ID: 1133201486

View in Genome Browser
Species Human (GRCh38)
Location 16:4206970-4206992
Sequence GAAGGTGGAGCGCCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 256}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133201486_1133201496 0 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201496 16:4206993-4207015 CTGGGGCTCCTCGGCTTCCTGGG 0: 1
1: 1
2: 4
3: 55
4: 285
1133201486_1133201495 -1 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201495 16:4206992-4207014 CCTGGGGCTCCTCGGCTTCCTGG 0: 1
1: 1
2: 6
3: 54
4: 408
1133201486_1133201497 1 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201497 16:4206994-4207016 TGGGGCTCCTCGGCTTCCTGGGG 0: 1
1: 0
2: 4
3: 37
4: 219
1133201486_1133201491 -9 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201491 16:4206984-4207006 TCCACCTTCCTGGGGCTCCTCGG 0: 1
1: 0
2: 2
3: 60
4: 467
1133201486_1133201501 18 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201501 16:4207011-4207033 CTGGGGATCCCCGCCTTCCTGGG 0: 1
1: 1
2: 5
3: 22
4: 228
1133201486_1133201504 27 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201504 16:4207020-4207042 CCCGCCTTCCTGGGACTCCTCGG 0: 1
1: 0
2: 4
3: 36
4: 291
1133201486_1133201500 17 Left 1133201486 16:4206970-4206992 CCTTCCTGTGGCGCTCCACCTTC 0: 1
1: 0
2: 1
3: 26
4: 256
Right 1133201500 16:4207010-4207032 CCTGGGGATCCCCGCCTTCCTGG 0: 1
1: 1
2: 1
3: 46
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133201486 Original CRISPR GAAGGTGGAGCGCCACAGGA AGG (reversed) Intronic
900092282 1:925647-925669 GAGGGTGGAGCGCGGGAGGAGGG + Intronic
900845628 1:5098070-5098092 GAGGGTGGAGCACCCCAGAAAGG - Intergenic
901957322 1:12795943-12795965 GACGGTGATGAGCCACAGGAAGG - Exonic
901965341 1:12861726-12861748 GACGGTGATGAGCCACAGGAAGG - Exonic
901973718 1:12928200-12928222 GACGGTGATGAGCCACAGGAAGG - Intronic
901988699 1:13095205-13095227 GACGGTGATGAGCCACAGGACGG + Intergenic
901993114 1:13131562-13131584 GACGGTGATGAGCCACAGGACGG - Intergenic
902011460 1:13273567-13273589 GACGGTGATGAGCCACAGGAAGG + Intergenic
902020593 1:13342559-13342581 GACGGTGATGAGCCACAGGAAGG + Exonic
902613486 1:17610571-17610593 GAGGGTGAAGCACCACAGGCAGG - Intronic
902847854 1:19126336-19126358 GAGGGTGAAGAGCCATAGGAAGG - Intronic
903961580 1:27061078-27061100 GAAGGCGGAGCTCCACAGTCAGG + Intergenic
904889880 1:33771793-33771815 GAAGGTGGAGTGACAAGGGATGG + Intronic
906778333 1:48549969-48549991 GAAGGTGGAGAGACACAGATAGG + Intronic
910708720 1:90156901-90156923 GGAGGTGGGGGGCCAAAGGAGGG - Intergenic
911047237 1:93638691-93638713 GAAGGTGGAGCCACTCTGGAGGG + Intronic
912450537 1:109765140-109765162 GAAGCTGAAGGGCCACAAGATGG - Intronic
912520856 1:110243701-110243723 GAAGGGGGAGGGGCAGAGGAGGG + Intronic
912718738 1:112002176-112002198 GGATGTGGAGCAGCACAGGAAGG + Intergenic
913264732 1:117033303-117033325 GAAGGAGGAGACCCACAGGGAGG + Intronic
915449384 1:155994176-155994198 GAAAGTGCTGCGCCACAGGCTGG + Intronic
916169315 1:161988696-161988718 GAAGGTGGAACTCCAGAGGGTGG - Intronic
917122217 1:171654815-171654837 GGAGGTGGAGGGGGACAGGAAGG - Intergenic
917589907 1:176465788-176465810 GAAGGTGGAGAGTGGCAGGAGGG - Intronic
920340036 1:205269867-205269889 GCAGGAGGAGCGCTACAGGTAGG + Exonic
921166816 1:212513847-212513869 GAGGATAGAGTGCCACAGGAAGG - Intergenic
922566056 1:226602455-226602477 GCAGGTGGGGTCCCACAGGACGG - Exonic
923207782 1:231775636-231775658 GAATGAGGAGCTCCACAGTATGG + Intronic
1063115047 10:3067289-3067311 GCAGGGGTAGCGCCACAGGTGGG - Intronic
1065860836 10:29871229-29871251 GAAGGAGGAGAGCCAGAGGTAGG + Intergenic
1067564188 10:47325178-47325200 GACTGTGGAGAGCCACAGGAAGG + Exonic
1074294467 10:112171007-112171029 GCAGGTGGAGCTTCACAAGATGG - Intronic
1075714500 10:124548268-124548290 GAAGGTGAAGAACCAGAGGATGG - Intronic
1076429553 10:130391929-130391951 GAACGTGGAGGGGCACAGGGAGG - Intergenic
1076912620 10:133399307-133399329 GAAGGCGCAGCGCCCCAGGCAGG + Intronic
1077118418 11:895883-895905 GAAGGTGGGGAGCTGCAGGAAGG - Intronic
1078346689 11:10555957-10555979 GCAGGTGGAGAGCCACGTGATGG - Intergenic
1078533026 11:12151628-12151650 GAAGTTGGTGAGCCACAAGAAGG - Intronic
1079597384 11:22267758-22267780 GAAGGTGGAGTGTCAGAAGAGGG - Intronic
1081762249 11:45584615-45584637 GAAGGGAAAGAGCCACAGGAGGG - Intergenic
1081783700 11:45731623-45731645 GAAGGTTGAGGACCAAAGGAGGG + Intergenic
1083280999 11:61627330-61627352 GAAGGTGGAGGACAACAGGAGGG - Intergenic
1083953138 11:65967681-65967703 GAAGGTGGAGCTCCACCGCCGGG + Exonic
1085150589 11:74249886-74249908 GCAGGAGGAGGGGCACAGGATGG + Intronic
1089857251 11:121556960-121556982 GAACGTGGAGTGACACGGGATGG + Intronic
1092229601 12:6769223-6769245 GGAGGCGGAGGGACACAGGAGGG + Intronic
1092542273 12:9427365-9427387 GAAGATGGAGTGACACAGCAAGG + Intergenic
1092579823 12:9826870-9826892 GAAGGTGGAGGGTGAGAGGAGGG + Intergenic
1095705866 12:45236372-45236394 GAAGGTGGGGGGCTGCAGGAGGG - Intronic
1096148694 12:49295695-49295717 GCAGGTGGAGCGCGACGGGCTGG + Exonic
1096618817 12:52849639-52849661 GAAGGAGCAGAGCCACAGGCTGG - Intergenic
1097181222 12:57173136-57173158 GACAGTGGAGGGCCTCAGGAGGG - Intronic
1098700862 12:73623595-73623617 GGAGGTGAAGGGCAACAGGAGGG + Intergenic
1099431447 12:82591161-82591183 GGGGGTGGAGGGCTACAGGAGGG + Intergenic
1101758809 12:107642593-107642615 GAAGTTGGTGAGCCACAGGAAGG + Intronic
1105274021 13:18904401-18904423 GTAGATGGAGGGCGACAGGAAGG - Intergenic
1106791091 13:33155204-33155226 GAAGGAGGAGCGAGTCAGGAGGG - Intronic
1108756674 13:53511327-53511349 GAAGGTGGAGGGTGAGAGGAGGG - Intergenic
1108901899 13:55421807-55421829 GAAGGTGGACGGAAACAGGAAGG - Intergenic
1112309303 13:98303804-98303826 AAAGGTTAAGCGCCAGAGGAGGG + Intronic
1113426943 13:110216076-110216098 GAAGGGGCAGTGCCACAGTATGG - Intronic
1114972507 14:28050737-28050759 GAAGGTGGAGAGTGAGAGGAGGG - Intergenic
1115316322 14:32028633-32028655 GAAGGTGAAGCACCACTGTAGGG - Intergenic
1115570882 14:34665207-34665229 GAAGGAAGAGAGCCACAGAAGGG + Intergenic
1117492030 14:56257979-56258001 CATGGTGAAGCGCCACAGAATGG + Intronic
1119022203 14:71125231-71125253 GAAGGGGTAGCGACACAGAAGGG - Intergenic
1119068572 14:71556678-71556700 GAAGGTGGCACGCCAAAGGAGGG - Intronic
1119507510 14:75185574-75185596 GAAGGTGGAGCACCCAGGGAGGG + Intergenic
1122012141 14:98759106-98759128 GAAGGTGGAAAGTCAAAGGAAGG - Intergenic
1122966029 14:105126454-105126476 TAAGGTGGAAAGCCACTGGAAGG + Intergenic
1123049957 14:105536424-105536446 CAAGGTGCAGCAACACAGGAGGG - Intergenic
1123058609 14:105584256-105584278 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1123082940 14:105704490-105704512 GATGGTGGTGGGCCACAGGTTGG + Intergenic
1202890743 14_KI270722v1_random:154859-154881 CAAGGTGGAGGTCCACAAGAAGG - Intergenic
1126567661 15:50116403-50116425 GAAGGTGGAGGGGCAGAAGAAGG + Intronic
1128550829 15:68596912-68596934 GCAGGAGGAGAGCCACAGGATGG - Intronic
1129255457 15:74331555-74331577 GAGGGTGGACCTCCAGAGGAGGG + Intronic
1130916864 15:88312058-88312080 GAAGGTGGAGCGAGGGAGGAGGG - Intergenic
1131154765 15:90067920-90067942 GACCGTGGAACGCCACAAGAAGG + Exonic
1132115546 15:99132944-99132966 GAAGGTGCAGCTCCAGAGAATGG + Exonic
1132504809 16:302459-302481 GATGGTGGAGCTCCCCATGAAGG - Intronic
1133022299 16:2972113-2972135 GAAGTTGGAGCGCCACGGCGTGG - Exonic
1133201480 16:4206952-4206974 GAAGGCGGGGAGCCCCAGGAAGG - Intronic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1133396301 16:5450192-5450214 GAAGGTGCAATGCCACAGGCTGG - Intergenic
1135712114 16:24726608-24726630 GAAGGAGGAGAGCCAGTGGAAGG + Intergenic
1135929052 16:26721170-26721192 GAGGGTGGAGCTACAAAGGATGG - Intergenic
1135952661 16:26929816-26929838 GAAGGTGGAGGGTGGCAGGAGGG - Intergenic
1138786366 16:59851390-59851412 GTAGGTGGAGGGCAAGAGGAGGG - Intergenic
1139235273 16:65331676-65331698 GAGGGTGGAGGGTCAGAGGAGGG - Intergenic
1142685710 17:1575869-1575891 GAAGGGGGAACGAAACAGGAAGG + Intronic
1144833213 17:18143242-18143264 GAAGGTGGCGCTACAGAGGAGGG + Intronic
1145043248 17:19592506-19592528 GAAGCTGGAGTCCCACAGGGAGG + Intergenic
1145389450 17:22444298-22444320 GAAGGTCCAGTTCCACAGGAAGG - Intergenic
1145939952 17:28738032-28738054 GGAGGTGGAGGTCCACAGCAGGG + Intronic
1146602662 17:34232118-34232140 GAAGGTGGAGAGTGAGAGGAGGG + Intergenic
1148484428 17:47981607-47981629 GAAGATGGAAAGCCACAGGAAGG + Exonic
1151337303 17:73447515-73447537 GAAGATGGAGTGGCAGAGGAGGG - Intronic
1151357019 17:73565195-73565217 GAAGGAGGAGAGCCAGAGGGAGG + Intronic
1151745422 17:76009238-76009260 GGAGGTGGTGCGCCACGAGAAGG - Exonic
1152124415 17:78437805-78437827 GAAGCTGGAGCACTACAGCACGG - Exonic
1153815091 18:8784510-8784532 GACGGTGGAGCGCCTCATCACGG + Exonic
1158847303 18:61458172-61458194 GAGGATGGAGGGACACAGGAAGG - Intronic
1158931884 18:62330754-62330776 GAAGGTGCAGGGGCAAAGGACGG + Intronic
1160203054 18:76810883-76810905 GAAGGTGGAAGGTCACTGGATGG - Intronic
1160982756 19:1823767-1823789 GCAGGTGGAGCCCCCGAGGAGGG - Exonic
1161032468 19:2064517-2064539 GCAGGTGGAGAGAAACAGGAGGG + Intergenic
1161185671 19:2918156-2918178 GAAGGAGGAGTGCCACTTGAAGG - Exonic
1161843123 19:6694321-6694343 GAAGGTGGAGCCTCAGGGGAGGG + Intronic
1162073287 19:8167839-8167861 GAAGACGGGGCCCCACAGGAGGG + Intronic
1163146234 19:15380516-15380538 GAAGCTGGAGCGCTACCTGAAGG - Exonic
1165290247 19:34878009-34878031 GAAGGTGGAGGGTGGCAGGAGGG - Intergenic
1165861967 19:38914042-38914064 GAAGGTGGAGCAGCTCAGGTGGG + Intergenic
1167208965 19:48121349-48121371 GAAGGGGGAGCGCCCAAGGCGGG + Intronic
1167757595 19:51422095-51422117 GAAGGTGGAGCGCCCCCTGGGGG - Intergenic
1202666164 1_KI270708v1_random:121696-121718 CAAGGTGGAGGTCCACAAGAAGG - Intergenic
925077913 2:1034126-1034148 GAAGGTGGAGGGTAAGAGGAGGG - Intronic
925085209 2:1102349-1102371 GAAGGTGGAGAGCCAGTGCAGGG + Intronic
926214353 2:10895001-10895023 GAAGCTGGAAGGTCACAGGAAGG - Intergenic
926732393 2:16046165-16046187 GAAGATGGAGCGCTACGGGAGGG - Intergenic
927884851 2:26712111-26712133 GAAGCTGGAGGGCTTCAGGATGG + Intronic
928427760 2:31192889-31192911 GAAGATGCAGCCCCACAGGCTGG + Intronic
931015561 2:57975909-57975931 GAAGGTGGAGGGTGAGAGGAGGG - Intronic
931066471 2:58593598-58593620 GAAGGTGCTGGGCCACAGAATGG + Intergenic
932593129 2:73079137-73079159 GAAGGCAGAGAGCCAGAGGAGGG - Intronic
933873094 2:86589361-86589383 GAAGGTGGAGGGTGAGAGGAGGG - Intronic
934125344 2:88883038-88883060 GAATGTGTAGCTCCACAAGATGG + Intergenic
934500781 2:94858488-94858510 GAAGGTGGAGCTCCCCTGGATGG + Intergenic
935743348 2:106170171-106170193 GAAGGTGGAGAGTCACATGCAGG - Intronic
937287491 2:120762498-120762520 GCAGGAGGAGAGTCACAGGAAGG + Intronic
937303281 2:120856369-120856391 CAACCTGGAGCCCCACAGGAAGG - Intronic
938284548 2:130099072-130099094 GAAGGTGGAGCGTCGCGGGAGGG + Intronic
938335187 2:130487634-130487656 GAAGGTGGAGCGTCACGGGAGGG + Intronic
938354638 2:130633032-130633054 GAAGGTGGAGCGTCGCGGGAGGG - Intronic
938431059 2:131239820-131239842 GAAGGTGGAGCGTCGCGGGAGGG - Intronic
939787929 2:146539470-146539492 GAAGATGCAGAGCCACACGATGG + Intergenic
940398468 2:153220984-153221006 GAAGGTGGAGATCAAGAGGAAGG + Intergenic
940628661 2:156209582-156209604 GAGGGTGGAGGGTGACAGGAAGG - Intergenic
941035945 2:160569505-160569527 CAACGTGGAGTGCCACAGCAAGG - Intergenic
941384749 2:164840692-164840714 GCGGGTGGAGGGCGACAGGAGGG - Intronic
943749184 2:191494058-191494080 GGAGGTGGCTCACCACAGGATGG + Intergenic
944118305 2:196212341-196212363 GAGGGTGGAGGGTCAGAGGAGGG - Intronic
944277991 2:197861338-197861360 GAAGGTGGAGCACCTAAAGAAGG + Intronic
948657278 2:239484420-239484442 GAAGGTGTTTCGCCACAGGGAGG + Intergenic
1171891997 20:30725205-30725227 GAAGGCGGAGCTCCCCTGGATGG + Intergenic
1171937046 20:31285188-31285210 GAAGACGGAAAGCCACAGGAAGG - Intergenic
1172783238 20:37449752-37449774 GCAGGTGCAGCGCAAGAGGAGGG - Intergenic
1173500529 20:43549578-43549600 GAAGGGGGAGAGCCACTGGTAGG + Intronic
1175115091 20:56676551-56676573 GAAGTTGGAGAGCAACGGGATGG + Intergenic
1175878316 20:62241606-62241628 GAAGGTGGTGCGCCAGACCAGGG + Intronic
1175988685 20:62776969-62776991 GAAGGAGGGGCGGGACAGGAAGG + Intergenic
1175988712 20:62777043-62777065 GAAGGAGGGGCGGGACAGGAAGG + Intergenic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176625183 21:9086769-9086791 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1176873467 21:14102745-14102767 GAAGGGGGAGGGCCAAAGGCTGG + Intergenic
1177526888 21:22304682-22304704 GAAGGTGGAGGGTGAGAGGAGGG + Intergenic
1178884729 21:36476218-36476240 AAGGGTGCAGGGCCACAGGAGGG - Intronic
1178955470 21:37017998-37018020 GAAGCTGAAGAGCCAGAGGAAGG + Exonic
1180782409 22:18528655-18528677 GGAGGCGGAGCGCCACAAGGAGG + Exonic
1181125960 22:20702682-20702704 GGAGGCGGAGCGCCACAAGGAGG + Intergenic
1181669911 22:24421205-24421227 GAAGGTTGCGGGCCCCAGGATGG + Intronic
1182833858 22:33325703-33325725 GAAGGAGGGGTGTCACAGGAAGG - Intronic
1184130606 22:42514608-42514630 GAAGGTGGCGCCCCAGAGGGAGG - Intronic
1184140785 22:42576438-42576460 GAAGGTGGCGCCCCAGAGGGAGG - Intergenic
1184899357 22:47434663-47434685 GAAGGTGGAGGGACAGAGCATGG - Intergenic
1184997879 22:48223641-48223663 GAGGGTGGGGCACCACAGGAAGG - Intergenic
1185243101 22:49756850-49756872 GAAGGTGGAGGGACACAGCAGGG - Intergenic
1185343744 22:50302559-50302581 GAAGGTGGGGCGCCCCAGGCAGG - Intronic
949790508 3:7786978-7787000 GAAAGTGGGGAGCCATAGGAAGG - Intergenic
950575731 3:13830996-13831018 GAAGGTGGAGTTCCAGGGGAAGG + Intronic
950648421 3:14392350-14392372 GAAGGTGTGCAGCCACAGGAGGG - Intergenic
950860336 3:16142216-16142238 GAAGATGGAGCTTCCCAGGATGG - Intergenic
951319140 3:21224042-21224064 CAAGGTGGAGGGCTACATGAGGG - Intergenic
952548049 3:34444122-34444144 GAAGGTGGAGGGTGAAAGGAGGG - Intergenic
953210706 3:40872589-40872611 GAAAGAGGAAGGCCACAGGAAGG + Intergenic
953333590 3:42074839-42074861 GAAGGTGGAGCGTAGGAGGAGGG - Intronic
954683550 3:52358668-52358690 GGAGGTGGAGCGCAGCATGAAGG + Exonic
957680189 3:83424014-83424036 GAAGGTGGAGTACCAGATGAAGG + Intergenic
958181775 3:90070008-90070030 GAAGGTTGAGGGACACAGGAGGG + Intergenic
959717935 3:109453769-109453791 GAATCTGTAGCTCCACAGGATGG + Intergenic
960257494 3:115526547-115526569 GAGGGTGGAGGGTGACAGGAGGG - Intergenic
960432394 3:117584956-117584978 GAAGGTGGAGGGCGGGAGGAGGG + Intergenic
961477261 3:127156736-127156758 GCTGGTGGAGGGCCACAGGAGGG - Intergenic
964124197 3:153218731-153218753 GAAGGGGGAGCAAAACAGGAAGG + Intergenic
964375264 3:156043067-156043089 GAAGGTGGAGGGTGAAAGGAGGG - Intronic
964594541 3:158409133-158409155 GAAGGTGGAGGGTGAGAGGAGGG + Intronic
965553820 3:169999193-169999215 GAATGAGGAGCACCACAGAAGGG - Intergenic
965792854 3:172408304-172408326 CAAGGTGGAGGGCCTCAGCAAGG - Intergenic
968181936 3:196601855-196601877 GCAGGAGGAACGCCACATGAGGG + Intergenic
968922669 4:3530778-3530800 TAAGGTGGAGCGCACCAGGGCGG + Intronic
970227573 4:13875682-13875704 GAAGATGGAGAGCCAGTGGAAGG + Intergenic
972668302 4:41189363-41189385 GCAGGAGGAAGGCCACAGGAGGG + Intronic
973089730 4:46120306-46120328 GAAGGTGGAGGCCCAAAGGAGGG - Intronic
976866113 4:89729252-89729274 GAAGAAGGAGCCCCACAGGAAGG - Exonic
979559433 4:122085268-122085290 CAAGGTGAAGCTCAACAGGATGG + Intergenic
980550439 4:134327992-134328014 GCAGGAGGAGGACCACAGGAAGG + Intergenic
981444787 4:144823131-144823153 GAGGGTGGAGAGCGAGAGGAGGG - Intergenic
981594064 4:146399272-146399294 TAAGGTGGAGCCACAGAGGAAGG + Intronic
983609427 4:169626277-169626299 GAAGGTGGCGCACCATGGGAAGG - Intronic
984636141 4:182111804-182111826 GAAGGTGGAGCCATAGAGGAAGG + Intergenic
985487207 5:158408-158430 GAAGGAGGAGACCCCCAGGATGG - Intronic
985693449 5:1326273-1326295 GACGCTGGAGCTCCACAGGCAGG - Intronic
988461968 5:31447233-31447255 GAAGGTGGAGAACAAAAGGAGGG + Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
992966145 5:82002642-82002664 GAAGGTGGAGGGAGAGAGGAGGG + Intronic
993044974 5:82856678-82856700 GATAGTGGGTCGCCACAGGAAGG - Intergenic
994156442 5:96508699-96508721 GAAGTTGGAGGGTCTCAGGAAGG + Intergenic
994638248 5:102370051-102370073 GAAGGTGGAGGGGGAGAGGAGGG + Intergenic
996266003 5:121541119-121541141 GATGCTGGAGAGCCTCAGGAAGG + Intergenic
996597480 5:125222260-125222282 TAAGGTGGAGAACCTCAGGAGGG + Intergenic
1000989646 5:167898742-167898764 GAAGGTAGAGAGCCATAGGCTGG + Intronic
1002640301 5:180627605-180627627 GAAGGGTGGGCACCACAGGAAGG + Intronic
1002770137 6:283231-283253 GTAGGGGGAGCCCCAGAGGAGGG + Intergenic
1003815706 6:9837762-9837784 GAGGGTGGAGGGCGGCAGGAGGG + Intronic
1006460036 6:34152869-34152891 GAAGGTGGGGCATCTCAGGAGGG + Intronic
1006510499 6:34518716-34518738 GGTGGTGGAGAGCCACTGGAAGG - Intronic
1006752937 6:36390506-36390528 GAAGGAGGAACCCCACAGCAGGG - Intergenic
1006830471 6:36964960-36964982 GAAGGGGAAGAGCCAAAGGAAGG + Intergenic
1007140628 6:39569802-39569824 GAAGGTGGTGTGCCACAGACAGG - Intronic
1008843738 6:55936557-55936579 GAAGGAGGAGGGGCAAAGGAGGG + Intergenic
1008966027 6:57313644-57313666 GAGGGTGGAGGGCCAGAGGTTGG + Intergenic
1009462588 6:63932501-63932523 GAAGGAGGAGTGCCAGAGGAAGG - Intronic
1010427512 6:75743529-75743551 GAAGGTGAGGTGACACAGGAGGG + Intergenic
1011821677 6:91260557-91260579 GAGGGTGGAGTGCCAGAAGAAGG + Intergenic
1012109125 6:95204276-95204298 GAAGGAGGAGAGAGACAGGAAGG - Intergenic
1015565569 6:134567089-134567111 GAACTTGGAGCTCCACTGGATGG - Intergenic
1016704863 6:147094965-147094987 GAAGGTGGAGGGTGAGAGGAAGG + Intergenic
1019706836 7:2500743-2500765 GAAGGGACAGTGCCACAGGATGG - Intergenic
1022557755 7:31316848-31316870 GAAGGTGCAGCCCCAGAGGTGGG - Intergenic
1022623913 7:32014601-32014623 GAAGGTGGAGGGCAAGGGGAGGG - Intronic
1024638354 7:51309241-51309263 GCAGGTGGAGCACGAAAGGACGG + Intronic
1027609401 7:80340772-80340794 GAAGGTGGAATGCCAAAAGAGGG - Intergenic
1028101391 7:86825101-86825123 GAAGGTGGAGGGCAGGAGGAGGG - Intronic
1028210169 7:88064101-88064123 GAGGATGGAAGGCCACAGGAGGG + Intronic
1029448217 7:100626700-100626722 GGAGGTGGAGCCCCAGGGGAGGG + Intronic
1033121553 7:138670865-138670887 GAGGGTGGAGAGCCATTGGAAGG - Intronic
1034674475 7:152882733-152882755 GAAGGTACAGCGCCAGAGGCCGG - Intergenic
1035199119 7:157248809-157248831 GAGAGTGGAGCTCCGCAGGAGGG - Intronic
1035520916 8:274405-274427 GAGGGTGGAGCCCTGCAGGAAGG + Intergenic
1037002407 8:13736261-13736283 CCAGGTGGAGCGCCACTTGATGG + Intergenic
1037290242 8:17342633-17342655 GAAGTTGGAGAACCACAGAATGG + Intronic
1038695055 8:29799106-29799128 GAAGGCAGAGAACCACAGGAAGG - Intergenic
1039195287 8:35024207-35024229 GAAGGAGGAGCGAGAGAGGAGGG - Intergenic
1039265813 8:35822781-35822803 GAGGGTGGAGGGTGACAGGAGGG + Intergenic
1039595972 8:38789933-38789955 TAAGGTGGAAAGCCACTGGAGGG + Intronic
1040407617 8:47121807-47121829 GAGGGTGGAGGGCAGCAGGAGGG + Intergenic
1040439807 8:47429349-47429371 GGAGGTGGGGGGCCACAGAAAGG - Intronic
1041108930 8:54467414-54467436 GAAGGTCGAGCGCCAGAGGCTGG + Intergenic
1041583426 8:59489291-59489313 GGAGGTGGAGAGCTAGAGGAGGG - Intergenic
1042629052 8:70796203-70796225 GAAGGTGGAGGGACAGAGGATGG - Intergenic
1044625479 8:94232344-94232366 GAAGGTGGAGAGACATAAGAGGG + Intergenic
1044954374 8:97464314-97464336 CAGGGTGGAGGGTCACAGGAGGG + Intergenic
1045355707 8:101387117-101387139 GAAGCTGGAGCAGCACAGGACGG + Intergenic
1048070577 8:131016733-131016755 GAAGGTGTAGGGCCAGAGGCAGG + Intronic
1049546470 8:143233988-143234010 GAAGGTGGATGGCCACAGGGAGG - Intergenic
1050881549 9:10706148-10706170 GAGAGTGGAGCTCAACAGGAAGG - Intergenic
1053656400 9:40222053-40222075 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1053906750 9:42851271-42851293 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1054368506 9:64368275-64368297 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1054528216 9:66154232-66154254 GAAGGCGGAGCTCCCCTGGATGG + Intergenic
1054676130 9:67858027-67858049 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1055521357 9:77084304-77084326 GATGGGGGAAGGCCACAGGAAGG - Intergenic
1056389765 9:86130246-86130268 GAAGGAGGAGCTTCACATGACGG - Intergenic
1057507161 9:95644461-95644483 GATGGTGGAGTGCCACAGTAAGG + Intergenic
1058846362 9:108963659-108963681 GCTGGAGGAGTGCCACAGGATGG - Intronic
1060139018 9:121188965-121188987 GAAAGTGGATTGCCAGAGGATGG - Intronic
1060774908 9:126365953-126365975 GAAGGAAGAGGGCCACTGGAGGG - Intronic
1061407917 9:130402942-130402964 GCAGGTGGAGAGCCAGAGGCAGG + Intronic
1061483363 9:130908234-130908256 GAGGGTGGTGCGGCAGAGGAGGG + Intronic
1061777818 9:132977678-132977700 GAAGGTGGGGAGCCAGGGGATGG + Intronic
1061793196 9:133069293-133069315 GAAGGTGCAGCACCCCAGGAAGG - Intronic
1061795800 9:133085077-133085099 GAAGGTGCAGCACCCCAGGAAGG - Intronic
1061994483 9:134176831-134176853 GGAGGAGGAGAGACACAGGAGGG - Intergenic
1203748357 Un_GL000218v1:57229-57251 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1185812211 X:3121140-3121162 GAAGGTGGAGCGTGGGAGGAGGG + Intergenic
1188283108 X:28294897-28294919 GAAGGTGGATCCCCTCATGATGG - Intergenic
1190302570 X:49065210-49065232 GAAGCTGAAGCAGCACAGGAGGG - Intronic
1192217506 X:69172950-69172972 GAAGGTGTGGAGCCACAGGCAGG + Intergenic
1193758966 X:85441584-85441606 GCATGTGTAGTGCCACAGGATGG - Intergenic
1194950223 X:100116818-100116840 GAAGGTGGAGGGTGAGAGGAGGG + Intergenic
1198525799 X:137499366-137499388 GAAGGTGGAGAGTGGCAGGAGGG + Intergenic
1198736647 X:139792756-139792778 GAGGGTGGTGCGCCCAAGGAAGG + Intronic
1201161704 Y:11172199-11172221 GAAGGCGGAGCTCCCCTGGATGG - Intergenic
1201269142 Y:12237468-12237490 GAAGGTGGAGCGTGGGAGGAGGG - Intergenic