ID: 1133206795

View in Genome Browser
Species Human (GRCh38)
Location 16:4238919-4238941
Sequence CCACCGTGTTACCTTCTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133206790_1133206795 17 Left 1133206790 16:4238879-4238901 CCAAAGCGCTGGGATTACAGGTG 0: 744
1: 72901
2: 211050
3: 285047
4: 257423
Right 1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 72
1133206784_1133206795 30 Left 1133206784 16:4238866-4238888 CCACCTTGGGTTCCCAAAGCGCT 0: 1
1: 64
2: 4108
3: 68881
4: 158673
Right 1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 72
1133206791_1133206795 -10 Left 1133206791 16:4238906-4238928 CCACTGTGTCCGACCACCGTGTT 0: 1
1: 0
2: 4
3: 17
4: 164
Right 1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 72
1133206786_1133206795 27 Left 1133206786 16:4238869-4238891 CCTTGGGTTCCCAAAGCGCTGGG 0: 1
1: 108
2: 6161
3: 99417
4: 222237
Right 1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 72
1133206789_1133206795 18 Left 1133206789 16:4238878-4238900 CCCAAAGCGCTGGGATTACAGGT 0: 793
1: 77054
2: 309923
3: 268996
4: 241940
Right 1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG 0: 1
1: 0
2: 1
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133206795 Original CRISPR CCACCGTGTTACCTTCTTGA GGG Intronic
908531150 1:65035680-65035702 CCACCCTGTTCCCTTCTTTGGGG + Intergenic
914404162 1:147354353-147354375 CCAGCCTGTTACCTTCTTGAGGG - Intergenic
918621646 1:186612366-186612388 CCACCGTGTTCCCTTCTACAAGG - Intergenic
918964130 1:191319319-191319341 TCACTGTGTTAGCCTCTTGATGG + Intergenic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
1071048303 10:81412538-81412560 TCATAGTGTTACCTTCTTTATGG + Intergenic
1072925311 10:99611898-99611920 ACACCATGTTATCTACTTGAGGG - Intronic
1077874778 11:6294757-6294779 CCACCTTCTTACCTTGTGGAAGG - Intergenic
1084871245 11:72099846-72099868 CAAGTGTGTTCCCTTCTTGAAGG + Intronic
1091119070 11:133041884-133041906 AAACAGTGTTGCCTTCTTGAGGG - Intronic
1098444156 12:70549054-70549076 CCACATTGTAAGCTTCTTGAAGG + Intronic
1099252116 12:80269294-80269316 CCATCATGTTATCTTCTTCAGGG + Intronic
1104629088 12:130384782-130384804 CCAACATGTTATCTTCCTGAGGG + Intergenic
1108332249 13:49399715-49399737 TCACTGTGTTACCTTAGTGATGG - Intronic
1110257332 13:73446076-73446098 CCACCATGAAAGCTTCTTGAGGG - Intergenic
1110644471 13:77866486-77866508 CCATGGTGTTATATTCTTGATGG + Intergenic
1118773591 14:68958825-68958847 CCACACTGTTTCCTTCCTGAAGG + Intronic
1131387787 15:92021716-92021738 CCACAGTGGAAGCTTCTTGAGGG - Intronic
1131796307 15:96020453-96020475 CCAACCTCTTTCCTTCTTGAAGG + Intergenic
1133206795 16:4238919-4238941 CCACCGTGTTACCTTCTTGAGGG + Intronic
1139486894 16:67262883-67262905 CCACAGTGCTGCCTTCTTGCTGG - Intronic
1142367042 16:89656091-89656113 CCACCGTGTCATCATCATGAAGG - Intronic
1142839322 17:2614558-2614580 CAACTGTGTTTTCTTCTTGAAGG + Intronic
1144520846 17:15951398-15951420 CCACCCTGTTACCTGCATCAGGG + Intronic
1146788601 17:35738783-35738805 CCAACATGTTGCCTCCTTGAGGG - Intronic
1153149122 18:2070013-2070035 CCACCTTGTTACCTCCAAGAAGG - Intergenic
1160966565 19:1749353-1749375 CCAGCGTGTTACTTTCTAGATGG + Intergenic
1161919473 19:7255336-7255358 CCCCTGTGTGACCTTCATGACGG + Intronic
1164100343 19:22049318-22049340 CCACTCTGTGACCTTCATGATGG + Intergenic
1167083830 19:47295543-47295565 AGACCTTGTTACCTTCTTGGAGG + Intronic
1167215776 19:48163594-48163616 CCAGAGTGTTAGCTTCTTGAAGG - Intronic
929192509 2:39152612-39152634 CCACTGAGTTTCCTCCTTGAAGG + Intergenic
935798270 2:106666682-106666704 CCACCTTTTCACTTTCTTGATGG + Intergenic
935806041 2:106748593-106748615 CCAACGTGTTGTCTTCTTGGAGG + Intergenic
938113467 2:128587329-128587351 CAGCCTTGTTACCTTGTTGATGG + Intergenic
1168816640 20:742256-742278 CCACTGTGTTGCCTCCTTGAAGG - Intergenic
1170391626 20:15881056-15881078 CCACTTTGTGACCTCCTTGAGGG + Intronic
1171210937 20:23316489-23316511 CCTCAGTGTTACCTTCATTAGGG - Intergenic
1175259128 20:57663823-57663845 CCAGGGTGTTGCCTTCCTGATGG - Intronic
1183451606 22:37898961-37898983 TCACCGTGTTCCCTCCTTGCTGG - Intergenic
950950358 3:16992372-16992394 CCACTGTGTTCCCTTTGTGAAGG + Intronic
955511029 3:59680577-59680599 CCACAGTTCTACCTTCATGAAGG + Intergenic
959010474 3:101070170-101070192 CCATCCTGTTATCTTCTTTAGGG + Intergenic
960144817 3:114189784-114189806 CCACAGTGTCACCTTCTTCCAGG - Intronic
960727889 3:120689403-120689425 CCATTGTTTTACCTTCTTGAGGG - Exonic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
969086045 4:4657249-4657271 TCACAGTGTTACCTACTTCATGG + Intergenic
972086249 4:35220498-35220520 CCACTGTATTACCTTCTAAATGG + Intergenic
974862155 4:67535216-67535238 CCATGGTTTTACCTTCATGATGG - Intronic
977584213 4:98757940-98757962 TCACTGAGTAACCTTCTTGATGG - Intergenic
980522402 4:133950780-133950802 CCATAGTGTTCCCTTTTTGATGG + Intergenic
981700480 4:147602382-147602404 CCATCTTGTTGCCTTGTTGAGGG + Intergenic
993439102 5:87933159-87933181 CTACCGTGTTAACTTCTGCAGGG + Intergenic
994991529 5:107002904-107002926 ACCCCGTTTTACCTTTTTGAGGG + Intergenic
995836543 5:116405463-116405485 CCACGTTGTTACCTTCTGGTTGG + Intronic
998195220 5:140063221-140063243 CCAGTATGTTAACTTCTTGAGGG - Intergenic
1001528728 5:172447357-172447379 ACACAGTTTTACCATCTTGATGG + Intronic
1006343342 6:33459528-33459550 CCACTTTGTTGCCATCTTGATGG - Intergenic
1006524702 6:34593940-34593962 CCATCGCGGTACCTTCTGGATGG + Intronic
1009694954 6:67090306-67090328 CCACCGTGATACATTTTTTACGG + Intergenic
1018148373 6:160915191-160915213 CCAGCGTGGTTTCTTCTTGAGGG - Intergenic
1018557121 6:165061301-165061323 CTACAGTGTTTCCTTTTTGATGG + Intergenic
1022982639 7:35618818-35618840 CCACCAGGTTACCTTGTTCATGG - Intergenic
1028173414 7:87627595-87627617 CCACCGTTTTACCTGCAGGAGGG - Intronic
1029525138 7:101089397-101089419 CCACCTTGTTGACTTCTCGAAGG - Exonic
1031236759 7:119187429-119187451 CCAACATGTTATCTTCTGGAAGG - Intergenic
1032384517 7:131512273-131512295 CCAGAGTGTTAGCTTCTTGAGGG - Intronic
1034096946 7:148418033-148418055 CCACATTGTAACCCTCTTGAAGG - Exonic
1035424488 7:158759470-158759492 CCACTGTGTTACCTACCGGAAGG + Exonic
1041841122 8:62272662-62272684 CCATCTGGTTACTTTCTTGAGGG + Intronic
1044133683 8:88558398-88558420 CCACTGTGATACCTTGTGGAAGG - Intergenic
1051851256 9:21511683-21511705 CTACCATGTAAGCTTCTTGAGGG - Intergenic
1053167875 9:35857264-35857286 CCACCGTGTGAGCTCCTTCAGGG - Intergenic
1059712383 9:116880858-116880880 CCAGCTTGTGCCCTTCTTGAAGG - Intronic
1061645578 9:131998322-131998344 CCACTGTCTTCCCTTCTTGGAGG - Intronic
1187121125 X:16407452-16407474 CCACCCTGATACCCTCTTTAAGG - Intergenic
1191710034 X:64139925-64139947 CCATCCTGGTTCCTTCTTGAAGG + Intergenic
1196003041 X:110806904-110806926 CCACCATGTGACTTTCATGAGGG + Intergenic
1198486415 X:137091903-137091925 CAACCCTGCAACCTTCTTGATGG - Intergenic
1199392511 X:147297144-147297166 CCAACGTGTTTCCCTCTTGCAGG - Intergenic