ID: 1133202901

View in Genome Browser
Species Human (GRCh38)
Location 16:4215319-4215341
Sequence CCACTGGGACAGCTTGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133202896_1133202901 -4 Left 1133202896 16:4215300-4215322 CCTAAAGTCAAGGCTAATCCCAC 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 170
1133202893_1133202901 8 Left 1133202893 16:4215288-4215310 CCTGGCCATGCTCCTAAAGTCAA 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 170
1133202895_1133202901 3 Left 1133202895 16:4215293-4215315 CCATGCTCCTAAAGTCAAGGCTA 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133202901 Original CRISPR CCACTGGGACAGCTTGTCCC TGG Intronic
900513670 1:3071500-3071522 CAGCTGGGACCGCTTGTCCCAGG + Intronic
900642244 1:3693373-3693395 CCGCTGGGCCAGCCTGGCCCTGG + Intronic
901122808 1:6908799-6908821 TCAGTGGGACAGCCTGTGCCAGG + Intronic
903668833 1:25023720-25023742 CCACTGTGCCAACCTGTCCCTGG + Intergenic
904321135 1:29698422-29698444 CCCCTGGGTCAGCTTCTCCCTGG - Intergenic
907276831 1:53321431-53321453 CCCCTGGGACAGCATGGGCCTGG + Intronic
908098631 1:60767246-60767268 CCACTAAGACAGCTAGACCCAGG + Intergenic
908321353 1:62981947-62981969 CCACTGGGACAGTCTGACTCAGG - Intergenic
911557247 1:99360061-99360083 CCACTGGGAGAGCTTAACCAGGG - Intergenic
912822587 1:112879647-112879669 ACACTGGGTCAGCTTCTGCCAGG - Intergenic
913289750 1:117261196-117261218 ACACCGGGACAGCTGGGCCCTGG + Intergenic
916854862 1:168738805-168738827 CCACTAGGCCATGTTGTCCCTGG + Intergenic
919805122 1:201376892-201376914 CCACTGGGAGAACCTGTCCTTGG - Intronic
1062947785 10:1474290-1474312 CCTCTGGGACGGCATGGCCCTGG + Intronic
1063062086 10:2566545-2566567 TCAATGGGACATTTTGTCCCTGG - Intergenic
1063675964 10:8140926-8140948 ACACTGGGAGAGATTGTCCTTGG + Intergenic
1064528715 10:16284940-16284962 CCACGGAGACAGCTTCTACCTGG - Intergenic
1064803883 10:19109182-19109204 CCAGTGGGGAAGCTTGTCCAAGG - Intronic
1067029576 10:42871272-42871294 CCACTGGGAAAGGCTGGCCCTGG + Intergenic
1067737463 10:48869271-48869293 CCTTTGAGACAGCTTCTCCCAGG + Intronic
1067756407 10:49009043-49009065 ACTGTGGGACAGCTTGGCCCTGG + Intergenic
1070791816 10:79194105-79194127 CCACTGGCACCGCTTGCCCCAGG + Intronic
1071600193 10:86955233-86955255 CCACTGGGACAGCAAATCCTGGG + Intronic
1074550745 10:114439895-114439917 CTGCAGGGACAGCTTGACCCAGG + Intronic
1075320886 10:121491020-121491042 CCACCGGGAGAGTTTGGCCCGGG - Intronic
1075712338 10:124537430-124537452 CCAATGGCACAGCTTGCTCCGGG - Intronic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1077417800 11:2432924-2432946 CCACTGGCAGAGCTTGCCCATGG - Intergenic
1078901190 11:15644251-15644273 TCACTTGCACAGCTTGTTCCAGG + Intergenic
1081938046 11:46918294-46918316 CCGCCGGGAAAGTTTGTCCCTGG - Intronic
1083238313 11:61366763-61366785 CCACTGGGATATCTTTTCTCTGG + Intronic
1089580523 11:119479092-119479114 CCACTGGGAGAGAATGTCCATGG + Intergenic
1090246642 11:125220851-125220873 CCACTGGGTCAGTACGTCCCAGG + Intronic
1091238024 11:134034518-134034540 CCACTGGGACACCTGGTACTTGG - Intergenic
1092167684 12:6352949-6352971 CCTGTGGGACAGCTGGGCCCAGG + Intronic
1096176881 12:49527494-49527516 TCACTCAGACAGCTTGTTCCAGG + Intergenic
1096463294 12:51834633-51834655 CCGCTTGGCCAGCTTCTCCCAGG - Intergenic
1096815142 12:54197176-54197198 GCGCTGGTACAGCATGTCCCAGG + Intergenic
1101874927 12:108591705-108591727 CCACTGGGACCCCATGTCCCTGG + Exonic
1102228114 12:111243695-111243717 CAACTGTCACAGCTTGGCCCTGG + Intronic
1102480846 12:113221972-113221994 CCGCTGGGGCAGCCTGACCCAGG - Intronic
1104676585 12:130715532-130715554 CCACTGGGAGAGTCTGCCCCCGG + Intronic
1104832840 12:131766154-131766176 CGCCTGGGCCAGCTTTTCCCGGG - Exonic
1106595288 13:31130158-31130180 CCCCTGGGACTTCTTGCCCCTGG + Intergenic
1106692423 13:32132605-32132627 CAAATGGTACAGCTTGGCCCTGG + Intronic
1110558296 13:76885288-76885310 CGACTCGGACAGCTTGTCGAAGG + Exonic
1113617469 13:111691251-111691273 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1113622999 13:111776511-111776533 CCCCTGGGACAGCTTGGCCAGGG + Intergenic
1116028024 14:39537638-39537660 CCACTGGGAGCTCTTGTCCAGGG - Intergenic
1118276730 14:64392224-64392246 CCACTCGGTCAGCTTCTCACAGG - Intronic
1118319889 14:64746918-64746940 GCACTGGGAGAGCTTAGCCCTGG + Exonic
1119719525 14:76881836-76881858 TCACTGGGCCAGCTGGTTCCTGG - Intergenic
1122625469 14:103083433-103083455 TGAATGAGACAGCTTGTCCCAGG + Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1124549039 15:30660724-30660746 CCACTTGGAGAGTTTGGCCCAGG + Intronic
1126902486 15:53328519-53328541 TCACTGGGAGAACTTGTCCAAGG + Intergenic
1128576066 15:68775968-68775990 CCCTTGGGCCAGCCTGTCCCAGG + Intergenic
1131112878 15:89776435-89776457 CCACTGGGACTCCACGTCCCCGG + Exonic
1131229811 15:90651631-90651653 CCACTAGCACAGCTACTCCCTGG + Intergenic
1132244477 15:100283773-100283795 CCAGAGGGACAGGTTGTTCCTGG + Intronic
1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG + Intronic
1133336756 16:5011356-5011378 CAGCTGGGTCAGCTTCTCCCGGG + Intronic
1136551879 16:30986284-30986306 TCAATAGGACAACTTGTCCCAGG - Intronic
1138845818 16:60564476-60564498 CCACTGGGCCACATTGTCTCTGG + Intergenic
1143906875 17:10216246-10216268 GAACAGGGTCAGCTTGTCCCAGG - Intergenic
1144011275 17:11150507-11150529 CCGCTGTGACAGCTCCTCCCAGG - Intergenic
1144796052 17:17891990-17892012 CCCTGGGGACAGCATGTCCCTGG + Intronic
1146599678 17:34203881-34203903 CCACTGGGTCTGATTGTGCCTGG + Intergenic
1148210760 17:45807060-45807082 GCACTGCGAGAGCCTGTCCCTGG + Exonic
1148650870 17:49249332-49249354 GCATTGGGTCAGCTTCTCCCTGG + Intergenic
1148912203 17:50949118-50949140 CCACTGGGCTAGCTTGTACGTGG + Intergenic
1150228820 17:63538779-63538801 CCACTTGCACAGCATGTGCCCGG + Intronic
1150673499 17:67223307-67223329 CCACAGGGACAGAGTGGCCCAGG + Intronic
1150946894 17:69757186-69757208 ACAATGGTACAGCTTGTACCTGG + Intergenic
1151986137 17:77545087-77545109 ACACAGGGACTGCTGGTCCCCGG - Intergenic
1152564723 17:81095205-81095227 CCACTGGGACTGCCTGCCCATGG + Intronic
1154112132 18:11579248-11579270 CCACTGGGACAGCTAGGATCTGG - Intergenic
1157472774 18:48002869-48002891 TCAGTGGGACAGCTACTCCCGGG - Intergenic
1157621823 18:49021264-49021286 CCACTGCCACAGCTGGGCCCTGG + Intergenic
1158878107 18:61752148-61752170 CCCCTGGGAAGGCTTATCCCAGG + Intergenic
1162060914 19:8094667-8094689 CCACTGGGAGGGCTTGTCCTGGG - Intronic
1162112041 19:8404622-8404644 CCACAGGGGCAGCTTGACCAGGG - Intronic
1162465171 19:10835484-10835506 CCACTGGGACAGGTTGGGGCGGG - Intronic
1163234014 19:16020662-16020684 CCACTGGGTCCCCCTGTCCCTGG - Intergenic
1164616864 19:29672491-29672513 ACCCTGGGACAGCCTGTCTCAGG + Intronic
1165090023 19:33381408-33381430 CTCCTGGGACAGCTTCTCCTGGG - Exonic
1167609547 19:50500624-50500646 CCGCTGGGACTGCTCTTCCCAGG - Intergenic
925538990 2:4946031-4946053 CCTCTGGGACTCCCTGTCCCTGG + Intergenic
929572991 2:43034466-43034488 CCACTGTGACAGCCTGGCCTAGG - Intergenic
929668352 2:43851260-43851282 CCACAGGGCCAGCTGGTGCCTGG - Intronic
929686989 2:44043664-44043686 CCTTTGGGACTGTTTGTCCCAGG - Intergenic
931606497 2:64058243-64058265 CCACTGAGAATGCTTGCCCCAGG + Intergenic
933286791 2:80393517-80393539 CCACTGGGACAGATTGGATCTGG - Intronic
937738371 2:125318949-125318971 CCACAGGGCCAGCTTGGCTCTGG + Intergenic
940275592 2:151937278-151937300 CCAATGGTAGAGCTTGACCCTGG - Intronic
946022448 2:216650393-216650415 ACACTGGGACTGCTTGGCCAAGG + Intronic
946555137 2:220847977-220847999 ACAATGAGACAGCTTGTCCAAGG - Intergenic
946776047 2:223142316-223142338 CCAATGGGACACCGTGTCTCCGG + Intronic
948392911 2:237625680-237625702 CAACTGGCACAGCCAGTCCCTGG + Intergenic
1168959920 20:1861993-1862015 CCCATGGGGCAGCCTGTCCCAGG + Intergenic
1169022711 20:2341429-2341451 CCTCTGGCAGAGCTGGTCCCGGG + Intergenic
1172066349 20:32223394-32223416 CCACTGGGACAGCTCTTTGCTGG + Intronic
1173468135 20:43300775-43300797 TCACTAGGACAGGGTGTCCCTGG - Intergenic
1174174476 20:48636244-48636266 CCACTGGGACAGAAGATCCCTGG + Intronic
1174318445 20:49721171-49721193 ACAGTGGGACAGCTTGTCTGGGG - Intergenic
1174366130 20:50057626-50057648 CCTCTGGGACAGCTGGGGCCAGG - Intergenic
1175263614 20:57689690-57689712 CCCCTGGGTCCCCTTGTCCCCGG - Intronic
1175777852 20:61664197-61664219 CCACTGGGAGAGCAAGTCCAAGG + Intronic
1176194090 20:63829172-63829194 GCACTGGGTCAGCCTGGCCCTGG + Intronic
1179128701 21:38614878-38614900 CCAGAGGGAGAGCCTGTCCCAGG - Intronic
1179478074 21:41660398-41660420 ACACTGGGAAGGCTTGGCCCAGG + Intergenic
1181441839 22:22940581-22940603 CCAGTGTGACAGTTTGTCCAGGG + Intergenic
1182099930 22:27650710-27650732 CCATTGGGCCAGCTTGTCTCGGG - Intergenic
1182921849 22:34087622-34087644 CCACTGGAATAGCTTGAACCAGG - Intergenic
1183568047 22:38630788-38630810 CCCCTGGGATGCCTTGTCCCGGG - Intronic
1184512597 22:44942256-44942278 CCACCGGGACAGTGTGTGCCAGG + Intronic
1184884597 22:47334905-47334927 CCCCTGGGCCAGCTTTTCCAGGG + Intergenic
1185002747 22:48256252-48256274 CCCCTGGGACCGTTTGTCTCTGG - Intergenic
1185127534 22:49019871-49019893 CCCCTCGGACAGCAGGTCCCTGG + Intergenic
950141105 3:10616122-10616144 TAACAGGGACAGCTTGTTCCTGG - Intronic
951072934 3:18353212-18353234 CCACTGGGTCAGCCAGTCACTGG - Intronic
952777314 3:37059117-37059139 CTACTGGGACACCTGGTCCTGGG - Intronic
953492071 3:43361031-43361053 CCTCTCAGACAGCTGGTCCCAGG - Intronic
954574955 3:51670954-51670976 CCACAGTGACAGCCTGGCCCAGG - Intronic
954747284 3:52794420-52794442 CCACTGGGACAGCCTCTCTCTGG - Intergenic
954994004 3:54865463-54865485 CCACTGGGGCTGCCTTTCCCCGG + Intronic
955663896 3:61329909-61329931 CCACTGTGGTTGCTTGTCCCAGG - Intergenic
957616930 3:82541799-82541821 CCTCTGCAACAGCTTGCCCCTGG - Intergenic
960619292 3:119623471-119623493 CCAGAGGGACAGCAGGTCCCAGG + Intronic
960814530 3:121659343-121659365 CCACTGAGACTTCTTGACCCTGG + Intronic
961204463 3:125069845-125069867 ACACTGGATCAGCTTTTCCCTGG - Intergenic
962089028 3:132223403-132223425 TCCTTGGGACAGATTGTCCCGGG - Intronic
962679614 3:137784765-137784787 CTACTGAGTCAGGTTGTCCCAGG + Intergenic
963939885 3:151087080-151087102 CCGCTGGGCCAACTTGGCCCCGG - Intronic
965433717 3:168620977-168620999 CCACTGGGAAAACCTGTCCTGGG - Intergenic
966837456 3:184059971-184059993 GCAGTGGGACAGCATCTCCCTGG - Exonic
966840570 3:184083895-184083917 GCAGTGGGACAGCATCTCCCTGG - Intergenic
966843262 3:184106271-184106293 GCAGTGGGACAGCATCTCCCCGG - Exonic
967205722 3:187118985-187119007 CCACTGGGACACGTTGTCTTAGG + Intergenic
968857789 4:3140540-3140562 CTACTGGATCAGCTTGTCCTTGG - Exonic
976099868 4:81550262-81550284 CCACTGTGCCAGCTTTTCCAGGG + Intronic
978939940 4:114424044-114424066 CCAGTAGGTCACCTTGTCCCAGG - Intergenic
984463899 4:180072553-180072575 GCACTGGCACAACTTGTCCCTGG - Intergenic
985317357 4:188672441-188672463 CCACTGGGAAAGCTGTACCCGGG - Intergenic
985499348 5:231873-231895 CCACTGAGAGAGCTTGTCGTGGG + Intronic
985681456 5:1257977-1257999 CCACAGGGCCAGCTTCTGCCTGG - Intronic
987114280 5:14713918-14713940 CCACTGGGACAGCATCTTCCAGG + Intronic
988893026 5:35639848-35639870 CCACTGGGACATCTTTGCTCTGG - Intronic
994043726 5:95285106-95285128 CCAGGGGGACTGCTGGTCCCCGG - Intergenic
996827643 5:127703411-127703433 CCACTGGGATCCCCTGTCCCTGG - Intergenic
998106585 5:139472841-139472863 CCACCGGGCCCTCTTGTCCCTGG + Intergenic
1001080911 5:168666657-168666679 CCTCTCGGACTACTTGTCCCAGG + Exonic
1001659525 5:173380401-173380423 CCACTGGTACAGCTTGATTCGGG - Intergenic
1001989930 5:176107938-176107960 GCACTGGGACAGCCTGTCATGGG - Intronic
1001998501 5:176181400-176181422 GCACTGGGACAGCCTGTCATGGG + Intergenic
1002071825 5:176683175-176683197 GCTCTAGGGCAGCTTGTCCCAGG + Intergenic
1002226941 5:177730200-177730222 GCACTGGGACAGCCTGTCATGGG + Intronic
1002774027 6:313611-313633 TCACTGGGACAGCTTTTACTTGG + Intronic
1004150676 6:13117091-13117113 CCCATGGGACACCTTGTCCTTGG - Intronic
1007211629 6:40197237-40197259 CCCCTGTGTCAGCTTGTCCTTGG - Intergenic
1008588601 6:52970839-52970861 CAACTTGGACATCATGTCCCTGG - Intergenic
1009910296 6:69917959-69917981 CCTCTGGGAAAGACTGTCCCAGG + Intronic
1014163553 6:118197833-118197855 CCACTGGGACAGCCAGTGGCTGG + Intronic
1014952636 6:127576082-127576104 TCACTGGTACTGCTTGTTCCTGG - Intronic
1018742387 6:166740043-166740065 CCACTGGGACATCAGGGCCCTGG - Intronic
1022312581 7:29210994-29211016 ACACTGAGATAGGTTGTCCCTGG + Intronic
1024186931 7:46958868-46958890 CCTCTAGGAAAGATTGTCCCAGG + Intergenic
1029530381 7:101121546-101121568 GCTCTGGGACAGCCTGTCCAGGG - Intergenic
1031815778 7:126433395-126433417 CAACTGTGACAGCTTCTCCTGGG + Intergenic
1035556209 8:569120-569142 CCATTGGGGCTGCTTGTCACAGG + Intergenic
1039901168 8:41753511-41753533 CAACTGGGACAGCGTGCCCCTGG - Intronic
1043030189 8:75124658-75124680 TCACAGGGACAGCTTGCCCACGG - Intergenic
1047673642 8:127175713-127175735 CCACTGGTAGAGATTGTTCCTGG - Intergenic
1048071702 8:131028254-131028276 CCATTGGCACAGCTTCTCTCTGG + Intronic
1049081328 8:140445542-140445564 CCATGGGGACAGCCTGGCCCGGG - Intronic
1060303437 9:122390108-122390130 CCACTGGAAGCTCTTGTCCCAGG + Intronic
1061028631 9:128066761-128066783 CCACTGCCACCGCCTGTCCCAGG + Exonic
1061824165 9:133247470-133247492 CTGCTGGCAGAGCTTGTCCCTGG - Intergenic
1061921610 9:133785538-133785560 CCTCTGCCACAGCCTGTCCCAGG - Intronic
1062116000 9:134809242-134809264 CCACAGGGCCAGCTGGACCCGGG - Exonic
1062657769 9:137613113-137613135 GCACTGGCCCATCTTGTCCCAGG + Intronic
1196610750 X:117711933-117711955 CCACAGACAGAGCTTGTCCCTGG - Intergenic
1199883423 X:151995151-151995173 CCAGTTGGCCAGCTAGTCCCCGG + Intergenic