ID: 1133209745

View in Genome Browser
Species Human (GRCh38)
Location 16:4256904-4256926
Sequence GGTTTTCGGAATCGGTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133209735_1133209745 2 Left 1133209735 16:4256879-4256901 CCCTGAACACCTGTGTCCTTTCC No data
Right 1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG No data
1133209733_1133209745 13 Left 1133209733 16:4256868-4256890 CCAAGCAGGGCCCCTGAACACCT No data
Right 1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG No data
1133209736_1133209745 1 Left 1133209736 16:4256880-4256902 CCTGAACACCTGTGTCCTTTCCC No data
Right 1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG No data
1133209730_1133209745 27 Left 1133209730 16:4256854-4256876 CCAAAGCGTAGGGACCAAGCAGG No data
Right 1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG No data
1133209734_1133209745 3 Left 1133209734 16:4256878-4256900 CCCCTGAACACCTGTGTCCTTTC No data
Right 1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG No data
1133209738_1133209745 -7 Left 1133209738 16:4256888-4256910 CCTGTGTCCTTTCCCAGGTTTTC No data
Right 1133209745 16:4256904-4256926 GGTTTTCGGAATCGGTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133209745 Original CRISPR GGTTTTCGGAATCGGTGGCT TGG Intergenic
No off target data available for this crispr