ID: 1133202305

View in Genome Browser
Species Human (GRCh38)
Location 16:4211402-4211424
Sequence CTGTTGTCCTTCAATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133202297_1133202305 8 Left 1133202297 16:4211371-4211393 CCTCTGGGAATCCAGCCCTTTCC 0: 1
1: 0
2: 1
3: 65
4: 384
Right 1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG 0: 1
1: 0
2: 0
3: 14
4: 160
1133202302_1133202305 -8 Left 1133202302 16:4211387-4211409 CCTTTCCATGGGCTCCTGTTGTC 0: 1
1: 0
2: 3
3: 21
4: 257
Right 1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG 0: 1
1: 0
2: 0
3: 14
4: 160
1133202300_1133202305 -3 Left 1133202300 16:4211382-4211404 CCAGCCCTTTCCATGGGCTCCTG 0: 1
1: 0
2: 15
3: 435
4: 679
Right 1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG 0: 1
1: 0
2: 0
3: 14
4: 160
1133202301_1133202305 -7 Left 1133202301 16:4211386-4211408 CCCTTTCCATGGGCTCCTGTTGT 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG 0: 1
1: 0
2: 0
3: 14
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133202305 Original CRISPR CTGTTGTCCTTCAATGATGA TGG Intronic
904361375 1:29974747-29974769 AAGGTCTCCTTCAATGATGATGG + Intergenic
907138430 1:52161198-52161220 GGGTTGTCCTTCACTGATTAAGG + Intronic
909126451 1:71677141-71677163 TTGTTGGCCTTCTATAATGATGG + Intronic
913520856 1:119644970-119644992 CTGTTTCCATTCAATTATGAAGG - Intronic
914012071 1:143787421-143787443 CTTGTGTCCTTCAGTGGTGATGG + Intergenic
917953613 1:180067847-180067869 TTGATCTCCTTCAATGATGTTGG + Intronic
922656960 1:227393586-227393608 CTGGTGTCCTTAAAAGAAGAGGG + Intergenic
924602758 1:245505899-245505921 CTGGTGTCTTTAAATGATTAAGG + Intronic
1062870118 10:893912-893934 CTGTTGTCCTTTAGTGATCTTGG - Intronic
1063221450 10:3972275-3972297 CTGTTGTCCTGCAATGGAAACGG + Intergenic
1064803003 10:19097506-19097528 CTGTTGTCCTAAAATGTTCAAGG + Intronic
1066005137 10:31140107-31140129 CTGTTGACCTCCTTTGATGATGG + Intergenic
1066498069 10:35961763-35961785 CTTTTCACCTTCAGTGATGATGG - Intergenic
1067215534 10:44299723-44299745 CTGATGTCCTTCTAAGAAGATGG - Intergenic
1068118771 10:52763048-52763070 CTGGTGTCCTTCTAAGAAGAGGG - Intergenic
1068635333 10:59341831-59341853 CTGATGTGCTTGAATTATGAAGG - Intronic
1070236727 10:74635371-74635393 ATATTTTCCTTCAGTGATGAAGG + Intronic
1070370609 10:75778536-75778558 CTGTAGTCAATCAATGAGGATGG + Intronic
1072867243 10:99076948-99076970 AAATTGTCCTTCAATAATGATGG - Intronic
1073070060 10:100787672-100787694 CTCTTCTCCTTCAATAATCAGGG - Intronic
1073322961 10:102626742-102626764 CTTTTGTCCTTCTACGGTGAGGG + Intronic
1074377277 10:112950808-112950830 CTGATTTCCTTCAAAGACGAGGG + Exonic
1075010753 10:118868007-118868029 CTGATGTCCTTCAAGGAAGAAGG + Intergenic
1075365907 10:121888486-121888508 CGGTTGTCCTTCATTTGTGATGG - Intronic
1075669820 10:124256728-124256750 CTGTTGTCCTTATAAGAAGAGGG + Intergenic
1078424925 11:11241734-11241756 CTGATGTGCTTCAGAGATGAAGG + Intergenic
1081712210 11:45224627-45224649 CTGTCGGCCTTGAATGATGAAGG - Exonic
1082686957 11:56250681-56250703 CTGTAGTCCCTCATTTATGAGGG + Intergenic
1084007159 11:66329382-66329404 CTGTAGTCCTTCAAAGCAGAGGG - Intergenic
1088138614 11:106587926-106587948 TTGTTTTCCTCCAATGATTAAGG + Intergenic
1088780922 11:113133049-113133071 CTGTTGTCCTGCATTGTTGAGGG + Intronic
1089933615 11:122340383-122340405 GTGTTTTCTTTCTATGATGATGG + Intergenic
1090693715 11:129214857-129214879 CTGCTGTCCTTCTACGAAGATGG - Intronic
1091214630 11:133893189-133893211 CTGTTGCCCTTTGATGATTAAGG + Intergenic
1092568113 12:9690263-9690285 AAGTTGTCCTTCAAGAATGAAGG + Intronic
1092771985 12:11905044-11905066 TTTTTTTCCTTGAATGATGAAGG - Intergenic
1094437533 12:30437536-30437558 CCCTTGTCATTCAAGGATGATGG - Intergenic
1096189079 12:49603198-49603220 CTTTTGTCCTTCAATGAGAGTGG + Exonic
1096805415 12:54138087-54138109 CTGTTTTCCTTCCCTGATGATGG + Intergenic
1098112969 12:67143513-67143535 CTGTTGTCCTTGAATGTAGCTGG - Intergenic
1099801591 12:87463676-87463698 CTGTTGTCCTTATAAGAAGATGG - Intergenic
1103864609 12:124042047-124042069 CTGGTGTCCTTCTAAGAAGAGGG - Intronic
1104062083 12:125277170-125277192 CTGGTGTCCTTAGATGAAGAGGG + Intronic
1104713393 12:131001104-131001126 CTATTGTCATTCAAGAATGATGG - Intronic
1106647667 13:31654120-31654142 TTGTTGTCCTTCAATGGAAAAGG + Intergenic
1107465343 13:40644744-40644766 CTTTTGTGCTTGAATGAGGATGG - Intronic
1108954106 13:56129611-56129633 CTGATACCCTTAAATGATGAAGG - Intergenic
1120923263 14:89773865-89773887 CAAGTGTTCTTCAATGATGAGGG + Intergenic
1124235786 15:27988450-27988472 CTGATGTCCTTATAGGATGAGGG + Intronic
1125987164 15:44064867-44064889 CTGGTGTCCATTAATGATAATGG - Intronic
1126490149 15:49227954-49227976 CAGTTCTCCTTCATTTATGAAGG + Intronic
1128555990 15:68631995-68632017 CTGTTGACCTTTAGTAATGAGGG + Intronic
1133202305 16:4211402-4211424 CTGTTGTCCTTCAATGATGATGG + Intronic
1134160025 16:11880227-11880249 CTGGTGTCCATAAAGGATGATGG - Intronic
1134745562 16:16585433-16585455 CTGTTGTCCTTCCAGCACGATGG + Intergenic
1138905351 16:61324842-61324864 CTGCTGTCCCTCAATGATAGAGG + Intergenic
1143714901 17:8760167-8760189 CTCTTTTCCTTCAGTGATGCAGG + Intergenic
1147241950 17:39096257-39096279 CTGCTTTGCTTCAATGCTGAGGG - Intronic
1151821522 17:76499580-76499602 CTTTTGTCCTGCAATAAAGAGGG - Intronic
1155191120 18:23431517-23431539 TTGTTGTCCTTCAATTTTTAGGG + Intronic
1155635552 18:27950768-27950790 ATGTTTTTCTTCTATGATGATGG + Intergenic
1155865090 18:30955058-30955080 CTGGTGTCCTTCTAAGAAGATGG - Intergenic
1156148556 18:34216351-34216373 TAGTTGTCCTTCAAGGATAAAGG + Intronic
1161884493 19:6983343-6983365 CTGGTGTCCTTATAAGATGAAGG - Intergenic
1163002627 19:14378099-14378121 CTTTTGTTCTGCAATGATGAGGG - Intergenic
1167560447 19:50223740-50223762 CTGTTTTCCTGCACTGAAGACGG + Intronic
927311612 2:21638097-21638119 CTGCTGGCCTTCAAAGGTGAAGG - Intergenic
927848523 2:26484626-26484648 CTGGTGCTCTGCAATGATGAGGG + Exonic
928675080 2:33642846-33642868 CAGTTGACCTTGAATGATGTGGG + Intergenic
932008036 2:67947347-67947369 CAGTTGGCCTTCACTGATGTTGG - Intergenic
932073234 2:68642096-68642118 CAAATGTCCATCAATGATGAAGG - Intergenic
934572181 2:95379697-95379719 CTGTTCTCCTTCAAAGTTGGGGG + Intronic
937959768 2:127448224-127448246 ATGTTATCCTTCAAAGGTGAAGG - Intronic
939658968 2:144863797-144863819 GTGTTGTCCTACTATGATAAGGG + Intergenic
939664335 2:144932163-144932185 CTGTTGTACTTAAGTGGTGAAGG - Intergenic
940390139 2:153122949-153122971 CTGGTGTTCTTCTAAGATGAGGG + Intergenic
941246012 2:163098525-163098547 CTGTTTTCTTTCTATTATGAGGG - Intergenic
943360489 2:186913068-186913090 CTCTTGTTCTTCAGTGATGTTGG + Intergenic
944858558 2:203792121-203792143 GTGTTGTCCTTCACTGATGTAGG - Intergenic
946007678 2:216539431-216539453 CTGGTGTCCTTGAAAGAAGAGGG - Intronic
946579193 2:221107933-221107955 GTGATGTCCTTCTATAATGAGGG + Intergenic
946639236 2:221765661-221765683 CTGCAGTCCCTCAATGCTGATGG + Intergenic
948359849 2:237412422-237412444 CTGCTCTCCTTCAATGGGGAAGG + Intronic
948564338 2:238874106-238874128 CGATTGTCTGTCAATGATGAGGG + Intronic
1169616447 20:7451687-7451709 ATGTTGTCCACCAATGTTGAGGG - Intergenic
1170357942 20:15512660-15512682 CTGTTGTCCTTTACTGAAGCCGG + Intronic
1170762416 20:19262592-19262614 CAATTGTGCTACAATGATGATGG + Intronic
1170915037 20:20614703-20614725 TTCTTGTTCTTCAAAGATGAGGG - Intronic
1174063273 20:47847021-47847043 CTGTTGTCCTTTAATTAGCAGGG - Intergenic
1174844012 20:53926124-53926146 CTGATTTACTTCCATGATGATGG + Intergenic
1178704582 21:34862668-34862690 CTGATGTCCTTCTAAGAAGAGGG - Intronic
1181338329 22:22158306-22158328 CTGGTGTCCTTATAAGATGATGG + Intergenic
1182038872 22:27220592-27220614 CTGTTGTCATTCAAGAAGGATGG - Intergenic
1184346771 22:43918379-43918401 CTCCTGTCTGTCAATGATGATGG - Intergenic
949416415 3:3819608-3819630 CTGGTGTCCTTTAAAGACGAGGG - Intronic
951085163 3:18503769-18503791 CTCTTGTGCTTCAATAAAGAAGG + Intergenic
954660727 3:52225515-52225537 CTGTTGTCCTACCATGCTGGGGG + Exonic
956428769 3:69163875-69163897 CAGTAGCCCTTCAATTATGATGG - Intergenic
957346666 3:78970327-78970349 CTGTTTTCCTTCTTTGATGCTGG + Intronic
959149297 3:102589561-102589583 GTCTTGTCTTTCAATGATAAGGG + Intergenic
959235881 3:103721269-103721291 CTGTTGCCTTTCATTGATGTTGG + Intergenic
961738015 3:129014493-129014515 CTGGTGTCCTTCTAAGAAGAGGG - Intronic
964698520 3:159537140-159537162 CTCTTGCCCTTCTGTGATGAGGG - Intronic
965375965 3:167924408-167924430 CTGTAGACCTTCAAAGATCAAGG - Intergenic
966037821 3:175441771-175441793 CTGGTGTGTTTTAATGATGATGG - Intronic
967242602 3:187455797-187455819 GTTTTGTCCTTTGATGATGATGG + Intergenic
967475761 3:189915519-189915541 CAGTTTTCCTAGAATGATGAGGG - Intergenic
970265560 4:14280181-14280203 CTGTTAACCTTCAGTGGTGAAGG - Intergenic
971091901 4:23355317-23355339 CTGTAGTCATTCAAGGATCAGGG + Intergenic
971427814 4:26533355-26533377 CTGTCTTCCTTCCATGATGATGG + Intergenic
973951210 4:56016054-56016076 TGGGTGTCCTTCAAAGATGAGGG + Intronic
974561420 4:63525829-63525851 TTGTTGTGCTTCACTGATAAAGG - Intergenic
977450599 4:97191480-97191502 CTGTTGTCTTTCCAAGATGAAGG + Intronic
978866291 4:113515983-113516005 ATACTGTCCTTCAACGATGAAGG + Intronic
979081349 4:116347849-116347871 CTGGTGTCCTTCAATTAAGAAGG - Intergenic
979081578 4:116350375-116350397 CTGGTGTCCTTCAATTAAGACGG + Intergenic
979215597 4:118160310-118160332 AAATTGTCCTTCAATAATGAAGG + Intronic
981083370 4:140657551-140657573 CTGTTGAACTGCAAGGATGATGG - Exonic
983853640 4:172614734-172614756 CTGTTATTCTTAAAAGATGAGGG + Intronic
985155136 4:186979648-186979670 CTTGTGTCCTGGAATGATGACGG + Intergenic
985838411 5:2287972-2287994 CTGCTGTCCTGCAAAGAAGACGG + Intergenic
986972814 5:13356974-13356996 CTGTTGTCCTTATAAGAAGAGGG + Intergenic
987640606 5:20607021-20607043 CTGTTGGCTTTCAAAGATGGAGG + Intergenic
991184225 5:63788525-63788547 TTGGTGTCCTGCAATGAGGAAGG + Intergenic
991195390 5:63925944-63925966 GTGTTTTCCTCCAGTGATGAGGG - Intergenic
993135452 5:83955794-83955816 CTTTTGTCTTTTAACGATGAAGG + Intronic
994291385 5:98032049-98032071 CTGCTGTGATTCACTGATGAGGG + Intergenic
994708649 5:103237752-103237774 CATCTGTCCTTCACTGATGATGG - Intergenic
994879929 5:105477132-105477154 AAGTTGTCCTTCAGCGATGAAGG + Intergenic
995083632 5:108083034-108083056 CTGTTGTCCATGACTGAAGAGGG + Intronic
996060152 5:119024068-119024090 CTGTTGTCCCTCACTTATGAAGG - Intergenic
997470589 5:134114973-134114995 CTGCTGGCCTTCCAGGATGAAGG + Exonic
998031274 5:138870672-138870694 CTGCTGTCCTTCAGGGCTGATGG + Exonic
998382134 5:141733280-141733302 CTGGTGTCCTTCTAAGAAGAGGG + Intergenic
1000866096 5:166516882-166516904 CTGTAGTCATAAAATGATGAAGG - Intergenic
1004859114 6:19782975-19782997 CAGTTTTCCTTCAATGAAGTTGG + Intergenic
1009588050 6:65631410-65631432 CTTTGGTCCTTGAATGAGGATGG + Intronic
1011000443 6:82582623-82582645 CTGGTGTCCTTCTAAGAGGAGGG + Intergenic
1011018572 6:82785844-82785866 CTGTTTTACTTCAATGATTGGGG - Intergenic
1012060275 6:94469568-94469590 CTGTTGCCCTTCAATCCTGATGG + Intergenic
1013130691 6:107229845-107229867 CTGTTGCCCTCCAAGGATAAAGG - Intronic
1013184101 6:107742698-107742720 CAGTTATCCTTCAAATATGAAGG + Intronic
1014754918 6:125292227-125292249 CTGTTGTCTTTCATTTGTGAAGG - Intronic
1015200039 6:130569074-130569096 CTGTTGTTGTTCCATGATGTGGG - Intergenic
1019629355 7:2039258-2039280 CTGATGTCCTTCGGTGGTGATGG - Intronic
1019938630 7:4272208-4272230 CTGGTGTCCTTCACAGATGCAGG + Intergenic
1021721125 7:23504928-23504950 GGGTTGTCCTTCACTGATTAAGG + Exonic
1031013381 7:116547079-116547101 CTGGTGTCCTTATATGAAGATGG - Intronic
1031029113 7:116715433-116715455 CTGTTGTCCTTATAAGAAGAGGG - Intronic
1033499426 7:141933086-141933108 CTGTGGTTCTTCAAACATGATGG - Intronic
1033761203 7:144438608-144438630 TTGTCTTCCTCCAATGATGAAGG + Intergenic
1035559958 8:596856-596878 TTGATTTCCTTCAATGATGGGGG - Intergenic
1036293274 8:7514429-7514451 CTGTTGAGTTTCAGTGATGAAGG - Intergenic
1036329282 8:7806572-7806594 CTGTTGAGTTTCAGTGATGAAGG + Intergenic
1036949644 8:13128890-13128912 CTGTTCTCCATTAATTATGATGG + Intronic
1039455505 8:37703285-37703307 CTGTTGTTATGCAATAATGAGGG - Intergenic
1045835704 8:106519050-106519072 CTGCTCTTCTTCAATGATGGGGG - Exonic
1047990630 8:130282912-130282934 CTGTTTTACTTAAATGATGAAGG - Intronic
1048421055 8:134278860-134278882 CTGCTGTCCTTAAAAGAAGAGGG + Intergenic
1048958441 8:139555965-139555987 CTGTTGTCGGTCAAGCATGAAGG + Intergenic
1049235122 8:141508407-141508429 CTGTTCGCCTGCAATGAGGAAGG + Intergenic
1052011714 9:23418554-23418576 CAGTTGTCCCTAAATGCTGATGG - Intergenic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055055024 9:72015483-72015505 GTGTTGTCATTCAAGAATGAGGG + Intergenic
1056205810 9:84318293-84318315 CTGTTACCTTTCAATGCTGAGGG + Intronic
1057276554 9:93679028-93679050 TTGTTTTCCTTGTATGATGAGGG + Exonic
1059149593 9:111937497-111937519 CTGGTGTCCGTCAGTCATGAGGG - Intergenic
1186903072 X:14079054-14079076 CTGGTGTCCTTATAAGATGAAGG + Intergenic
1188303978 X:28539764-28539786 CTGATGTCCTTAAAAGAAGAGGG + Intergenic
1188907365 X:35804719-35804741 GTTATGTCCTTCAATCATGAGGG - Intergenic
1189590033 X:42501068-42501090 CTCTTGACCTACAATGTTGAAGG + Intergenic
1193317509 X:80080611-80080633 AAATTGTCCTTCAATAATGAAGG - Intergenic
1195482860 X:105367984-105368006 ATCTTGTCCTTCAAAAATGAAGG - Intronic
1197121738 X:122901270-122901292 CTGTTTTCCTTCATTTTTGAAGG - Intergenic
1202591508 Y:26488497-26488519 TGTTTCTCCTTCAATGATGAAGG - Intergenic