ID: 1133198860

View in Genome Browser
Species Human (GRCh38)
Location 16:4190123-4190145
Sequence GTGTTCTTGTGGAAGGGTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133198855_1133198860 -10 Left 1133198855 16:4190110-4190132 CCTGGAACCTCGGGTGTTCTTGT 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1133198848_1133198860 29 Left 1133198848 16:4190071-4190093 CCTGGTCGACTCGTTCCTTGGAA 0: 1
1: 0
2: 0
3: 0
4: 26
Right 1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1133198852_1133198860 -1 Left 1133198852 16:4190101-4190123 CCTGAGTGCCCTGGAACCTCGGG 0: 1
1: 0
2: 0
3: 7
4: 142
Right 1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1133198849_1133198860 14 Left 1133198849 16:4190086-4190108 CCTTGGAAACATTGTCCTGAGTG 0: 1
1: 2
2: 13
3: 204
4: 1368
Right 1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 145
1133198854_1133198860 -9 Left 1133198854 16:4190109-4190131 CCCTGGAACCTCGGGTGTTCTTG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG 0: 1
1: 0
2: 0
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133198860 Original CRISPR GTGTTCTTGTGGAAGGGTCC AGG Exonic
900197907 1:1386435-1386457 GTGTGCTTGTGAAAGTGTCCAGG - Intronic
901248187 1:7750227-7750249 AGGTTCTTGCAGAAGGGTCCTGG + Intronic
904563122 1:31412075-31412097 GTGTGTTTGTGGAACAGTCCTGG + Intronic
904916578 1:33974855-33974877 TTGCTCTTGTAGAAGGGGCCAGG - Intronic
911684117 1:100754635-100754657 GTGTGCCAGTGGAAGGGTCTGGG + Intergenic
915231390 1:154448180-154448202 CTGTTCTTGTAAAAGGGTCAGGG + Intronic
918054291 1:181005381-181005403 TTGTTGCTGTGGAGGGGTCCTGG + Exonic
918056857 1:181029364-181029386 GTGTTGTGGTGGGAGGGACCTGG + Intergenic
918693081 1:187507078-187507100 CTGTTCTTCTGAAAGGGTCTTGG + Intergenic
920044618 1:203125322-203125344 GTCATCTTGTCTAAGGGTCCTGG + Intronic
922232646 1:223700133-223700155 GTGTTCTGGGAGTAGGGTCCTGG - Intergenic
922537562 1:226392396-226392418 GTGTCCTAGTGGAAGGATCCTGG - Intronic
923112514 1:230903529-230903551 GTGGTCTTAAGCAAGGGTCCAGG - Intergenic
1063742894 10:8844202-8844224 GTGTTCTTCTAGAAGGGTCTAGG + Intergenic
1066658211 10:37713820-37713842 GTGTGGCTGTGGAAGGCTCCTGG - Intergenic
1070416670 10:76196889-76196911 GTCTTCTGGTGGTAGGGTCCTGG + Intronic
1070760895 10:79023805-79023827 GTGTTCATGGGGAAGACTCCTGG - Intergenic
1073083010 10:100871670-100871692 GTGTTCTGGTGTCAGGGGCCAGG + Intergenic
1079360550 11:19766930-19766952 ATGATCCTGTGGAAGGCTCCAGG + Intronic
1081129373 11:39359333-39359355 GTGTTATTGTGAAATGGTGCTGG + Intergenic
1081237750 11:40666024-40666046 GTGTTCATGTGTACAGGTCCTGG + Intronic
1084396148 11:68911810-68911832 GGGTTGTTGAGGAAGGCTCCTGG + Intronic
1085419419 11:76342814-76342836 TTGTTATTGTGGCAGGGGCCTGG + Intergenic
1089330907 11:117688347-117688369 GTGTTCTCGGGGATGGGCCCAGG + Intronic
1089431795 11:118430980-118431002 GTGTTTTTGTGGAAGAGTAATGG + Intronic
1091047899 11:132341293-132341315 ATCTTCTTGTGGAAGGATGCCGG + Intergenic
1091129916 11:133137115-133137137 GGGTACTTGTGGAAAGGTTCTGG + Intronic
1092887667 12:12939214-12939236 GTGTGCCTCTAGAAGGGTCCCGG - Intergenic
1093286169 12:17266931-17266953 GTCTTCCTGTGGAAGGATCTAGG - Intergenic
1096235082 12:49920962-49920984 GTGTTCTTATGCAAGGGTCTGGG - Intergenic
1097654856 12:62345938-62345960 CTGGTGTTGTGGGAGGGTCCTGG - Intronic
1100008412 12:89922558-89922580 GTGTTCTGATGGAAATGTCCTGG + Intergenic
1100350672 12:93778809-93778831 GTGTTCTTGTGTTAGGATTCTGG + Intronic
1104254763 12:127126351-127126373 GTGTTCCTGTTGGAGGCTCCAGG + Intergenic
1104254772 12:127126395-127126417 GTGTTCCTGTCGGAGGCTCCAGG + Intergenic
1105016050 12:132787464-132787486 GGGCTCTTGGGGAGGGGTCCTGG - Intronic
1106545685 13:30729311-30729333 GTGATTTTTTGGAAGGGTCAAGG + Intronic
1109791940 13:67260143-67260165 CTGTTTTTGTCGAAGAGTCCTGG + Intergenic
1110044531 13:70811382-70811404 CAGTTTTTGTGGAAGGGACCTGG + Intergenic
1112189870 13:97165704-97165726 TTGTTCTTGAGGGAGTGTCCTGG - Intergenic
1113568736 13:111338397-111338419 GTGTTCTTTTCAAAGGCTCCCGG - Intronic
1113629174 13:111869290-111869312 GTTTTGTTGGAGAAGGGTCCAGG + Intergenic
1117612755 14:57501639-57501661 GTATTCTTGTGGAAGGTACTTGG - Intergenic
1120077003 14:80170082-80170104 GTGTTCTTGTGAAAGGGACATGG + Intergenic
1123843462 15:24271751-24271773 GCGTTCTTGTGCCAGGGTCATGG - Intergenic
1124206031 15:27721360-27721382 ATTTTCTTGTGGAGGGGTGCAGG - Intergenic
1124658635 15:31527681-31527703 GTGTCCTTATGGAGGGCTCCAGG + Intronic
1125674813 15:41496146-41496168 GAGTCCGTGTGGAAGGGCCCAGG + Intronic
1130329872 15:82913700-82913722 GGATTCTGGAGGAAGGGTCCAGG - Intronic
1131710430 15:95048073-95048095 GTGTTCCTTTGGAAGTGTCATGG - Intergenic
1132248958 15:100319049-100319071 GTGCACTTGTGGAAGAGCCCTGG + Intronic
1133198860 16:4190123-4190145 GTGTTCTTGTGGAAGGGTCCAGG + Exonic
1135463458 16:22664843-22664865 GGGTGCATGTGCAAGGGTCCTGG + Intergenic
1138184606 16:54966821-54966843 GGGTTCTTGTGGAAGGAGGCAGG + Intergenic
1139832926 16:69814762-69814784 GTGTTCTGGTGGATGGGCCGTGG + Intronic
1143326863 17:6104794-6104816 GTGTTGATGTGGCAAGGTCCTGG + Intronic
1143625482 17:8108213-8108235 GTGGGCTTGTGGAAAGGTCAAGG + Intronic
1146089990 17:29867390-29867412 GTGTTTTTGTGGCAGGGGCTGGG - Intronic
1146831784 17:36075876-36075898 GTGATCCTGTGGAAGGGAGCTGG + Intergenic
1149781899 17:59404321-59404343 GTGGTCCTGTGTGAGGGTCCTGG - Intergenic
1149929678 17:60738766-60738788 TTTTTCTTGTGAAAGGGTCTTGG + Intronic
1150336958 17:64337303-64337325 GTGGTGCTGTGGGAGGGTCCTGG + Intronic
1157410796 18:47461433-47461455 GTGCTCTTGCTGAAGGCTCCAGG + Intergenic
1159276377 18:66226978-66227000 GTGTTCTTGAGCAAGCTTCCTGG - Intergenic
1160394484 18:78561848-78561870 GGCTGCTTGTGGAAGGGTCCAGG - Intergenic
1161487261 19:4543100-4543122 GTGTTCGTGTGCAAGGGGCCGGG - Exonic
1162478499 19:10914986-10915008 GTGTGCGTGTGGCAGGGTACAGG + Intronic
1163507544 19:17717236-17717258 GTGTATTTATGGATGGGTCCAGG - Intergenic
1165443528 19:35844287-35844309 GTGGTCATGGGGAGGGGTCCCGG - Intronic
1166270018 19:41708023-41708045 CTGTCCTTGGGGAAGGCTCCAGG - Intronic
1166423134 19:42653657-42653679 GTGTCCTCGTGACAGGGTCCTGG + Intronic
1166644623 19:44522455-44522477 GTGTTCTAGAGGAAGGATCTAGG - Intronic
1168145183 19:54416379-54416401 GTGTCCCTGGGGAAGGGGCCCGG + Intronic
1168409145 19:56127707-56127729 GAGGTCTGGAGGAAGGGTCCAGG + Intergenic
925156626 2:1653204-1653226 GGGTTGTTTTGGAAGAGTCCCGG - Intronic
929122965 2:38498585-38498607 GTGTTCTTGGGGAAGAGTGGAGG + Intergenic
931649594 2:64455237-64455259 GTGTGCATGTGGAAGGCTGCTGG + Intronic
933177288 2:79189794-79189816 CAGTACTTGAGGAAGGGTCCTGG + Intronic
937039296 2:118808557-118808579 TTGTGCTTCTGGAAGGATCCAGG + Intergenic
937314005 2:120919677-120919699 GTGTTGCTGTGGAGGGTTCCAGG - Intronic
941792060 2:169563180-169563202 GTGTTGTGGTGGAAAGATCCTGG - Intronic
942687226 2:178546031-178546053 GTCTTCCTGCGGAAGGCTCCAGG + Exonic
944360708 2:198852527-198852549 GTTGTCTTGAGGAAGGGTACTGG + Intergenic
944912298 2:204322605-204322627 GTGTGCTTGTGGAAGAGTTTTGG - Intergenic
946410589 2:219513409-219513431 GTGTTCTCGTGGAGGGGAACAGG - Intergenic
947013489 2:225591489-225591511 GTGTTCTCGAGGAAGGGGCTGGG - Intronic
948016633 2:234696558-234696580 ATCTTGTTGTGGAAGGGACCTGG - Intergenic
948694035 2:239724021-239724043 GTGTACTTGTGTGAGTGTCCAGG + Intergenic
948868954 2:240788799-240788821 GCCTTCTTCTAGAAGGGTCCAGG + Intronic
1174405013 20:50297143-50297165 GGGTTCTTGTGGCAGAGTGCTGG + Intergenic
1175927450 20:62477865-62477887 GGGTGCTTGTGGAGGCGTCCAGG + Intergenic
1178028000 21:28490047-28490069 GTGGTGTTGGGGAAGGATCCTGG + Intergenic
1178112012 21:29378234-29378256 AAGTTATTGTGGAAGGGTGCAGG + Intronic
1180956721 22:19744546-19744568 GTGACCCTGTGCAAGGGTCCTGG - Intergenic
1181978862 22:26752202-26752224 GTGTGCTTGAGGAAGAGACCTGG + Intergenic
1184683534 22:46085697-46085719 GTGGTCCTGGAGAAGGGTCCTGG + Intronic
949158977 3:858422-858444 GTGTTCTAGTGTGAGGGTCATGG - Intergenic
952397908 3:32937537-32937559 GTGTTGATGTGGGAGTGTCCAGG + Intergenic
957766038 3:84625171-84625193 GTGTTCTTGTCAAAGTGTCTAGG - Intergenic
957951011 3:87126427-87126449 GTGTTCTTTTAGAAGGATCTCGG - Intergenic
961188136 3:124933723-124933745 GTGTTCATGCTGAAGGTTCCTGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
970301105 4:14682150-14682172 GTGTTCCTTTGGAAGGTTCTAGG + Intergenic
971713215 4:30143972-30143994 GTGTGCATGTGGGAGGGTTCTGG + Intergenic
973317559 4:48778881-48778903 GGGTTCTTTTGGAAGGGTAGGGG - Intronic
982029040 4:151280602-151280624 GTGTTGTTATTGAAGAGTCCTGG - Intronic
984876442 4:184371966-184371988 GTTTTCTTTTGGAAGGGACAGGG - Intergenic
985811674 5:2094750-2094772 GTGTTCCTGTGGCCGGGGCCAGG - Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
988094042 5:26579882-26579904 GTGTTATTGTGGAAGAATCTTGG + Intergenic
988891570 5:35623145-35623167 GTGTTTTTGAGGAGGGTTCCAGG + Intronic
992534120 5:77681323-77681345 GTGTTGTTGTGGGAGGGACCAGG - Intergenic
1000867031 5:166526520-166526542 GTGTGCTTGGAGAAGTGTCCTGG - Intergenic
1002447329 5:179297572-179297594 GGGGTCTTGAGGGAGGGTCCTGG - Intronic
1003405565 6:5824483-5824505 GTGTTCTTGTGGGAGGTGGCAGG + Intergenic
1005858962 6:29887286-29887308 GTTTTCTTCTAGAAGAGTCCAGG + Intergenic
1005875177 6:30006110-30006132 GTTTTCTTTTTGAAGAGTCCAGG + Intergenic
1006466269 6:34196627-34196649 GCGTCCTTGTGGAAGGAGCCTGG + Intergenic
1006835962 6:36999029-36999051 GCTTTCTTCTGGAAGGGTGCTGG - Intergenic
1007025072 6:38563385-38563407 GTGGTCTTGTGTAAGGATCGTGG - Intronic
1012004210 6:93692365-93692387 TTTTTCTTGGGGAAGGCTCCAGG + Intergenic
1013308094 6:108868731-108868753 GTGCTCTTCTGGAAGGGTTGTGG + Intronic
1014830503 6:126097806-126097828 GTGTTCTTGGGGCAGGGGCTGGG + Intergenic
1021018724 7:15568953-15568975 GTCTTATTGTGGATGGGTACGGG + Intergenic
1021791174 7:24207412-24207434 GTCCTCTTGGGGAAGGGACCAGG + Intergenic
1021884985 7:25129449-25129471 GTGTGCTTGCGGAAGGGACAGGG - Intergenic
1022770579 7:33467937-33467959 GTGATCTTCTGCCAGGGTCCAGG - Intronic
1024290409 7:47799789-47799811 GTGTTCCTATGGAAGGCTCAGGG - Intronic
1032021070 7:128407327-128407349 GTGTTTTCCTGGCAGGGTCCCGG - Intronic
1033860742 7:145623655-145623677 GTGAGCTAGTGGAAGGGTCAAGG - Intergenic
1036429924 8:8680774-8680796 GTGTCCTTGTGGAGGGCTGCTGG + Intergenic
1036520573 8:9488058-9488080 ATGTTCTTGTGGTAGGGAACTGG + Intergenic
1042523865 8:69744053-69744075 GGGTTCTGGTGCAAGGCTCCAGG - Intronic
1043660461 8:82735012-82735034 GTGTTGTTGTGGGAGGGACCTGG + Intergenic
1045427540 8:102082042-102082064 GTATCCTTGTGGAAGGGGCGAGG - Intronic
1046891792 8:119430235-119430257 GTGTGCTTCTGGAATTGTCCAGG - Intergenic
1046918165 8:119699368-119699390 CTGTCCCTGTGGAGGGGTCCTGG - Intergenic
1047746087 8:127846060-127846082 GTGTGCTTGGGAAAGGCTCCAGG - Intergenic
1048038881 8:130706206-130706228 GTGTTATTATAGAAGGGTCCTGG - Intergenic
1049440200 8:142606128-142606150 GTGCCCTTGTGGGAGGGACCTGG + Intergenic
1049631156 8:143658380-143658402 GTGAGCTTGTGGAGGGCTCCTGG + Intergenic
1051080412 9:13287451-13287473 GTGTTTTTGTGGTTGGGTCAAGG - Intergenic
1052631354 9:31044941-31044963 GTGTGTTTATGGAAGGGTGCAGG + Intergenic
1055607935 9:77990541-77990563 GAGTTCTTGTCAAAGGCTCCAGG + Intronic
1056201971 9:84285721-84285743 GGATTCTTGGGGAAGGGGCCAGG + Intronic
1057316502 9:93972202-93972224 GTGGTTTTGTGGATGGGTCCAGG - Intergenic
1057859831 9:98632187-98632209 ATGTCCTAGTGGAAGGGTCACGG + Intronic
1060894039 9:127206190-127206212 GTGCACATGTGGAAGGGCCCAGG - Intronic
1061487074 9:130925364-130925386 GTGTTCTTGTGTAGGAGACCAGG + Intronic
1062486308 9:136778160-136778182 GTGTTCTAGTTTAAGGGTCATGG - Intergenic
1185923853 X:4124795-4124817 GTTTTCTTGAGGAAGAATCCAGG + Intergenic
1188543129 X:31271341-31271363 GTGTACTGTTGGAAGGGTCTTGG + Intronic
1188997765 X:36906002-36906024 GTGTTTTTGTGGGACAGTCCTGG - Intergenic
1190596007 X:52053234-52053256 GGGTTCTTGTGGGAGAGGCCAGG + Intronic
1190612817 X:52200839-52200861 GGGTTCTTGTGGGAGAGGCCAGG - Intronic
1200986013 Y:9304073-9304095 GTGGTCTTGTGGGAGGGTGGAGG - Intergenic
1202124572 Y:21556828-21556850 GTGGTCTTGTGGGAGGGTGGAGG + Intergenic
1202154436 Y:21872552-21872574 GTGGTCTTGTGGGAGGGTGGAGG - Intergenic