ID: 1133208854

View in Genome Browser
Species Human (GRCh38)
Location 16:4251437-4251459
Sequence TCCCAAAGTTGTGGGATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133208854_1133208863 3 Left 1133208854 16:4251437-4251459 CCTGCAATCCCACAACTTTGGGA No data
Right 1133208863 16:4251463-4251485 CGAGGTGGGTGGATCACCTGAGG 0: 5942
1: 26642
2: 57212
3: 84075
4: 88064
1133208854_1133208861 -8 Left 1133208854 16:4251437-4251459 CCTGCAATCCCACAACTTTGGGA No data
Right 1133208861 16:4251452-4251474 CTTTGGGAGGCCGAGGTGGGTGG 0: 27130
1: 110883
2: 157143
3: 168159
4: 124493
1133208854_1133208864 8 Left 1133208854 16:4251437-4251459 CCTGCAATCCCACAACTTTGGGA No data
Right 1133208864 16:4251468-4251490 TGGGTGGATCACCTGAGGTCAGG 0: 15131
1: 42916
2: 78223
3: 96454
4: 105535
1133208854_1133208866 26 Left 1133208854 16:4251437-4251459 CCTGCAATCCCACAACTTTGGGA No data
Right 1133208866 16:4251486-4251508 TCAGGAGTTCGAGACCAGCCAGG 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133208854 Original CRISPR TCCCAAAGTTGTGGGATTGC AGG (reversed) Intergenic
No off target data available for this crispr