ID: 1133205677

View in Genome Browser
Species Human (GRCh38)
Location 16:4232083-4232105
Sequence CTGTCTACACAGAGGCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133205677_1133205681 -7 Left 1133205677 16:4232083-4232105 CCGCTCTGCCTCTGTGTAGACAG 0: 1
1: 0
2: 0
3: 33
4: 261
Right 1133205681 16:4232099-4232121 TAGACAGCGCCAAGCAAGGAGGG 0: 1
1: 0
2: 1
3: 18
4: 295
1133205677_1133205682 -1 Left 1133205677 16:4232083-4232105 CCGCTCTGCCTCTGTGTAGACAG 0: 1
1: 0
2: 0
3: 33
4: 261
Right 1133205682 16:4232105-4232127 GCGCCAAGCAAGGAGGGACTTGG 0: 1
1: 0
2: 1
3: 14
4: 129
1133205677_1133205684 2 Left 1133205677 16:4232083-4232105 CCGCTCTGCCTCTGTGTAGACAG 0: 1
1: 0
2: 0
3: 33
4: 261
Right 1133205684 16:4232108-4232130 CCAAGCAAGGAGGGACTTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 224
1133205677_1133205680 -8 Left 1133205677 16:4232083-4232105 CCGCTCTGCCTCTGTGTAGACAG 0: 1
1: 0
2: 0
3: 33
4: 261
Right 1133205680 16:4232098-4232120 GTAGACAGCGCCAAGCAAGGAGG 0: 1
1: 0
2: 1
3: 11
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133205677 Original CRISPR CTGTCTACACAGAGGCAGAG CGG (reversed) Intronic
900350614 1:2232778-2232800 CAGTTTACACTGAGGCAGAGAGG - Intronic
900502984 1:3015744-3015766 CTGTGTCCTCAGTGGCAGAGAGG - Intergenic
900583260 1:3419676-3419698 CTGGCCACACAGAGCTAGAGGGG + Intronic
902294008 1:15453898-15453920 CTCACTACACAGAGGCACTGGGG + Intergenic
903249930 1:22045496-22045518 CTGAATCCACAGAGGCACAGAGG + Intergenic
903642106 1:24867312-24867334 ATGTCTGCACAGAGGCTGAGCGG + Intergenic
903649520 1:24914346-24914368 CTGTCTACCCAGCAGCAGGGTGG + Intronic
903829647 1:26166935-26166957 ATGTCTACACAGAGGCATGCAGG + Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
906187134 1:43870785-43870807 GTGTCTGCAGAGAGGCAAAGTGG + Intronic
907321591 1:53606185-53606207 CTGTCCAGACAGCAGCAGAGGGG - Intronic
907685288 1:56605371-56605393 TAGCATACACAGAGGCAGAGAGG - Intronic
909151355 1:72010074-72010096 CTGGCTGGACAGTGGCAGAGGGG - Intronic
909423591 1:75494778-75494800 CAGTCTTCACTGAGCCAGAGAGG - Intronic
910485672 1:87710926-87710948 CTGTCAAGACAGAGCCAGGGAGG - Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
913999866 1:143684381-143684403 CTTTCTCCACACAGGCACAGAGG + Intergenic
914195046 1:145443186-145443208 CTTTCTCCACACAGGCACAGAGG + Intergenic
914476317 1:148025763-148025785 CTTTCTCCACACAGGCACAGAGG + Intergenic
915578959 1:156801895-156801917 CAGTATTCACAGAGGCAGTGGGG + Intergenic
916774250 1:167943701-167943723 GTGTTCACACAGATGCAGAGTGG - Intronic
917459380 1:175216438-175216460 TTCTCTACACAGAGACACAGTGG - Intergenic
919863904 1:201764372-201764394 CTGTCTACAGCCAGGAAGAGAGG - Intronic
920157838 1:203969878-203969900 CAGTCTGCACAGAGAGAGAGAGG + Intergenic
920186236 1:204161159-204161181 CAGTGGGCACAGAGGCAGAGAGG + Intronic
922613203 1:226944947-226944969 CTGTCTTCAGAAAGGCAGAGAGG - Intronic
1064152215 10:12874566-12874588 CTGTCTACAGAGGTGAAGAGGGG + Intergenic
1064601879 10:17002025-17002047 CTGTGTACTCAGAGGAACAGAGG - Intronic
1064866264 10:19884004-19884026 CTGGCTACATGGAGGCTGAGAGG - Intronic
1067779389 10:49188484-49188506 CTGTCTTCAGAGAGGCTGAGAGG - Intronic
1068566072 10:58577020-58577042 CTGTCGGGCCAGAGGCAGAGGGG + Intronic
1069193631 10:65521002-65521024 CTGACTTCACAGAGACAGGGAGG + Intergenic
1069746742 10:70719916-70719938 GTGTGTAAACAGAGGCAGTGTGG - Intronic
1070322732 10:75366531-75366553 GTGGGGACACAGAGGCAGAGCGG - Intergenic
1071495559 10:86165392-86165414 CAGTCTAGACCAAGGCAGAGAGG + Intronic
1072010721 10:91300840-91300862 GTGTCTACAGAGAGAGAGAGAGG + Intergenic
1072625178 10:97106744-97106766 CTGTCTGCTCAGGGGTAGAGCGG - Intronic
1074696132 10:116051550-116051572 CTGTCTGACCAGTGGCAGAGGGG - Intergenic
1075162519 10:120037049-120037071 TTGGGTACACAGAGACAGAGGGG + Intergenic
1076277043 10:129209643-129209665 CTGTTTACACTCAGGCAGCGGGG + Intergenic
1079955257 11:26854771-26854793 CTGTCTAAATAGAGGCATAGAGG - Intergenic
1080392394 11:31860557-31860579 CTGGCATCACAGTGGCAGAGGGG + Intronic
1081827914 11:46076005-46076027 CTTTCTAACCAGAGGGAGAGTGG + Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082267268 11:50132581-50132603 CAGCCTACACAAAGCCAGAGAGG + Intergenic
1082288819 11:50345987-50346009 CAGCCTACACAAAGCCAGAGAGG - Intergenic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1085834449 11:79937401-79937423 ATGTCCACAGAAAGGCAGAGCGG - Intergenic
1085985266 11:81779433-81779455 CTGTGCAGGCAGAGGCAGAGTGG - Intergenic
1086569130 11:88262912-88262934 CTGTAGAGACAGTGGCAGAGAGG + Intergenic
1087033370 11:93729180-93729202 CTATCTAAACAGAGGCCTAGAGG + Intronic
1088344261 11:108804990-108805012 CTGCCCACACTGAGGCTGAGGGG + Intronic
1088373491 11:109116472-109116494 CTGCCTACAAAGAGGCAGCTAGG - Intergenic
1088625876 11:111730146-111730168 CTGTCTTTTCAGAGGCAAAGTGG + Exonic
1088692051 11:112336610-112336632 CAGTGTGCACAGAGGCAAAGGGG + Intergenic
1088807291 11:113364213-113364235 CTGCCTTCACAGAAGGAGAGGGG + Intronic
1089075987 11:115739158-115739180 ATGTGTACAGAGAGGGAGAGAGG + Intergenic
1090930186 11:131290649-131290671 CTGTTGAGACGGAGGCAGAGAGG - Intergenic
1092121575 12:6047932-6047954 CTATCTGCACAGAGGCAGAAGGG + Intronic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1096714698 12:53484012-53484034 CTCTCAACCCATAGGCAGAGTGG - Exonic
1097482513 12:60148166-60148188 CTGCCTACACAGAGCCTGATAGG + Intergenic
1100678071 12:96889641-96889663 TTGTCTACACTTTGGCAGAGGGG + Intergenic
1100784195 12:98062022-98062044 CTGTCTGCCCAGATGCAGAAAGG + Intergenic
1100804242 12:98264339-98264361 ATTTCTGCACAGAGGCAGATAGG + Intergenic
1101326244 12:103718285-103718307 CTGTCATCACAGAGGCCTAGAGG + Intronic
1101578677 12:106021851-106021873 CAGTGAACAGAGAGGCAGAGAGG + Intergenic
1103613763 12:122139498-122139520 CCGTTTACTCAGAGGCAGAGCGG - Intronic
1104502187 12:129297016-129297038 CATTTTACCCAGAGGCAGAGAGG - Intronic
1104908547 12:132228452-132228474 CTGTCTTGCCAGAGGCAAAGAGG - Intronic
1104908564 12:132228523-132228545 CTGTCTCGCCAGAGGCAAAGAGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106196665 13:27499816-27499838 CTGTCTACTCAGAGAGAGAGTGG - Intergenic
1106619477 13:31359602-31359624 ATGGGTACACAAAGGCAGAGTGG - Intergenic
1107399292 13:40053416-40053438 CCAGCTACACAGAGGCAGAGTGG + Intergenic
1108739487 13:53320668-53320690 ACGTGTACAAAGAGGCAGAGAGG - Intergenic
1109441567 13:62380667-62380689 TAGTCTACTCAGAGGCAGATAGG + Intergenic
1110318860 13:74137185-74137207 CTGCAAACACAGAGGTAGAGAGG - Intergenic
1111133670 13:84010107-84010129 GTGTATACACACATGCAGAGAGG - Intergenic
1111661417 13:91217096-91217118 CGGTTTACCCAGAAGCAGAGAGG + Intergenic
1111683022 13:91467295-91467317 CTGTCACCACAGAGGGAGAAAGG + Intronic
1112780621 13:102897173-102897195 CTGGCTACACATCTGCAGAGTGG + Intergenic
1113426396 13:110211912-110211934 CTGTCTCCCCAGGGGGAGAGAGG - Exonic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1116568714 14:46487340-46487362 CTGTCCACTCAGAGGCAGGCTGG - Intergenic
1117860880 14:60091786-60091808 CTGTCTTAACGCAGGCAGAGGGG - Intergenic
1118487089 14:66224524-66224546 CTGTCTTTGAAGAGGCAGAGGGG + Intergenic
1119779884 14:77270659-77270681 CGGTCGAGAGAGAGGCAGAGGGG + Intronic
1120959518 14:90111737-90111759 CTGCCTGCACAGAGGGAAAGTGG - Intronic
1121324004 14:93009332-93009354 CCGTCCACACACAAGCAGAGGGG + Intronic
1122886848 14:104714017-104714039 CTGTCTACACTGTGGCAGGGTGG - Intronic
1122965399 14:105121802-105121824 CAGTCTACACAGGGGAGGAGAGG + Intergenic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1123194780 14:106606055-106606077 CTCCCTACAGATAGGCAGAGGGG - Intergenic
1202872482 14_GL000225v1_random:177402-177424 CTGACAACCCGGAGGCAGAGTGG + Intergenic
1124182525 15:27490313-27490335 TTGTCTGCACAGAAGCAGTGTGG - Intronic
1124690976 15:31822558-31822580 CTGCCCACAAAGAGGCAGGGTGG - Intronic
1125843610 15:42829998-42830020 CTGTCTACCCAGCCGGAGAGTGG + Exonic
1127907569 15:63387631-63387653 CAGACAAGACAGAGGCAGAGAGG + Intergenic
1131362260 15:91803637-91803659 CTCTCTATACAGAGGAAGAAAGG - Intergenic
1132214445 15:100052331-100052353 CTTTCTATATAGAGGCAAAGGGG + Intronic
1132510856 16:340686-340708 GTGTTCCCACAGAGGCAGAGCGG + Intronic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1133252623 16:4493616-4493638 CTGGCCACACAGAGGCCAAGAGG - Intronic
1134807859 16:17140968-17140990 CAGTCTGCACAGAGGCTGCGTGG - Intronic
1136043221 16:27596549-27596571 TTTTGTACACAGAGGTAGAGTGG + Intronic
1136519303 16:30786053-30786075 CTGTGTGCACAGGGGCAGTGGGG + Intronic
1138480147 16:57297373-57297395 CTGCCTCCAGAGAAGCAGAGAGG + Intergenic
1138514898 16:57530642-57530664 CTGTCCTCTCAGGGGCAGAGAGG - Intronic
1139272736 16:65698958-65698980 CTGTCTGCAGAGAGAGAGAGAGG + Intergenic
1139965903 16:70745237-70745259 CTTCCGAGACAGAGGCAGAGTGG + Intronic
1139966366 16:70747709-70747731 CTGTCTGCACAGGGGGACAGAGG + Intronic
1139972125 16:70782820-70782842 CTGTCACCACAGAGACACAGAGG - Intronic
1141074933 16:80996282-80996304 CTGGCAACAGAGAGGCACAGCGG - Intronic
1141157816 16:81609529-81609551 CTGTCTCCCCAGGGGCTGAGGGG - Intronic
1141273873 16:82566820-82566842 CTGTCTACACAGAGAAAGTATGG - Intergenic
1141830362 16:86506918-86506940 CCGCCTACACAGAGGCACATGGG + Intergenic
1142231723 16:88903255-88903277 CCTTTTACAGAGAGGCAGAGAGG + Intronic
1142781056 17:2181672-2181694 TGGGCTACAGAGAGGCAGAGGGG - Intronic
1144021979 17:11245706-11245728 CTGCCTGCACAGGAGCAGAGGGG + Intronic
1146470468 17:33120481-33120503 CAGATGACACAGAGGCAGAGGGG + Intronic
1146917849 17:36689561-36689583 CTGACCCCACAGAGGCAGGGTGG + Intergenic
1147511148 17:41069863-41069885 GTGTGTCCACAGAGCCAGAGAGG + Intergenic
1147595618 17:41715373-41715395 CTGTCCCCACAGAGGCCCAGAGG - Intronic
1149085514 17:52710567-52710589 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085522 17:52710608-52710630 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085537 17:52710690-52710712 CTGCCTACAGAGAGGCAGCTGGG + Intergenic
1149987449 17:61358154-61358176 CTGACTACCCAGAGACAGCGTGG + Intronic
1152662568 17:81549577-81549599 CTGTCTCCACTGCGGAAGAGAGG - Intronic
1156570717 18:38249891-38249913 CAGTATACAGAGAGGCAGGGAGG + Intergenic
1157232301 18:45929165-45929187 CTGTCTACTCTGAGGCCGAAAGG + Intronic
1158348057 18:56535727-56535749 CTCTCTAATCAGAGGCAGAGTGG - Intergenic
1158779739 18:60633029-60633051 CTGTATACAAATAGGCAGAATGG + Intergenic
1158880285 18:61772125-61772147 CTTTCTAGAGAGAGGGAGAGAGG - Intergenic
1161330187 19:3683222-3683244 CTGTCTGCACTGTTGCAGAGGGG - Intronic
1164656895 19:29928388-29928410 CTGTCTCCACTGAGGCTCAGGGG - Intronic
1166033056 19:40147518-40147540 GTGTCTACCCAGAGGAAGGGAGG - Intergenic
1167169414 19:47821378-47821400 CTGACAACACAGAGACAGAGAGG + Intronic
1167553589 19:50178169-50178191 TTCTCTACAAAGAGCCAGAGAGG - Intergenic
925204709 2:1996251-1996273 CAGTCCACACTGAGGCAGGGCGG - Intronic
926218297 2:10918960-10918982 CTGTCTCCGCACAGGCAGACAGG - Intergenic
926314671 2:11700568-11700590 CTGCCTCCAGAGAGGCAGGGAGG - Intronic
926994981 2:18724961-18724983 CAGTCTAGGAAGAGGCAGAGCGG + Intergenic
927902270 2:26829096-26829118 CTGTCTCCACAGGAGCAGCGGGG + Intergenic
931884200 2:66598119-66598141 ATGCCAACACAGAGGCATAGAGG + Intergenic
933282817 2:80351245-80351267 CTTTCCCCACATAGGCAGAGTGG + Intronic
936375748 2:111939971-111939993 CTGATTAGACAGAGGCAGAAGGG - Intronic
936404220 2:112187875-112187897 CTGGCTACAAAAAGGCAGAAGGG - Exonic
944619428 2:201498759-201498781 CTGTGTGCACAGAGAAAGAGAGG - Intronic
948378260 2:237536563-237536585 CTGCCTGCACTGAGTCAGAGTGG + Intronic
948605665 2:239133166-239133188 CTGTCTAAACAGAGACACATGGG + Intronic
948856079 2:240731287-240731309 CAGACTAAACAGAGGCAGGGAGG + Intronic
1168779160 20:473951-473973 CTGTCAACAAAGAGGAAGGGAGG + Intronic
1168843176 20:922879-922901 CTGCCTCCTCAGAGGCTGAGGGG + Intergenic
1169219995 20:3816610-3816632 CTGTCTGCACAGAGCCTGATGGG + Intergenic
1169663937 20:8013121-8013143 ATGTGTACACAGAGTGAGAGAGG - Intronic
1169930180 20:10824095-10824117 GTGACACCACAGAGGCAGAGTGG - Intergenic
1173720550 20:45253990-45254012 AAGGCTACACAAAGGCAGAGAGG + Intronic
1174850060 20:53985299-53985321 CAGTTTGCCCAGAGGCAGAGAGG + Exonic
1175129507 20:56779014-56779036 CTGTTTAGACAAAGGCAAAGTGG - Intergenic
1178860985 21:36289523-36289545 AGGTCTACACAAAGGCAGTGAGG - Intronic
1179154633 21:38839116-38839138 ATGTCTGCACACAGCCAGAGTGG + Intergenic
1180180603 21:46117221-46117243 CTGTCTCCGGGGAGGCAGAGTGG - Intronic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1182111263 22:27725341-27725363 CTGGCTACAGAGTGGCAGAGTGG - Intergenic
1182531059 22:30957838-30957860 TTGTATACACAGAGGTAAAGAGG + Intronic
1183384819 22:37508831-37508853 CTGTCTCCCCATCGGCAGAGTGG + Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1185361140 22:50407715-50407737 CTGTGGACACACAGGTAGAGAGG + Intronic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
952665885 3:35903364-35903386 TTGTCCACACAAAGGCAAAGAGG - Intergenic
952850449 3:37724126-37724148 CTGTGTGCCCAGAGGCTGAGTGG - Intronic
953396198 3:42572510-42572532 CTGTCTACCCAGTGACACAGTGG - Intronic
953488271 3:43323936-43323958 ATGACTACACAGAGGCACAAAGG + Intronic
953937520 3:47058775-47058797 CTGACTACAAAGGGGCACAGGGG + Intronic
960710206 3:120520146-120520168 CTGTCTACTCAGAGACAGTGAGG - Intergenic
963110388 3:141683380-141683402 CTGTCTCCACTGAGGCTGTGAGG + Intergenic
963945686 3:151143728-151143750 TTCTCTACACAGAAGCAAAGTGG + Intronic
964858547 3:161173733-161173755 TTCTCTCCACAGAGGCATAGAGG - Intronic
966094594 3:176184536-176184558 CTGTCTACTCAGAGGAGTAGAGG + Intergenic
966655489 3:182353055-182353077 CTGTCTACCCAGAGCCAGGCTGG + Intergenic
967294783 3:187954439-187954461 GTGTGTCCACACAGGCAGAGAGG - Intergenic
968867014 4:3219564-3219586 CCATCTGCACAAAGGCAGAGGGG - Intronic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
970219573 4:13796952-13796974 CTCTTTACACAGATCCAGAGAGG + Intergenic
970260454 4:14218884-14218906 CTGTACACACAGAGGCATTGTGG + Intergenic
972761902 4:42114707-42114729 CTGGCTACACAGAGGCCCAATGG + Exonic
973537311 4:51896413-51896435 CTGTCTACGAAGAAGAAGAGCGG - Intronic
973890570 4:55363665-55363687 CAGGCATCACAGAGGCAGAGAGG - Intronic
974084393 4:57244042-57244064 CTGTCTATACACAGACATAGTGG + Intergenic
974855846 4:67459634-67459656 CTAACTACCCAGAGGCACAGGGG - Intergenic
975610212 4:76195793-76195815 CTGAGTATACACAGGCAGAGGGG + Exonic
975928261 4:79486468-79486490 ATGTGAAGACAGAGGCAGAGTGG + Intergenic
980828193 4:138097002-138097024 CTTTCTATACTAAGGCAGAGAGG - Intergenic
983030149 4:162790562-162790584 CTGCCTACACAGAGGTAGCTAGG + Intergenic
983534864 4:168846675-168846697 CAGTCTACCCAGAGGAAGATAGG + Intronic
985144705 4:186884111-186884133 CTGTCTACACATATGCAAAATGG - Intergenic
986644019 5:9898792-9898814 CTGTCCACAGACAGGCAGAGGGG + Intergenic
987026540 5:13932447-13932469 CTGCATACACAAAGGCTGAGAGG + Intronic
987226859 5:15850988-15851010 CTGTCTGGAAAGAGGCAAAGCGG - Intronic
987588660 5:19893129-19893151 CTGTGTCCTCAGAGGCAGAGGGG - Intronic
993531367 5:89028768-89028790 CTGATTACACAGAAGCAGAAGGG - Intergenic
996545167 5:124670204-124670226 CTTTCTTCACAGAGATAGAGGGG + Intronic
997210544 5:132074464-132074486 CTGACTACAGAGAGGCACAGAGG + Intronic
997340906 5:133143858-133143880 CAGTCTACAGAGAGGTAGGGAGG - Intergenic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
998172543 5:139881054-139881076 CTCTCTCCACAGAGCCACAGTGG + Intronic
999432125 5:151533453-151533475 CAGTCAACACAAAGGCAGGGTGG - Intronic
1000875161 5:166628068-166628090 CTATATACACAGAGAGAGAGAGG - Intergenic
1000971388 5:167718438-167718460 TTGTCTCCAGGGAGGCAGAGAGG - Intronic
1001168207 5:169391138-169391160 ATGTCTACACAGGGGCAGCTTGG + Intergenic
1001215481 5:169852064-169852086 CTGTCAGCACAGAGAGAGAGAGG + Intronic
1001775422 5:174325940-174325962 CTGTCTCCAGAGAAGCAGAAGGG + Intergenic
1002052348 5:176578148-176578170 ATCTCTGCAGAGAGGCAGAGAGG - Intronic
1002306376 5:178286275-178286297 CTGCCTACACAGAGGAAGTGGGG + Intronic
1002426550 5:179180202-179180224 CTGTGCAGACAGAGGAAGAGAGG - Intronic
1006249191 6:32766165-32766187 CTGTCCCCACAGAGGCCGGGTGG - Intergenic
1006339287 6:33437799-33437821 CGGTGTCCCCAGAGGCAGAGCGG - Exonic
1006681178 6:35797875-35797897 CTGACTATAGTGAGGCAGAGAGG - Intergenic
1011077934 6:83458001-83458023 TTGACTCCACTGAGGCAGAGGGG - Intergenic
1016052071 6:139540070-139540092 CTGTTTACAGAAAGGAAGAGCGG - Intergenic
1016953616 6:149605546-149605568 CTGTCATCACAGAGGATGAGAGG - Intronic
1017255582 6:152329675-152329697 CTGTTTACAAATAAGCAGAGTGG + Intronic
1018907418 6:168083643-168083665 CTGTCTCCCAAGGGGCAGAGGGG - Intergenic
1018940962 6:168308648-168308670 CCATCTCCACAGAGGCAGGGTGG - Exonic
1018961059 6:168448664-168448686 CTGTCTCCACTGAGGCAATGAGG + Intronic
1019587711 7:1814116-1814138 CTGTGAACACAGAGGGACAGGGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022274839 7:28845186-28845208 CTGTCTACCTAGAGAGAGAGAGG - Intergenic
1022296062 7:29054729-29054751 ATGTCTAAGCAGAGTCAGAGAGG - Intronic
1023258472 7:38335440-38335462 CTGCCTACAGAGAGGCTGATGGG - Intergenic
1024081498 7:45859803-45859825 TTGGCTACAAGGAGGCAGAGGGG + Intergenic
1024324954 7:48102211-48102233 CTGTCTACACAGTGTGAGGGTGG + Intronic
1028765055 7:94545998-94546020 CTTCTTATACAGAGGCAGAGTGG + Intronic
1029312583 7:99680667-99680689 CTATCACCACAGAGTCAGAGGGG - Intergenic
1032506399 7:132437880-132437902 CTGTCTCCACTGAGAAAGAGAGG + Intronic
1033234570 7:139628037-139628059 ATGTGGACACAGAGGCACAGAGG + Intronic
1033380801 7:140816263-140816285 CTGTCTACACAGAAACTGAATGG + Intronic
1034590477 7:152133972-152133994 GTGTGTACACTGAGGCTGAGTGG - Intergenic
1035528630 8:334226-334248 CTTTCAACACAGACGCACAGTGG - Intergenic
1039015828 8:33147551-33147573 CTGTCTAGACAGTGTCAGAGAGG - Intergenic
1040660975 8:49575062-49575084 CAGTCCACACATAGGGAGAGGGG - Intergenic
1042059978 8:64806037-64806059 CTGTGTTCTCAGAAGCAGAGAGG - Intergenic
1044466457 8:92512511-92512533 CTGTCTACAGAGAAGCTGGGGGG - Intergenic
1045390006 8:101705750-101705772 GAGACTACACAGAGGCACAGAGG + Intronic
1047406065 8:124586715-124586737 CTGTCTGCACAGGGGCCAAGAGG - Intronic
1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG + Intronic
1049153560 8:141052760-141052782 GCGTCTGCACAGAGGCAGAATGG - Intergenic
1049267384 8:141675903-141675925 ATGTCTACACAGACAGAGAGTGG + Intergenic
1049345988 8:142138901-142138923 CCGTCCACACAGAGGGAGACGGG + Intergenic
1049938922 9:526047-526069 CATTCTCCTCAGAGGCAGAGAGG - Intronic
1050341973 9:4649214-4649236 CTGTCTACCCAGAGGAAAAGAGG - Intronic
1051327178 9:15985158-15985180 CTGTGTACAAAGAGGCACACAGG + Intronic
1053057188 9:35000265-35000287 GTGTCTACACAGAGGCCAAAGGG - Intergenic
1055155007 9:73052000-73052022 CTGAATCCACAGAGGCAGTGTGG + Intronic
1055777822 9:79784939-79784961 CTGTCTCCTTTGAGGCAGAGAGG + Intergenic
1055930814 9:81558148-81558170 CTTTCTTCAAAGGGGCAGAGAGG + Intergenic
1056126989 9:83544045-83544067 CTGTCTGTACAGAGGTGGAGGGG - Intergenic
1056252397 9:84763101-84763123 ATGTCTACGCAGAGACAGTGGGG - Intronic
1056798108 9:89673179-89673201 CTGACTGCCCAGAAGCAGAGGGG + Intergenic
1057895417 9:98904944-98904966 TCATCTACAGAGAGGCAGAGAGG + Intergenic
1058887907 9:109336690-109336712 CTGAGAAGACAGAGGCAGAGAGG - Intergenic
1059792947 9:117660410-117660432 CTGCCTCCACAGAGGCAGCATGG - Intergenic
1060112002 9:120913258-120913280 CTGTCTCCAGAGCGGCAGACAGG - Intronic
1060295552 9:122340735-122340757 CGCTGGACACAGAGGCAGAGGGG + Intergenic
1061806889 9:133141758-133141780 CGGTAAACACACAGGCAGAGGGG + Intronic
1061956186 9:133962403-133962425 CTTTCTATCCAGAGGCAGAGGGG + Intronic
1203731970 Un_GL000216v2:99140-99162 CTGACAACCCGGAGGCAGAGTGG - Intergenic
1186925147 X:14325580-14325602 CTGTCTACCCAGAATTAGAGAGG + Intergenic
1187397780 X:18933251-18933273 CGGTGTGCAGAGAGGCAGAGGGG - Intronic
1188802592 X:34550141-34550163 CAGTTTGCACAGAGACAGAGAGG - Intergenic
1188968849 X:36588061-36588083 GCATCTTCACAGAGGCAGAGTGG - Intergenic
1188971424 X:36620878-36620900 CTGTCTAGATAGAGGTACAGGGG - Intergenic
1189234248 X:39475576-39475598 CTGACCACACAAAGGCTGAGAGG + Intergenic
1189748382 X:44193704-44193726 GTGTGTAGACAGAGGGAGAGTGG + Intronic
1189796221 X:44648209-44648231 CTGTCTACAGAAAGGGCGAGTGG - Intergenic
1195063879 X:101221485-101221507 CTGCCAACCCAGAGACAGAGGGG - Intronic
1195361167 X:104085018-104085040 CTGCCAAAGCAGAGGCAGAGAGG + Intergenic
1196168003 X:112556027-112556049 CTGTCTGCACCTTGGCAGAGGGG - Intergenic
1197710934 X:129666645-129666667 CAGTCTACACAGCCCCAGAGAGG + Intergenic
1198341656 X:135720063-135720085 CTGCCTGCGCAGAGGCAGAGGGG - Intronic
1198346342 X:135763298-135763320 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198348248 X:135780583-135780605 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198350150 X:135797846-135797868 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198352060 X:135815119-135815141 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198353968 X:135832387-135832409 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198355876 X:135849637-135849659 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198357787 X:135866916-135866938 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1198359705 X:135884198-135884220 CTGCCTGCGCAGAGGCAGAGGGG + Intronic
1198366559 X:135945976-135945998 CTGCCTGCGCAGAGGCAGAGGGG + Intergenic
1199714351 X:150495669-150495691 CTGGGGACACAGAGTCAGAGAGG + Intronic
1201943487 Y:19484207-19484229 TTGTCTGCACAGCGGAAGAGAGG + Intergenic
1202200928 Y:22346801-22346823 ATGTGTACCCAGAGGCATAGGGG - Intronic