ID: 1133206697

View in Genome Browser
Species Human (GRCh38)
Location 16:4238359-4238381
Sequence CAGCCTATGGACTCAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133206697_1133206709 17 Left 1133206697 16:4238359-4238381 CCCCCTCCTGAGTCCATAGGCTG 0: 1
1: 0
2: 2
3: 8
4: 201
Right 1133206709 16:4238399-4238421 ACACCCAAGCAGGCATCAAACGG 0: 1
1: 0
2: 0
3: 10
4: 155
1133206697_1133206706 7 Left 1133206697 16:4238359-4238381 CCCCCTCCTGAGTCCATAGGCTG 0: 1
1: 0
2: 2
3: 8
4: 201
Right 1133206706 16:4238389-4238411 CCAGCCCACTACACCCAAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133206697 Original CRISPR CAGCCTATGGACTCAGGAGG GGG (reversed) Intronic
900146440 1:1160852-1160874 CAGCCCATGGACTCATGAGGGGG + Intergenic
900213457 1:1468520-1468542 CTCCCCATGGACTCAGGATGAGG - Exonic
900221019 1:1509341-1509363 CTCCCCATGGACTCAGGATGAGG - Intergenic
900226022 1:1534062-1534084 CTCCCTGTGGACTCAGGATGGGG - Exonic
901169308 1:7244694-7244716 GAGCCCATGGACACAGGAAGGGG + Intronic
901810523 1:11764628-11764650 CAGCCTGGGGCCTAAGGAGGGGG + Intronic
902056935 1:13608781-13608803 CAGCCAATGGACACAGTAGTAGG - Intronic
904080475 1:27869355-27869377 CAGCTTTTGGACTCTGAAGGTGG - Intergenic
905082645 1:35337850-35337872 TATCCTTTGAACTCAGGAGGTGG + Intronic
905868878 1:41391708-41391730 GAGACCATGGACCCAGGAGGAGG + Intergenic
907801463 1:57769866-57769888 CAGCCTCAGGACACAGGAGAAGG - Intronic
909293287 1:73912086-73912108 CAGCCTGTGTAGCCAGGAGGGGG - Intergenic
912957496 1:114165729-114165751 AAGCCTGTGGCTTCAGGAGGAGG + Intergenic
915544213 1:156586673-156586695 CAGCCAGTGGACTCCTGAGGAGG + Exonic
918040530 1:180911878-180911900 CTGCCTCTTGAGTCAGGAGGGGG - Intergenic
918190621 1:182170586-182170608 CATCCTATGGACTCCGATGGTGG - Intergenic
919211504 1:194492812-194492834 GAGCACATGGACACAGGAGGGGG - Intergenic
921012207 1:211153164-211153186 GAGCCTTTGAACCCAGGAGGCGG - Intergenic
922807147 1:228396226-228396248 CAGCCTCTGACCTCAGGAAGGGG + Intronic
924948660 1:248863346-248863368 CACCCTATCAACTCAGGAGGGGG - Intergenic
1062812385 10:476669-476691 CAGCCTCTGCTCTCAGGAGAGGG - Intronic
1062962283 10:1581468-1581490 CAGGCTGGGAACTCAGGAGGTGG - Intronic
1063504714 10:6586076-6586098 CAGGCTATGGACAAAGGAGAAGG - Intergenic
1067030200 10:42874870-42874892 GAGCCTCTGGACTCGGGTGGGGG - Intergenic
1068405781 10:56586514-56586536 CAGCCGACTAACTCAGGAGGCGG - Intergenic
1069960611 10:72076957-72076979 CAGCATCTGCACTGAGGAGGAGG + Intronic
1070849516 10:79552222-79552244 CAGCCTGTAGGCTCAGAAGGGGG + Intergenic
1071298829 10:84241546-84241568 TATCCGATGGCCTCAGGAGGGGG - Intergenic
1071299760 10:84247755-84247777 GAGCCTGTGGACTGGGGAGGGGG - Intronic
1074257030 10:111812963-111812985 CAGCCTGTGGACACACTAGGTGG + Intergenic
1075591139 10:123692544-123692566 CAGGCTATGGACTCACATGGAGG + Exonic
1076129808 10:128005872-128005894 GACCCAATGGACTCTGGAGGAGG - Intronic
1076497445 10:130906159-130906181 CCCCCTCTGGACTCAGCAGGTGG - Intergenic
1077375732 11:2204391-2204413 CAGGCTAGGGACGCACGAGGGGG - Intergenic
1078428985 11:11272754-11272776 CAGCTTGTAGACTGAGGAGGTGG - Intronic
1078646976 11:13149752-13149774 AATCGTTTGGACTCAGGAGGTGG - Intergenic
1078746490 11:14120437-14120459 CAGCCTCTGGACTTAGGGTGGGG - Intronic
1079010616 11:16825234-16825256 CTACCTGTGGACTCTGGAGGTGG - Intronic
1082194982 11:49293028-49293050 CGGCCTCGGGCCTCAGGAGGAGG + Intergenic
1082959093 11:58901996-58902018 GAGCCTCTGGAGTCTGGAGGTGG + Intronic
1082974621 11:59059579-59059601 GAGCCTCTGGAATCTGGAGGGGG + Intergenic
1083765713 11:64840500-64840522 CATCCTAGGGACACAGGAGAGGG - Intronic
1083958480 11:66000435-66000457 CATCCAAGGAACTCAGGAGGAGG - Exonic
1087168900 11:95030858-95030880 CAACCTATGGCCTCAGGCTGTGG + Intergenic
1088729249 11:112666412-112666434 CAGCCCATGGACTCATGAAAAGG - Intergenic
1088771226 11:113037816-113037838 AAGCCTAAGGACTACGGAGGAGG - Intronic
1088830013 11:113528911-113528933 CAGCCTATTCACTCAGTGGGTGG + Intergenic
1089256448 11:117196749-117196771 CAGCCTCTTGAATCAGAAGGCGG - Exonic
1090160569 11:124489308-124489330 GAACATATGGACACAGGAGGGGG + Intergenic
1090471403 11:126984480-126984502 CAGCCTATGGACCCAGTAAAAGG + Intronic
1092697960 12:11194707-11194729 AATCCTAGGTACTCAGGAGGAGG - Intergenic
1093981846 12:25483683-25483705 CATCATTTGAACTCAGGAGGCGG + Intronic
1094818212 12:34206205-34206227 CAGCCCATGCATTCTGGAGGAGG - Intergenic
1095098709 12:38161070-38161092 CAGCCCATGGGTTCTGGAGGGGG + Intergenic
1096147877 12:49291849-49291871 CAGCCAAGGGAGGCAGGAGGAGG + Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096896130 12:54821937-54821959 CAGCCTAAGGATCCTGGAGGTGG - Intergenic
1097694596 12:62764216-62764238 CAGACTCTGGAGTCAGGATGTGG + Intronic
1098667611 12:73183318-73183340 GAACCTATGGACGCATGAGGGGG - Intergenic
1099955558 12:89350283-89350305 CAGTCTTTGGACTCAGGGGAAGG - Intronic
1101865503 12:108516956-108516978 CATCATCTGGACTCAGGAGAGGG - Exonic
1102676921 12:114665422-114665444 CAGCCTCTGGAATCGGGGGGCGG - Intergenic
1103157884 12:118702428-118702450 CAGCCTCTGGAATCAGGAAAAGG + Intergenic
1106666618 13:31858105-31858127 TAGCCTAGGGACTGAGTAGGGGG - Intergenic
1106702414 13:32244414-32244436 CAGCCTGTGGCCCCAAGAGGCGG - Intronic
1107533987 13:41310581-41310603 AATCCTTTGAACTCAGGAGGCGG + Intergenic
1109791445 13:67253760-67253782 CAGCCTATGAACTCTGGGAGGGG - Intergenic
1111306501 13:86419974-86419996 GAACATATGGACACAGGAGGGGG - Intergenic
1111941480 13:94613162-94613184 CAGCCAATGAACTCATGAAGAGG - Intronic
1114768258 14:25399304-25399326 CATCCTTAGGACTCAGGAGTGGG - Intergenic
1116595795 14:46842843-46842865 CAGCCTGAGGAATCAGGAAGAGG + Intronic
1122284159 14:100640937-100640959 AAGCCTCTGGAGTCAGGATGTGG + Intergenic
1122691440 14:103533722-103533744 GAGCCTTTGGACCCAGAAGGGGG - Intronic
1125384809 15:39125987-39126009 CAGTCCATGGACACAGGAAGGGG - Intergenic
1128951083 15:71882720-71882742 AAGACTATGGACTCTGGAGCAGG + Intronic
1131260700 15:90886047-90886069 CAGCCTCTAGACTGAGGAGCTGG - Intronic
1131991501 15:98097347-98097369 CAACACATGGACTCAGGAAGGGG + Intergenic
1132130053 15:99268358-99268380 CTGCCTAGGGAGTTAGGAGGGGG + Intronic
1132556773 16:576068-576090 CAGCCTGGGGCCGCAGGAGGAGG - Intronic
1132841777 16:1981518-1981540 CTGCCTCTGGCCACAGGAGGAGG + Exonic
1133206697 16:4238359-4238381 CAGCCTATGGACTCAGGAGGGGG - Intronic
1135744219 16:25002434-25002456 CAGCCGATGGAGTCAGGACCAGG - Intronic
1136164570 16:28444595-28444617 AATCCTTTGAACTCAGGAGGCGG - Intergenic
1136198396 16:28670386-28670408 AATCCTTTGAACTCAGGAGGCGG + Intergenic
1136214742 16:28784562-28784584 AATCCTTTGAACTCAGGAGGCGG + Intergenic
1136259464 16:29064407-29064429 AATCCTTTGAACTCAGGAGGCGG + Intergenic
1141825325 16:86475014-86475036 CAGCCTCTGGACTCTGCAGTAGG + Intergenic
1142000301 16:87660485-87660507 CAGCCTGTGGCCTCTGGTGGGGG - Intronic
1142114163 16:88347806-88347828 CATCCAATGGTCCCAGGAGGCGG - Intergenic
1142256983 16:89018774-89018796 CAGCCTCCGGAAGCAGGAGGTGG + Intergenic
1143684799 17:8505018-8505040 CAGCCTCAGGCCCCAGGAGGAGG - Intronic
1147952251 17:44113774-44113796 CAGCCTTTGGGCTCAGGAAATGG - Intronic
1149442948 17:56690569-56690591 CAGCCTCTGGACTCAGGAAGCGG - Intergenic
1149536962 17:57440736-57440758 CAGGGTAAGGACTGAGGAGGTGG + Intronic
1151235225 17:72715080-72715102 CAGGGTCTGCACTCAGGAGGAGG + Intronic
1151615609 17:75208356-75208378 AAGCCTTTGAACCCAGGAGGCGG + Intronic
1151887492 17:76931842-76931864 CTGCCTATGGGCGCAGGTGGAGG + Intronic
1152273657 17:79341016-79341038 CAGCCTCTGGGCTCAGCAGTTGG + Intronic
1152610609 17:81313485-81313507 CAGCCTGTGGCCTCTGCAGGAGG - Exonic
1152805608 17:82354419-82354441 CAGACTCTGGACTCAGGATGGGG + Intergenic
1153385292 18:4486874-4486896 CATCCTATGGCCTCAGCAGAAGG + Intergenic
1153829436 18:8908563-8908585 CATGGCATGGACTCAGGAGGTGG + Intergenic
1155451850 18:25971727-25971749 CAGCCACTGGAAACAGGAGGAGG - Intergenic
1159019210 18:63129408-63129430 AATCCTAGGTACTCAGGAGGCGG - Intronic
1162422321 19:10572892-10572914 CAGCCTATGGAATAAGGAAGAGG + Exonic
1162494930 19:11018299-11018321 CAGCCTAGAGACTGAGGAGAGGG - Intronic
1162966092 19:14156810-14156832 CAGCCTCTGGGATCAGGAGGAGG + Intronic
1165675511 19:37719388-37719410 CACCCTAGGGCCTGAGGAGGCGG + Exonic
1167226152 19:48242030-48242052 CAACCTATGGAGACAGAAGGTGG - Intronic
925572801 2:5330049-5330071 CTGCTTATTGACTCAGAAGGAGG - Intergenic
934810051 2:97270014-97270036 CAGCCTGAGGACACTGGAGGAGG - Intergenic
934827641 2:97437925-97437947 CAGCCTGAGGACACTGGAGGAGG + Intergenic
936386346 2:112033006-112033028 CAGCCACTGGGCTCAGGAGCTGG + Intergenic
936792924 2:116171139-116171161 CAGCATATGGAAACTGGAGGTGG - Intergenic
942526437 2:176857900-176857922 CAGCGCATGGACTCAGGAGAGGG + Intergenic
942902095 2:181133018-181133040 ATGCCTAGGGACTCATGAGGGGG - Intergenic
943114292 2:183647001-183647023 CATGCTATGGATTCTGGAGGTGG - Intergenic
946964745 2:225026004-225026026 CTGCCTGTGGACTCAGAAGAGGG + Intronic
948899046 2:240946887-240946909 CAGCCCAGGGACACATGAGGTGG + Intronic
1171274944 20:23848504-23848526 CAGCCTTTGCACTCAGGGGCAGG + Intergenic
1172807179 20:37620683-37620705 CAGGCTTTGGACTTAGTAGGAGG + Intergenic
1173138857 20:40464339-40464361 CAGTCTCTGGACTCAGAAGAAGG + Intergenic
1174017138 20:47498024-47498046 AAGCCCTTGAACTCAGGAGGCGG + Intergenic
1175990382 20:62785606-62785628 CAGACTGTGGGCTCGGGAGGCGG - Intergenic
1176183770 20:63766963-63766985 CAGCAGGTGGGCTCAGGAGGGGG - Intronic
1176762018 21:10808535-10808557 CAACATATGGACACAGGAAGGGG - Intergenic
1182448569 22:30404365-30404387 GAGCCTATGGGCCCAGGAGAAGG + Intronic
1182459897 22:30476159-30476181 CAGCCAGTGGGGTCAGGAGGAGG + Intergenic
1184129362 22:42508649-42508671 CAGCCTATGGACTGGGAAAGGGG + Intergenic
1184139561 22:42570742-42570764 CAGCCTATGGACTGGGAAAGGGG + Intronic
1184550395 22:45201336-45201358 CAGCCCTGGGATTCAGGAGGAGG - Intronic
949175184 3:1053214-1053236 AATCCTTTGAACTCAGGAGGTGG - Intergenic
949263795 3:2134079-2134101 AAGACTATGGAGTCAGGAGTTGG + Intronic
952149916 3:30578209-30578231 CATCCTGTGGACTCAGCAGGCGG + Intergenic
954884251 3:53858046-53858068 CAGCGTATGAACTCTGGAGAGGG + Intronic
961958606 3:130830211-130830233 AATCCTCTGAACTCAGGAGGCGG + Intergenic
964230077 3:154455609-154455631 CAGCCAATGGGCTTAGCAGGAGG - Intergenic
972118748 4:35673859-35673881 CAGACTATGGTGTCAGCAGGAGG - Intergenic
974918415 4:68205787-68205809 GAGCATATGGACACAGGAAGCGG + Intergenic
974976417 4:68899052-68899074 CAGCCTTTGGACTCAGAACAAGG - Intergenic
974989731 4:69071479-69071501 CAGCCTTTGGACTCAGAACAAGG + Intronic
975131953 4:70839820-70839842 CCGGCCATGGACTCCGGAGGCGG + Exonic
975206679 4:71651814-71651836 AAGCCTATTGACTGAAGAGGAGG + Intergenic
979898194 4:126187411-126187433 CAGCCTGTTGACTTAAGAGGAGG + Intergenic
981796886 4:148605657-148605679 CAGCCTAGGGGCCCAGGAAGAGG + Intergenic
982317733 4:154048305-154048327 CAGCCAAAGGATACAGGAGGAGG + Intergenic
983839323 4:172436855-172436877 CAGGTTATGGAATAAGGAGGGGG + Intronic
985562143 5:593585-593607 CACCTTATGGCCTCAGGATGTGG + Intergenic
991249986 5:64549407-64549429 CAGCCTATGGCTCCAGGTGGGGG + Intronic
992423955 5:76636325-76636347 TAGCCCATGGATTCATGAGGAGG + Intronic
994296000 5:98089330-98089352 CAGCCTCTGGAGGGAGGAGGGGG - Intergenic
995473349 5:112525349-112525371 CATGCTATGGGCTCAGGAGTGGG - Intergenic
996185181 5:120465204-120465226 CAGCCTTGGGGCTAAGGAGGGGG + Intronic
999098767 5:149005036-149005058 CTCCCTAAGGACTCAGGAGATGG - Intronic
1001598912 5:172916278-172916300 CAGCCCAGGCCCTCAGGAGGAGG + Intronic
1002443769 5:179277387-179277409 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443795 5:179277459-179277481 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443806 5:179277484-179277506 CAGCCTTTGGTCTCGGGTGGGGG - Intronic
1002443838 5:179277579-179277601 CAGCCTTTGGTCTCGGGTGGGGG - Intronic
1002443943 5:179277906-179277928 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443969 5:179277976-179277998 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443980 5:179278001-179278023 CAGCCTTTGGTCTCGGGGGGGGG - Intronic
1002443991 5:179278026-179278048 CAGCCTTTGGTCTCGGGTGGGGG - Intronic
1003573415 6:7270882-7270904 CAGCCTGTGCAGGCAGGAGGTGG + Intronic
1004157398 6:13182430-13182452 CAGCATCTAGACTCAGCAGGCGG + Intronic
1006131359 6:31871209-31871231 CAGGCTTTGGACAGAGGAGGAGG - Intronic
1007409850 6:41655173-41655195 CAGCCTATGGCCTTGGGAGTGGG + Intergenic
1013887064 6:114980803-114980825 GATCCTATGGACACAGGAGAAGG - Intergenic
1017156796 6:151329737-151329759 CAGACTAGGCACTCAGGAAGTGG - Intronic
1018474240 6:164124265-164124287 CAGACTATGGTGTCAGGTGGTGG - Intergenic
1018900246 6:168048262-168048284 CAAATGATGGACTCAGGAGGTGG + Intergenic
1020008015 7:4792458-4792480 CAGCCTCAGGACTATGGAGGGGG + Intronic
1020126265 7:5534004-5534026 CAGCCTTTGGACTCAGGCCTTGG - Intronic
1021821502 7:24502262-24502284 CAACACATGGACACAGGAGGGGG - Intergenic
1022514184 7:30964970-30964992 AAGCCTGTGCACTCAGGAGCAGG - Intronic
1023562560 7:41491134-41491156 CTTCCTTTGGATTCAGGAGGAGG - Intergenic
1029113050 7:98223233-98223255 CTGCCTCTGGAGCCAGGAGGAGG + Intronic
1030517188 7:110552666-110552688 CAGCCCCTGGTCCCAGGAGGAGG + Intergenic
1031033173 7:116757125-116757147 GATCCTCTGGACTCAGGAGTTGG - Intronic
1031813769 7:126406779-126406801 GAACATATGGACACAGGAGGGGG - Intergenic
1033244240 7:139704947-139704969 CTCCCTCTGGACTCAGGAAGAGG + Intronic
1034754712 7:153605527-153605549 CAGCCCATTGACTGAAGAGGAGG - Intergenic
1036025238 8:4900296-4900318 GAGCCTAAGGACATAGGAGGTGG - Intronic
1036823090 8:11955413-11955435 CAGCCTGGGGGCTCAGGACGGGG + Intergenic
1043001301 8:74763413-74763435 CAGCCTATGGGCTCACGATGAGG + Intronic
1043232482 8:77820615-77820637 TAACCTATGGTCTCATGAGGAGG - Intergenic
1048192055 8:132298819-132298841 AATCCTTTGAACTCAGGAGGTGG + Intronic
1049487231 8:142872749-142872771 CAGCCTATGAATTCTGGAGGCGG - Intronic
1055540519 9:77299880-77299902 GAACATATGGACACAGGAGGGGG + Intronic
1056559699 9:87719312-87719334 CAGGATTTGGTCTCAGGAGGTGG - Intergenic
1056566419 9:87776762-87776784 CAGGATTTGGTCTCAGGAGGTGG + Intergenic
1056762858 9:89427348-89427370 GTGCATATGGACTAAGGAGGCGG + Intronic
1059777343 9:117488845-117488867 CAGCCTCTGGTCACTGGAGGAGG - Intergenic
1060169987 9:121453485-121453507 CTCCCTATTGGCTCAGGAGGTGG + Intergenic
1060648398 9:125302666-125302688 CAGCCTATCTACACAGGAGAGGG - Exonic
1060978476 9:127779049-127779071 CAGCCTCTGTACCCAGGAGAGGG + Intergenic
1062073053 9:134568668-134568690 CAGCCCAAAGACTCTGGAGGGGG + Intergenic
1062439525 9:136563491-136563513 CTGGCTCTGGACTGAGGAGGTGG - Intergenic
1062634736 9:137484861-137484883 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1062634748 9:137484894-137484916 CAGCCTCAGGACTGGGGAGGCGG - Intronic
1185729600 X:2450845-2450867 AAGACAATGGAGTCAGGAGGTGG + Intronic
1185999889 X:4997453-4997475 CAGACAATGGAATCATGAGGTGG - Intergenic
1186972633 X:14864627-14864649 CAACTTATGGATTCAGGTGGAGG - Exonic
1188910306 X:35839390-35839412 GAGGCTATGGAATCAGGAGAAGG + Intergenic
1189184929 X:39046363-39046385 CAGCCTATTGACTCTGCAGAAGG - Intergenic
1189718229 X:43886374-43886396 CAGCCTGTGGACTTTTGAGGTGG - Intergenic
1192574442 X:72231638-72231660 AATCCTATGAACCCAGGAGGCGG - Intronic
1193099004 X:77586304-77586326 CAGACATTGGAGTCAGGAGGAGG + Intronic
1196766466 X:119250052-119250074 AAGCCTATTGACTCATGGGGTGG + Intergenic
1199991294 X:152989046-152989068 CAGCGGGTGGGCTCAGGAGGGGG - Exonic
1200034239 X:153317954-153317976 CAGCGGATGGGCTCGGGAGGGGG - Intergenic
1200406690 Y:2818987-2819009 GATCCCATGAACTCAGGAGGTGG + Intergenic