ID: 1133200401

View in Genome Browser
Species Human (GRCh38)
Location 16:4200678-4200700
Sequence TGTAGTGGATGCACAGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133200401_1133200408 -5 Left 1133200401 16:4200678-4200700 CCAATAGCTGTGCATCCACTACA 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1133200408 16:4200696-4200718 CTACAAAGGGGGGCGATAATTGG 0: 1
1: 0
2: 0
3: 1
4: 33
1133200401_1133200409 3 Left 1133200401 16:4200678-4200700 CCAATAGCTGTGCATCCACTACA 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1133200409 16:4200704-4200726 GGGGGCGATAATTGGCTGCTAGG 0: 1
1: 0
2: 0
3: 1
4: 70
1133200401_1133200410 22 Left 1133200401 16:4200678-4200700 CCAATAGCTGTGCATCCACTACA 0: 1
1: 0
2: 1
3: 4
4: 71
Right 1133200410 16:4200723-4200745 TAGGCTACAAAAAATAGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133200401 Original CRISPR TGTAGTGGATGCACAGCTAT TGG (reversed) Intronic
910081508 1:83347793-83347815 TTGAGTGGATGCACACCTAATGG + Intergenic
910325023 1:85996921-85996943 TGTTTTAGATACACAGCTATGGG + Intronic
912921185 1:113868797-113868819 GGTAGTGGTTGCACTGCTAATGG + Intronic
916039493 1:160950292-160950314 TGTTGGGGAGACACAGCTATGGG - Intronic
917633392 1:176912287-176912309 TGTAGTGCAAACACAGCTATGGG + Intronic
918637378 1:186794349-186794371 TGTAGTGGTTGCACATTTCTAGG - Intergenic
921712922 1:218390842-218390864 TGTACTGGCAACACAGCTATGGG - Intronic
1064106098 10:12502215-12502237 TGTGATGGATGCAGAGCTTTAGG + Intronic
1068553225 10:58428919-58428941 TGGAGAGGATGCAGAGCAATAGG - Intergenic
1069799018 10:71070833-71070855 TGTGATGGATGCTCAGCTCTGGG - Intergenic
1078959986 11:16253708-16253730 TGTAGTTGTTCCACAGTTATTGG - Intronic
1087832110 11:102830552-102830574 TGTAGTAGATGGACAGAGATTGG + Intergenic
1097562710 12:61228203-61228225 TCTAGAGGAGGCAAAGCTATAGG - Intergenic
1107708145 13:43127245-43127267 TGGAGTGGATGGAAAGCTCTGGG + Intergenic
1115043470 14:28959622-28959644 TGGAGGGGATGCAGAGATATAGG + Intergenic
1121898394 14:97670311-97670333 TGCAGTCGATGCACAGGGATTGG + Intergenic
1122717669 14:103705363-103705385 TGTAGGGGCTGCACAGTCATGGG + Intronic
1128635484 15:69299573-69299595 TGAAGTGGGTGCCCAGCTACAGG + Intronic
1129241426 15:74254534-74254556 TGTGGAGGATGCACAGCCATTGG - Intronic
1133200401 16:4200678-4200700 TGTAGTGGATGCACAGCTATTGG - Intronic
1133916367 16:10113041-10113063 TGTAGGGGATGCTCAGCGAGGGG - Intronic
1138539263 16:57678731-57678753 AGGAGTGGATGCACACCTCTGGG - Intronic
1143595711 17:7912382-7912404 TGTGGTGGAAGCCCAGCTCTGGG + Exonic
1144391540 17:14798181-14798203 TGGTGTGGATGCATAGATATTGG + Intergenic
1153503859 18:5774990-5775012 GGTGATGGATGCACAGCTCTTGG - Intergenic
1155187484 18:23399975-23399997 TGTAGTGGATTCAAAACTTTTGG - Intronic
1155532950 18:26786062-26786084 TGGAGTGGATCCACTGCTCTTGG - Intergenic
1166423017 19:42653056-42653078 TGTAGAGGAAGCACAGGTAGTGG - Intronic
931694542 2:64861902-64861924 TGGAGAGAATGCAGAGCTATAGG - Intergenic
934048956 2:88194221-88194243 TATAGTTGATGCACAGGAATTGG - Intergenic
935331491 2:101980594-101980616 AGTCTTGGCTGCACAGCTATTGG - Intergenic
937767952 2:125683586-125683608 TCTAGAGGATACAAAGCTATTGG + Intergenic
938524044 2:132107502-132107524 TGTAATGGATGCACCATTATTGG + Intergenic
939063547 2:137454113-137454135 TGTAGTAAATGCCCAGCAATGGG + Intronic
1173183076 20:40819224-40819246 TGTAGTGTGGGCACTGCTATGGG - Intergenic
1174461652 20:50687284-50687306 TGGAGTGGATGCAGAGAGATCGG - Intronic
1179592873 21:42422140-42422162 TGTCATGTATGCACAGCTGTGGG - Intronic
1180639953 22:17290467-17290489 TGTTGAGGCTGCACAGCTAGAGG - Intergenic
950013567 3:9740829-9740851 TGCAGAGGCTGCACAGCTACTGG + Exonic
952025807 3:29080502-29080524 TTTAGAAGATGCACAGCTAGAGG + Intergenic
952081960 3:29769798-29769820 TGGGGAGGATGCACAGCTCTGGG + Intronic
957931631 3:86885855-86885877 TCTAGTGGATTCACATCTAAGGG - Intergenic
959395607 3:105834104-105834126 GGCAGTGGATGAAGAGCTATTGG + Intronic
962351927 3:134662816-134662838 TGGTGGGCATGCACAGCTATTGG + Intronic
965150708 3:164971152-164971174 TGGAGTGGATGCGCAGAAATAGG + Intergenic
967531957 3:190558414-190558436 TGAAGAGGATGCAAAGCAATTGG - Intronic
973650942 4:52996579-52996601 TGTTGTGGATAAGCAGCTATAGG + Intronic
981200305 4:141972433-141972455 TGCAATGGAGGCACAGGTATTGG + Intergenic
990794604 5:59525417-59525439 TACAGTGGAGGCACAGGTATTGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
1000646804 5:163769444-163769466 TGTACAGGGTGCAGAGCTATGGG - Intergenic
1003412354 6:5876775-5876797 TGGAGTGGTTGCACAGCCAGGGG - Intergenic
1008395352 6:51000139-51000161 TGGGGAGGATTCACAGCTATGGG - Intergenic
1008687798 6:53944470-53944492 GCTAGTGGCTGCACAGGTATGGG + Intronic
1013165278 6:107584505-107584527 TGTAGTGGAAACACAGCAAATGG + Intronic
1018215974 6:161528304-161528326 TGTAGTGGGTGCACAGCTGTGGG + Intronic
1019912423 7:4108738-4108760 TGTGGTGGTTGCACAGCACTGGG - Intronic
1021214889 7:17903505-17903527 TGTAGTGGTTACACAACTAATGG - Intronic
1027298995 7:76810033-76810055 TTGAGTGGATGCACACCTAATGG + Intergenic
1032428945 7:131845086-131845108 TGTATTGGATACTCAGCTATGGG + Intergenic
1044903928 8:96979188-96979210 GGTACTGGATGCAAAGCTAAAGG + Intronic
1047577531 8:126174279-126174301 TTTAGTGAATGCAAAGATATGGG + Intergenic
1048279613 8:133095357-133095379 TGTGGCGCATGCACAGCTCTAGG - Intronic
1051658361 9:19404008-19404030 TGCAGTGGAAGCATACCTATGGG + Intergenic
1052081008 9:24205264-24205286 TGTAGTTGTTGCACAGTTCTTGG + Intergenic
1053368754 9:37542928-37542950 TGTAGGGGATCCAGAGCTCTAGG - Intronic
1056332200 9:85530060-85530082 TGTAGTGGATTCAAAACTGTAGG + Intergenic
1057713959 9:97473888-97473910 TGTAGTCAGTGCACAGCAATCGG + Intronic
1058339821 9:103880749-103880771 TGTAGTGGAAGGACAATTATAGG - Intergenic
1060300131 9:122370214-122370236 TGTAGTAGGTGCTCAGTTATCGG - Intergenic
1060998436 9:127888020-127888042 TGTAGTGTGAGCACAGCTCTTGG - Intronic
1185829254 X:3283833-3283855 TGTAGTGCATGCACACCTCTGGG + Intronic
1186633546 X:11377480-11377502 GGTAATGGATGCACAACTAGAGG + Intronic
1187846708 X:23545998-23546020 TGTAGTGGTTTCACAGTTTTAGG - Intergenic
1188840791 X:35014676-35014698 TGTTTTGTATTCACAGCTATAGG + Intergenic
1190627082 X:52346538-52346560 TTGAGAGGGTGCACAGCTATAGG + Intergenic
1199867213 X:151862927-151862949 TCTAGTGGATGTACAGTAATTGG + Intergenic