ID: 1133206146

View in Genome Browser
Species Human (GRCh38)
Location 16:4234994-4235016
Sequence CTGGTGACTCGCAGCACAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133206146_1133206156 30 Left 1133206146 16:4234994-4235016 CCATCTGTGCTGCGAGTCACCAG 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1133206156 16:4235047-4235069 ATGACCAGTGTCTTGGTAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 91
1133206146_1133206150 23 Left 1133206146 16:4234994-4235016 CCATCTGTGCTGCGAGTCACCAG 0: 1
1: 0
2: 1
3: 10
4: 118
Right 1133206150 16:4235040-4235062 TCCCCCCATGACCAGTGTCTTGG 0: 1
1: 0
2: 1
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133206146 Original CRISPR CTGGTGACTCGCAGCACAGA TGG (reversed) Intronic
900170082 1:1262960-1262982 CTGGGGGCGCCCAGCACAGAAGG + Intronic
900370542 1:2330134-2330156 CCTGTGACTCGCAGCCCAGGTGG - Intronic
900382693 1:2392560-2392582 CAGGTGTCTCACAGCACAGAGGG + Intronic
900994344 1:6112393-6112415 CAGGGGACTCGCTGCCCAGAAGG + Intronic
903356738 1:22753100-22753122 CTGTTGACTGGAAGAACAGATGG - Intronic
905793810 1:40804094-40804116 CTGCTGACTCAGAGGACAGAAGG + Intronic
913214965 1:116612645-116612667 CTGGTGAGTTGCAGTACAGGTGG - Intronic
914213731 1:145605932-145605954 CTGGGGACTCAGAGCCCAGATGG + Intergenic
914465674 1:147926337-147926359 CTGGGGACTCAGAGCCCAGATGG + Intergenic
915741316 1:158120429-158120451 CTGGTCACTGGAAGCACAGCTGG - Intergenic
921724579 1:218509230-218509252 CTGGTGACTGGCACCAGAGTGGG + Intergenic
923569060 1:235098383-235098405 CTGGTGACACTCAACAGAGATGG + Intergenic
1063201222 10:3786074-3786096 CTGGTGGCCCGGAGGACAGAGGG - Intergenic
1063374747 10:5547415-5547437 CTGGTTTCTCTCAGCACAGCTGG + Intergenic
1064037017 10:11922223-11922245 CTGTTGTCTCGCAGCACTGGAGG - Intronic
1065602253 10:27381021-27381043 CTGATGATTGGCAGCACAAAGGG - Intergenic
1065838906 10:29683833-29683855 ATGGTGAAGTGCAGCACAGAGGG - Intronic
1069993538 10:72329154-72329176 CAGGTGCCTGGCAGCACAGGAGG - Intergenic
1072611377 10:97019511-97019533 CTGCTGACTAGGAGGACAGAAGG + Intronic
1072766279 10:98097415-98097437 CTGGTGGGACGCAGGACAGAAGG - Intergenic
1073467795 10:103704418-103704440 CTGGTGGCTGGCAGCACTGGGGG + Intronic
1076571189 10:131434177-131434199 CTGGTATGTGGCAGCACAGAGGG + Intergenic
1076667977 10:132103546-132103568 GAGGTGCCTGGCAGCACAGAAGG + Intergenic
1077142742 11:1031558-1031580 CTGGAGACCCGCAGCACGGGGGG - Intronic
1077569769 11:3329731-3329753 CTGGTGTGTTGCAGCCCAGATGG - Intergenic
1078689331 11:13563197-13563219 CTGGTGGCTCTCAGCTCTGAAGG - Intergenic
1082254580 11:50019453-50019475 CTAAAGACTCACAGCACAGAAGG + Intergenic
1083278610 11:61611560-61611582 CTGCTGCCACTCAGCACAGACGG - Intergenic
1089332391 11:117699138-117699160 CTGGTGACACCCAGCAATGAAGG + Intronic
1090409393 11:126497384-126497406 CTGGTGACTGGGAACAGAGATGG - Intronic
1091217901 11:133914722-133914744 CTGGTGTCTGGCAGAACAGGAGG + Intronic
1094721109 12:33064261-33064283 CTGGTAACTGCCAACACAGATGG + Intergenic
1096631284 12:52928294-52928316 CTTGTGACTAGCAGAAGAGAAGG - Intronic
1100874784 12:98950533-98950555 CTTAGGACTCGCAGGACAGATGG - Intronic
1103582183 12:121923571-121923593 ATGGTGAGTAGCAGCACATATGG + Intronic
1104733763 12:131123419-131123441 CAGGTGACTCTCAGCACAGCTGG + Intronic
1105218698 13:18306121-18306143 CTGGTGAGTTGCAGTACAGGTGG - Intergenic
1106722845 13:32453808-32453830 CTGGTGACTCTGAGCTCAAAGGG + Intronic
1113814171 13:113159971-113159993 CAGGTGACTGGGAGCACCGAGGG - Intronic
1113959494 13:114118778-114118800 CTGCTGACTTTCAGCAGAGAAGG - Intronic
1115466449 14:33719681-33719703 CTGGTGACTCGTTGAAGAGAAGG - Intronic
1121599791 14:95194911-95194933 CTGGTGAGTCCCAGCACATCAGG - Intronic
1122205442 14:100145861-100145883 CTGGTGAGCCACAGCTCAGATGG - Exonic
1122262175 14:100529868-100529890 CTGGTGACGGGCAGCGCCGATGG + Exonic
1122546782 14:102527532-102527554 CTGATGACTCGCTGAACAGAAGG + Intergenic
1122842652 14:104473880-104473902 CTGGGAACACGCAGCACAGGTGG - Intergenic
1126857074 15:52848859-52848881 CTGGGGTCTCACAGCACAGTAGG - Intergenic
1130287863 15:82570703-82570725 CTGGTCACTCTCAACACAAAGGG + Intronic
1132654942 16:1037823-1037845 CTCCTGACTCCCAGCACTGATGG + Intergenic
1133206146 16:4234994-4235016 CTGGTGACTCGCAGCACAGATGG - Intronic
1135300416 16:21321915-21321937 ATGGTGATACTCAGCACAGATGG - Intergenic
1137707447 16:50545362-50545384 CTGGTGCCTCCCAGCCCAGCAGG - Intergenic
1142752863 17:1998721-1998743 CACGGGCCTCGCAGCACAGACGG + Intronic
1143112145 17:4558808-4558830 CTGGTGGCTCGGGGCACAGAAGG - Exonic
1143984250 17:10897681-10897703 CTGGTGCCTGCCAGCACTGAGGG + Intergenic
1144413752 17:15025817-15025839 CGGGTGACTCAAAGCAAAGAGGG - Intergenic
1145976576 17:28987363-28987385 CTGGGGCCTCACAGTACAGAGGG - Intronic
1146811541 17:35907701-35907723 CTGGTGAATCCTAGCACCGATGG + Intergenic
1148860314 17:50601164-50601186 CTGGTGACTCACAGCGCTGTGGG - Exonic
1150190682 17:63234492-63234514 CAGGAGACCCTCAGCACAGAAGG - Intronic
1151324177 17:73368680-73368702 CAGGTGACTCACAGCAATGAAGG - Intronic
1152408853 17:80112013-80112035 CTGGTGGCTGGAGGCACAGATGG - Intergenic
1153541476 18:6160270-6160292 CTGCTGACTTGCAACACAAAAGG - Intronic
1156897129 18:42258681-42258703 CAGGAAACTCTCAGCACAGAAGG + Intergenic
1158023345 18:52869316-52869338 CTGATAACTCTCAGCAGAGAGGG + Intronic
1159682366 18:71370758-71370780 CTGGTGTCTCTCAGCATGGAAGG - Intergenic
1160390683 18:78529169-78529191 CTGGAGGCTCCCAGAACAGAGGG + Intergenic
1161014681 19:1977897-1977919 CAGGTGAGCCCCAGCACAGATGG - Intronic
1164755846 19:30688901-30688923 CTGGGGACTGGCTGCAGAGAGGG + Intronic
1165072852 19:33265513-33265535 CTGGAGGCCAGCAGCACAGAGGG + Intergenic
1165211069 19:34236259-34236281 CTGGGGACCCCCAGTACAGATGG - Intergenic
1166673609 19:44725907-44725929 CTGGTGTCTTGCTGCACAGCTGG + Intergenic
1167274039 19:48524453-48524475 CTGTTGGCTAGCAGCTCAGAGGG - Intergenic
1168242666 19:55095279-55095301 CTGGGGACTCACAGGACAGAGGG + Exonic
925256234 2:2491010-2491032 CTGGTCCCTCCCAGCACACATGG + Intergenic
925809018 2:7680223-7680245 CTGGTGTGTAGCAGCACAGTTGG + Intergenic
926908612 2:17828974-17828996 CTGGTGCCTCCCACCACACATGG + Intergenic
932496233 2:72147245-72147267 CTGGGGGCTTGCAGCACCGAGGG + Intronic
933158952 2:79003079-79003101 ATGGTGACCAGCAGCCCAGAGGG + Intergenic
933850220 2:86360802-86360824 CTGGTTAGTCGCTGCACAGGAGG + Intergenic
934295617 2:91740509-91740531 CTGGTGAGTTGCAGTACAGGTGG + Intergenic
938949983 2:136246429-136246451 TGCGTGACTCTCAGCACAGAGGG - Intergenic
948808135 2:240461719-240461741 CTGGAGACTCGCAGGGCAGGCGG + Intronic
1168749377 20:271268-271290 CTGGTGGGAGGCAGCACAGAAGG + Intronic
1173827287 20:46056104-46056126 GTGGTGACTCCCAGCAGAGCTGG + Intronic
1176385824 21:6138172-6138194 CTGTTGACCGGGAGCACAGAGGG + Intergenic
1179173494 21:38991005-38991027 CAGGTGCATCCCAGCACAGAAGG - Intergenic
1179737649 21:43400080-43400102 CTGTTGACCGGGAGCACAGAGGG - Intergenic
1181672087 22:24430450-24430472 ATGGGGACCCACAGCACAGAAGG + Intronic
1184292806 22:43507128-43507150 CTGGGGGCTCACAGCACAAAAGG + Exonic
950466968 3:13161452-13161474 CTGGTGACTCTCTGTCCAGAGGG + Intergenic
955905347 3:63801856-63801878 CTGGGGGCTCCCAGGACAGAGGG - Intergenic
958855931 3:99385617-99385639 ATGGAGACTCACAGCAGAGAGGG + Intergenic
959691934 3:109207094-109207116 CTGCTGACTGGCAGCTCAGTTGG - Intergenic
959724821 3:109531438-109531460 CTATTGACTCAGAGCACAGAAGG + Intergenic
960954497 3:123022239-123022261 CAGGGGACTGGCAGGACAGATGG + Intronic
963550998 3:146722667-146722689 CTGGTGATCCGCAGCACTGTTGG - Intergenic
965346733 3:167560074-167560096 CTTTTGACTGGCAGCACAGATGG - Exonic
968430583 4:556093-556115 CTCCTGACCCGCAGCACAGCCGG + Intergenic
968741250 4:2332823-2332845 CTCGAGGCTCGCTGCACAGAGGG + Intronic
970802433 4:19989457-19989479 CTGCTGACTTGAAGCAGAGAAGG - Intergenic
984113776 4:175652114-175652136 CTGTTGATTTGCAGCACAGAAGG + Intronic
987081158 5:14426790-14426812 TGGGAGACTCTCAGCACAGACGG + Intronic
997823302 5:137085102-137085124 CTTGTTACTCTCAGCACTGAAGG - Intronic
999128811 5:149266945-149266967 CTGGTGACTGGCCCCTCAGACGG + Intergenic
1003678231 6:8226840-8226862 GTGCTGACTGGCAGCACAGTGGG + Intergenic
1006385166 6:33726746-33726768 CTGGGTACTCGGAGCACAGGCGG + Exonic
1013253660 6:108360954-108360976 CTGGGGGCTCTCAGAACAGAGGG - Intronic
1013480747 6:110550674-110550696 CTGGTGACTCCCAGCACACCTGG - Intergenic
1014494596 6:122105680-122105702 CTGGTGAGAGGCATCACAGAAGG - Intergenic
1016446540 6:144138698-144138720 TTGGTGATCCGCAGCACTGAAGG + Intergenic
1018766851 6:166940800-166940822 AGGGTGTCTCTCAGCACAGAGGG - Intronic
1019313645 7:374818-374840 CACGTGACCCCCAGCACAGAGGG - Intergenic
1019442551 7:1054789-1054811 CTGGTGTCTCCGTGCACAGAAGG - Intronic
1024248845 7:47491159-47491181 TTGGTGAATCGCAGCGTAGATGG - Intronic
1034491607 7:151395984-151396006 CTGGTGACCGGCAGCACAGATGG - Exonic
1035044843 7:155957006-155957028 CTGGTGACTCCCAGGACCGACGG + Intergenic
1037123706 8:15319680-15319702 CTGGTGGCCTGCAGCACAGGTGG + Intergenic
1039107888 8:34009135-34009157 CTGTTGATTCACACCACAGAGGG + Intergenic
1040108535 8:43554563-43554585 CTGGTGAGTCTCTGCAGAGATGG + Intergenic
1045232019 8:100314930-100314952 TTGGTGTCTCGCAGCACCTAGGG - Intronic
1047743648 8:127827532-127827554 CAGGAGCCTCCCAGCACAGAAGG + Intergenic
1050721233 9:8592699-8592721 TTGGTGTCTCGAAGCACATAAGG + Intronic
1054969225 9:71065455-71065477 CTGGTCAGTAGCAGCACAGATGG - Intronic
1057552108 9:96059037-96059059 CTGCTGCTTGGCAGCACAGAGGG + Intergenic
1061678500 9:132231324-132231346 CTGCTGCCTCGCAGAGCAGATGG - Intronic
1062464587 9:136675459-136675481 CTGGGGACTGGCAGCAGGGAGGG + Intronic
1062464616 9:136675541-136675563 CTGGGGACTGGCAGCAGGGAGGG + Intronic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1187697823 X:21939236-21939258 CTTGTGTCTGGCAGCACAGGTGG - Intergenic