGGTTTGATGG - Intergenic
1107050107 13:36037906-36037928 AAAGAACTTCCAAGGTTCCATGG + Intronic
1111347271 13:86974807-86974829 CATGAACAGCCTGGGTTCCATGG + Intergenic
1111760706 13:92460846-92460868 CTAGAACAACCTAGGATCCAAGG - Intronic
1112242485 13:97695541-97695563 CAAGAACACCGGAACTTCCTGGG - Intergenic
1123503295 15:20911980-20912002 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1123560543 15:21485645-21485667 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1123596781 15:21922941-21922963 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1202968890 15_KI270727v1_random:212809-212831 CAGGAGCAGCAGAGGTTCCAGGG - Intergenic
1133198854 16:4190109-4190131 CAAGAACACCCGAGGTTCCAGGG - Exonic
1133927016 16:10201544-10201566 AAACAACCCCCAAGGTTCCATGG - Intergenic
1140143671 16:72284921-72284943 CTAGAAAACCTGATGTTCCAGGG + Intergenic
1142454717 16:90212604-90212626 CACGAAGACCTGATGTTCCAGGG + Intergenic
1146283756 17:31560737-31560759 CAGGCAAACCCGAGGTTTCAGGG - Intergenic
1150211200 17:63442504-63442526 CAAGAACAGCCGGTGTCCCAGGG - Intronic
1152588907 17:81201490-81201512 CAACAACACCCAAAGCTCCAGGG - Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1158878735 18:61755899-61755921 CAAGAAAAACGGAGGTCCCAGGG - Intergenic
1160381232 18:78457660-78457682 CAAGGATACCCAAGTTTCCAAGG - Intergenic
1161617514 19:5280237-5280259 TAAGAAGGCCCGAGGTTCCAAGG + Intronic
1162839647 19:13346878-13346900 CAAGACCACCCTAGGCTACATGG - Intronic
1163287894 19:16360048-16360070 AAAAAACACCCAAGGTTTCAAGG - Intronic
1165789684 19:38483852-38483874 CAAGTACACCCCAGGATCCCTGG + Intronic
925538993 2:4946048-4946070 GAAGAACAAGAGAGGTTCCAGGG - Intergenic
925877859 2:8327899-8327921 CAAGAATACCAGAGCTTCCTGGG + Intergenic
928723658 2:34147797-34147819 CAAGAACAGCCCAGGGACCATGG - Intergenic
934562964 2:95322754-95322776 CAAGCACACCCCAGGCTCCCTGG - Intronic
934655036 2:96112965-96112987 CAAGAACACTGGGGGTCCCATGG + Exonic
936903175 2:117506991-117507013 CAAGAACGCCTGATGTTCCAGGG - Intergenic
939341000 2:140895903-140895925 CATGAAAACCCCAGGCTCCACGG - Intronic
943129315 2:183837593-183837615 CATGAACAGCCTAGGTACCATGG + Intergenic
944416768 2:199486925-199486947 CAAGATAACCTGAGGCTCCATGG + Intergenic
946469036 2:219939533-219939555 CAACAAGATCCAAGGTTCCACGG - Intergenic
948925474 2:241094021-241094043 CAACAACAGCCTAGGTTCTAGGG + Exonic
949086178 2:242157263-242157285 CACGAAGACCTGATGTTCCAGGG + Intergenic
1171052430 20:21872313-21872335 AAAGAACACCCTAGGTTGGATGG + Intergenic
1173163017 20:40666239-40666261 CAATAACACACGAGGCTCCTAGG + Intergenic
1173738430 20:45378188-45378210 CAAGAACAGCAGGGTTTCCAAGG - Exonic
1184099408 22:42334142-42334164 CAAGGCCACCCAAGGTCCCAGGG - Intronic
956227464 3:66975852-66975874 CAGGTACAGTCGAGGTTCCATGG - Intergenic
956486840 3:69731978-69732000 CAAGAACACCCTGGGTAACATGG - Intergenic
959753986 3:109874940-109874962 GAAGGACACCCCAGGTCCCAGGG + Intergenic
964582383 3:158254632-158254654 CAAGAACACCCTGGGTAACATGG - Intronic
965013893 3:163131515-163131537 CAAGAACAGCCTATGTGCCATGG + Intergenic
965139116 3:164813147-164813169 GAAGCAAACCAGAGGTTCCAGGG - Intergenic
968668462 4:1834453-1834475 CAAGAAGATCCCAGGTCCCAGGG - Intronic
976215081 4:82708513-82708535 CAAGACCACCCAGGATTCCAAGG + Intronic
978466711 4:109016376-109016398 CATGAACAGCCAAGGTGCCATGG + Intronic
979237903 4:118422251-118422273 CACGAAGACCTGATGTTCCAGGG + Intergenic
979738015 4:124112798-124112820 CAAATACACCTGAGTTTCCAGGG - Intergenic
980213718 4:129823320-129823342 CCAGAACACCATGGGTTCCATGG - Intergenic
981712243 4:147721036-147721058 CATGAAAACCAGAGGGTCCAAGG - Intergenic
982264021 4:153522066-153522088 CAAGAAAACCAGAGGTCCCAGGG - Intronic
982716198 4:158811115-158811137 TAAAAACACCCAAGGTTCCTGGG + Intronic
985525919 5:401564-401586 CAAGAACTCCAGGAGTTCCAGGG + Intronic
986653801 5:9990695-9990717 CAGGAAGACCCGAGCATCCAAGG + Intergenic
992779349 5:80113997-80114019 CAAGATAACCCGATGTTCCCAGG + Intronic
1002375347 5:178784891-178784913 CAAGAACACCCTAGGCAACATGG + Intergenic
1002678060 5:180935318-180935340 CATGAACAGCCCAGGTACCATGG - Intronic
1006845625 6:37059528-37059550 CAACAACACCCGGGGATCAAGGG + Intergenic
1010336081 6:74684944-74684966 CACAAACACCCGAGTTTTCAGGG + Intergenic
1011456251 6:87553058-87553080 CAAGATCACCCCAGATTCAAGGG - Intronic
1012053925 6:94380782-94380804 CAAGAACAGAGGATGTTCCAAGG - Intergenic
1017955472 6:159174019-159174041 CAAGAAATCCCTAAGTTCCATGG - Intronic
1018409485 6:163528818-163528840 CAATAACAACAGAGGTTCCATGG - Intronic
1021814309 7:24432770-24432792 CAAGAAGACTCGCGGGTCCAAGG + Intergenic
1027056395 7:75052749-75052771 CAAGAACATCCGAGGGTGCCTGG - Exonic
1027575652 7:79927375-79927397 AAAGAAAACATGAGGTTCCAAGG + Intergenic
1030837955 7:114311878-114311900 CAAAAACAAAAGAGGTTCCAGGG - Intronic
1032870869 7:135983506-135983528 CAAGAAAACCTGAGTTTCCTGGG + Intergenic
1038011132 8:23476675-23476697 CAGGAGCACCAGAGATTCCAGGG + Intergenic
1038517510 8:28199831-28199853 CAAGAACAGCTGAGGTCCCCAGG - Intergenic
1049140459 8:140949719-140949741 CATGAACAGCCTAGGTGCCATGG + Intronic
1049394691 8:142394494-142394516 CTAGAACCTCCGGGGTTCCAAGG + Intronic
1053123684 9:35563230-35563252 CAAGATCTCCTGAGGTTCCCAGG - Exonic
1057089747 9:92246628-92246650 CAAAATCACCCTAGGCTCCAGGG + Intronic
1060300106 9:122370033-122370055 CAAGATCACCCAAAGTCCCATGG - Intergenic
1061064665 9:128269927-128269949 CAAGGAAACACCAGGTTCCATGG - Intronic
1192267182 X:69546923-69546945 CAAAAACAGCCCAGGTACCATGG + Intergenic
1198268654 X:135033303-135033325 CAAGAACACAAGAGGTTTCTGGG - Exonic
1202385687 Y:24324052-24324074 CATGAAGACCTGATGTTCCAGGG + Intergenic
1202485099 Y:25346076-25346098 CATGAAGACCTGATGTTCCAGGG - Intergenic