ID: 1133210844

View in Genome Browser
Species Human (GRCh38)
Location 16:4262665-4262687
Sequence CACTAACCCCCGAGACTCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 64}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133210844_1133210847 -9 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210847 16:4262679-4262701 GGGTTAGTGGAATGTTGGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 306
1133210844_1133210853 19 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210853 16:4262707-4262729 AGAGAGGACAGGGACAGGCTCGG 0: 1
1: 0
2: 10
3: 95
4: 724
1133210844_1133210854 25 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210854 16:4262713-4262735 GACAGGGACAGGCTCGGCCAAGG 0: 1
1: 0
2: 0
3: 19
4: 228
1133210844_1133210850 9 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210850 16:4262697-4262719 CAAGGCTGCCAGAGAGGACAGGG 0: 1
1: 0
2: 1
3: 47
4: 334
1133210844_1133210851 14 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210851 16:4262702-4262724 CTGCCAGAGAGGACAGGGACAGG 0: 1
1: 0
2: 8
3: 37
4: 388
1133210844_1133210849 8 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210849 16:4262696-4262718 GCAAGGCTGCCAGAGAGGACAGG 0: 1
1: 0
2: 2
3: 26
4: 284
1133210844_1133210848 3 Left 1133210844 16:4262665-4262687 CCGCTGAGTCTCGGGGGTTAGTG 0: 1
1: 0
2: 1
3: 2
4: 64
Right 1133210848 16:4262691-4262713 TGTTGGCAAGGCTGCCAGAGAGG 0: 1
1: 0
2: 0
3: 22
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133210844 Original CRISPR CACTAACCCCCGAGACTCAG CGG (reversed) Exonic
900376071 1:2355472-2355494 CACAGACCCCCGAGGCTCTGAGG + Intronic
900607213 1:3529222-3529244 CACTGGCCCCCGAGACTCAGAGG + Intronic
905580946 1:39082159-39082181 CATCAATCCCCGAGACTCACAGG - Intronic
1067442583 10:46317961-46317983 CACTTACCCCACAGATTCAGGGG + Intronic
1067755033 10:48998948-48998970 CACTGACCGCCGAGACTCAAAGG - Intergenic
1070255295 10:74808661-74808683 CTCCAACCCCTGAGACTCACTGG - Intergenic
1071674302 10:87640223-87640245 CACTAAACCCCTTGACTCTGAGG + Intergenic
1075072016 10:119325969-119325991 CACAAACCCCAGAGTCTCCGAGG - Intronic
1075452563 10:122562295-122562317 CACTCTCCCCCTAGGCTCAGTGG + Intronic
1078519692 11:12053058-12053080 CAGAAACCCGGGAGACTCAGAGG - Intergenic
1079483542 11:20909956-20909978 AACAAACCCCCAAAACTCAGGGG + Intronic
1080304596 11:30822571-30822593 CAATTACCCCCCAAACTCAGTGG - Intergenic
1082566617 11:54687356-54687378 CAAGAAGCCCCGAGGCTCAGAGG - Intergenic
1085527116 11:77170695-77170717 CACTAACTCCCCAGTCCCAGGGG + Intronic
1104989191 12:132615594-132615616 CACTCTCCCCCGGGACACAGGGG + Intergenic
1106560461 13:30841149-30841171 GACCAACCCCCAAGTCTCAGTGG + Intergenic
1107017301 13:35717900-35717922 GACTCACCCCACAGACTCAGTGG - Intergenic
1114029655 14:18566930-18566952 CTGTAATCCCCGATACTCAGGGG - Intergenic
1133210844 16:4262665-4262687 CACTAACCCCCGAGACTCAGCGG - Exonic
1139252628 16:65510664-65510686 CAATAACCCCAGAACCTCAGTGG + Intergenic
1141602892 16:85137123-85137145 CACCATCCCCAGAAACTCAGGGG + Intergenic
1142855613 17:2727880-2727902 CACTCATCCCAGTGACTCAGGGG + Intergenic
1146352282 17:32104906-32104928 GACTATACCCCGAGACTCTGTGG + Intergenic
1146595873 17:34168166-34168188 CCCTTACCCACGACACTCAGTGG - Intronic
1151713214 17:75818338-75818360 CCCTCACCTCCTAGACTCAGTGG + Intronic
1154332492 18:13441242-13441264 CACTAACACCCGAGGCTCTAAGG - Intronic
1165158725 19:33803536-33803558 CCCCAACCGCCGAGACCCAGAGG - Intronic
1165192193 19:34074294-34074316 CCCTAACCCCCGAGCCTTCGGGG + Intergenic
1166153550 19:40893054-40893076 CACTAATCCCCCGGGCTCAGTGG - Intronic
926109489 2:10172894-10172916 CACTGTTCCCCGGGACTCAGGGG - Intronic
927032567 2:19137638-19137660 CACTAACCCCTGTGAAGCAGAGG + Intergenic
931400437 2:61926256-61926278 CACTAACTCGCCAGACGCAGTGG - Intronic
937113248 2:119383786-119383808 CAACAACCCCTAAGACTCAGTGG - Intergenic
940180253 2:150923947-150923969 CACTAACACCCAAGAGACAGAGG + Intergenic
946993910 2:225369078-225369100 CACTTACCCCCTAGTCTTAGTGG + Intergenic
1169613169 20:7407013-7407035 CAATGACCCCCAAGACTTAGTGG - Intergenic
1173307237 20:41862309-41862331 TCCTAACCCCAGAGAGTCAGAGG - Intergenic
1180185842 21:46138827-46138849 CACCAACTCCCCAGACACAGAGG + Intronic
1180453771 22:15493980-15494002 CTGTAATCCCCGATACTCAGGGG - Intergenic
1181589769 22:23876889-23876911 CCCTCACCCCCCACACTCAGGGG - Intronic
949636671 3:5990153-5990175 CATCAACCCCCAAAACTCAGTGG + Intergenic
952415230 3:33084109-33084131 AACTCACCCCAGAGACTCAAGGG + Intronic
954697226 3:52434335-52434357 GCCTTACCCCCGAGAATCAGCGG + Exonic
962414119 3:135167047-135167069 CACTAGCCCACTTGACTCAGTGG - Intronic
968909435 4:3470038-3470060 CTCTAACTCCCAGGACTCAGTGG - Intronic
969656944 4:8504063-8504085 CACCAACCTCAGAGGCTCAGAGG - Intergenic
969969157 4:11028175-11028197 CTCTAATCCCAGTGACTCAGGGG - Intergenic
980882153 4:138722404-138722426 CACTATCCCTCCAGACTCTGGGG - Intergenic
981075196 4:140584348-140584370 TATTCACCCCTGAGACTCAGAGG + Intergenic
982401158 4:154969578-154969600 TAATAACGCCCTAGACTCAGGGG - Intergenic
982819544 4:159928502-159928524 GACTAACCTCCTAGACTCAGGGG + Intergenic
992232921 5:74681274-74681296 CCCCAACCCCTGAGCCTCAGTGG - Intronic
1002366011 5:178711571-178711593 GACAAACCCCAGAGACTGAGAGG + Exonic
1007250565 6:40492242-40492264 CACTCACCCTTGGGACTCAGGGG - Intronic
1011245974 6:85321834-85321856 CACTAACCCTCCAGACACATGGG + Intergenic
1019154594 6:170030714-170030736 CACTACCACCAGAGACACAGTGG - Intergenic
1019686921 7:2387164-2387186 CACTGACTCCCGAGAACCAGTGG + Intergenic
1023821087 7:43980914-43980936 CCCTGTCCCCTGAGACTCAGAGG + Intergenic
1029749361 7:102534353-102534375 CCCTGTCCCCTGAGACTCAGAGG + Intergenic
1029767306 7:102633458-102633480 CCCTGTCCCCTGAGACTCAGAGG + Intronic
1033221635 7:139530370-139530392 CACCAACCCCTGAGCCTTAGAGG - Intronic
1036088420 8:5638280-5638302 CACTAACCCATGGGACTCTGGGG + Intergenic
1044537891 8:93378437-93378459 CACTAACCCCCAAGATTCTCAGG - Intergenic
1057191233 9:93088754-93088776 GTCTGACCCCCGAGATTCAGGGG - Intergenic
1062102330 9:134734729-134734751 CAGGAAGCCCCCAGACTCAGTGG + Intronic
1197955013 X:131937090-131937112 CACTAACCCAGGTGACCCAGAGG - Intergenic
1197981225 X:132219178-132219200 CAGAAACCTGCGAGACTCAGTGG + Intronic
1201919551 Y:19219819-19219841 CTCTAACCAAGGAGACTCAGAGG + Intergenic