ID: 1133211133

View in Genome Browser
Species Human (GRCh38)
Location 16:4264007-4264029
Sequence GCCGGGGCTGCGGCTTCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 374}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133211133_1133211138 -10 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211138 16:4264020-4264042 CAGCCCCGGCCTCTTCCTGAGGG 0: 1
1: 0
2: 4
3: 35
4: 288
1133211133_1133211157 28 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211157 16:4264058-4264080 CCTGTTCCAGGACTGGGCCAAGG 0: 1
1: 0
2: 2
3: 35
4: 340
1133211133_1133211139 -9 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211139 16:4264021-4264043 AGCCCCGGCCTCTTCCTGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 217
1133211133_1133211153 21 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211153 16:4264051-4264073 GGGGTGCCCTGTTCCAGGACTGG 0: 1
1: 0
2: 1
3: 19
4: 180
1133211133_1133211158 29 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211158 16:4264059-4264081 CTGTTCCAGGACTGGGCCAAGGG 0: 1
1: 0
2: 3
3: 19
4: 162
1133211133_1133211144 0 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211144 16:4264030-4264052 CTCTTCCTGAGGGGCCCTCCCGG 0: 1
1: 0
2: 3
3: 26
4: 219
1133211133_1133211145 1 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211145 16:4264031-4264053 TCTTCCTGAGGGGCCCTCCCGGG 0: 1
1: 0
2: 2
3: 21
4: 220
1133211133_1133211150 16 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211150 16:4264046-4264068 CTCCCGGGGTGCCCTGTTCCAGG 0: 1
1: 0
2: 0
3: 28
4: 289
1133211133_1133211159 30 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211159 16:4264060-4264082 TGTTCCAGGACTGGGCCAAGGGG 0: 1
1: 0
2: 1
3: 15
4: 223
1133211133_1133211146 2 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211146 16:4264032-4264054 CTTCCTGAGGGGCCCTCCCGGGG 0: 1
1: 0
2: 3
3: 16
4: 185
1133211133_1133211154 22 Left 1133211133 16:4264007-4264029 CCACCCGAAGCCGCAGCCCCGGC 0: 1
1: 0
2: 1
3: 25
4: 374
Right 1133211154 16:4264052-4264074 GGGTGCCCTGTTCCAGGACTGGG 0: 1
1: 0
2: 7
3: 55
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133211133 Original CRISPR GCCGGGGCTGCGGCTTCGGG TGG (reversed) Intronic
900341200 1:2190163-2190185 GCCGCGGCTGCGTCTACAGGAGG + Intronic
900376489 1:2357179-2357201 GCAGGGGCTGCAGCCTCGTGGGG - Intronic
900386294 1:2412498-2412520 GCCATGGCCGCGGGTTCGGGTGG + Exonic
900526813 1:3133416-3133438 TCCAGGGCTGTGGCTTCGGGAGG - Intronic
901080121 1:6579454-6579476 GCCTGAGCAGCGGCTTCGGTGGG + Exonic
901086268 1:6613981-6614003 CCCGGGGCTGGGGGCTCGGGCGG - Exonic
901540189 1:9910392-9910414 GCCGGGGCGGGGCCTGCGGGCGG + Intergenic
901626322 1:10627201-10627223 GCGGGGCCTGCGGCTGCAGGAGG - Intronic
901629027 1:10639249-10639271 CCGGGGGCGGCGGCGTCGGGCGG + Exonic
901836211 1:11925799-11925821 GGCGGTGCTGCTGCTGCGGGAGG - Exonic
902786816 1:18738319-18738341 GCCGGGGCTGCCGCTGCCGCTGG - Intronic
903055525 1:20633625-20633647 GCCGGGCCTACGGCTTGGGGCGG + Exonic
903263369 1:22142950-22142972 GCAGCGGCTGCGGCCGCGGGGGG + Exonic
904618648 1:31763040-31763062 GCCGGCCCTGGGGCTGCGGGAGG + Intronic
905885282 1:41488440-41488462 GCAGGGGCTGGGGGTTGGGGAGG + Intergenic
906365397 1:45205905-45205927 GCCGGAGCGGCGGCCCCGGGGGG + Exonic
907038330 1:51236339-51236361 GCCGTGGCTCCGGCGTCGGCGGG + Exonic
910427636 1:87132419-87132441 CCCGGCGCGGCGGCCTCGGGAGG + Intronic
910450105 1:87335406-87335428 GCTCTGGCTGCGGCCTCGGGCGG - Intronic
911176153 1:94820343-94820365 GCCGGGGCTGGGGCTGGGGCTGG - Exonic
912514960 1:110211468-110211490 TGCGGGGCTCCGGCTTGGGGCGG - Exonic
915495962 1:156282753-156282775 GCGGCGGCTGCGGCTACGGCCGG - Exonic
915973603 1:160370834-160370856 GCCGGGCCTGGGGGTCCGGGAGG + Exonic
916437765 1:164792619-164792641 GCAGCGGCGGCGGCTTCTGGAGG + Exonic
919748616 1:201023447-201023469 GCAGCGGCTGCGGCTGCGGGAGG + Exonic
921189850 1:212699678-212699700 GCTGCGGCTGCGGCTGCGGCTGG + Exonic
921903832 1:220475891-220475913 CCCGGGCCAGCGGCTGCGGGGGG - Intergenic
922462448 1:225823940-225823962 GCCAGGGCTGCGGCTTTATGTGG - Intronic
922960755 1:229643860-229643882 GCCCAGGCTGCGGCATAGGGAGG + Intronic
923506305 1:234609259-234609281 GCCGAGGCCGCGGCGCCGGGTGG + Exonic
924527432 1:244864403-244864425 GCGGCGGCTGCGGCTGCGGCTGG + Exonic
1063200235 10:3780535-3780557 GCCGGGGCTGTGGGTCCGGCAGG - Intronic
1067911437 10:50350652-50350674 GCCCGGGCTGTGGCTTCAGAGGG + Intronic
1067937441 10:50623892-50623914 AGCGGGGCAGCGGCTGCGGGCGG - Exonic
1068374026 10:56155261-56155283 GCCGGGCCAGCGGCTGCGGAGGG + Intergenic
1069714889 10:70514288-70514310 GGCGGGGCTGCCACTGCGGGGGG - Intronic
1070147006 10:73781921-73781943 GCCGGGGCTGCGGCGACGCTGGG - Intergenic
1071504971 10:86226749-86226771 GCTGGGACTGCTGCTTCTGGAGG - Intronic
1072983004 10:100115319-100115341 GCCGGGGCTGGGGGTTGGCGGGG - Intergenic
1073049040 10:100656187-100656209 GCCGGGGCTGTGACCTCGAGTGG + Intergenic
1074377386 10:112951300-112951322 GCCCGGGGGGCGGCTCCGGGCGG - Intronic
1076350558 10:129812071-129812093 CCACGGTCTGCGGCTTCGGGAGG + Intergenic
1076472489 10:130728707-130728729 GCGGGGGTTGTGGCCTCGGGCGG + Intergenic
1076728012 10:132422246-132422268 GCCGGGGCGGCAGCTTCCAGTGG - Intergenic
1076913129 10:133402250-133402272 GCCGGGGCTGGGGCTGGGGCTGG + Intronic
1076929443 10:133520346-133520368 GCTGGGGCTGCGGCTCCCTGAGG - Intergenic
1077008447 11:369719-369741 GCCGGGGATGCGGCGCGGGGCGG + Intergenic
1077385827 11:2269114-2269136 TCCGGGGCTGAGGCTGCGGGGGG + Exonic
1078246220 11:9574539-9574561 GCCGGGGCCGCGGCGCCGGAGGG + Intronic
1078801121 11:14644512-14644534 GCCGGAGCTGCGGCTCCTGGTGG + Exonic
1079122524 11:17695924-17695946 GCCGGGGCTGCGGTGAGGGGAGG + Intergenic
1079122589 11:17696141-17696163 GCGCGGGGTGCGGCTGCGGGCGG + Intergenic
1083740924 11:64711494-64711516 GGCGGGGCTGTGGTGTCGGGGGG - Intronic
1083903001 11:65652702-65652724 CACGGGGCTCCGGCTCCGGGGGG - Intergenic
1083997261 11:66278548-66278570 GCTGGGGCTGGGGCTGGGGGCGG + Intronic
1084180508 11:67443427-67443449 GCTGCGGCACCGGCTTCGGGCGG + Exonic
1084621106 11:70270779-70270801 CCCGGGGCCGCGGCGTGGGGCGG + Exonic
1085312755 11:75525913-75525935 GCTCGGGCTGCGGCTCCGGTGGG - Intergenic
1085384450 11:76149142-76149164 ACTGGGGCTGCGGAGTCGGGAGG - Intergenic
1090238212 11:125164835-125164857 GCGGCGGCTGCTGCTGCGGGCGG + Intronic
1090238400 11:125165534-125165556 GCCGCGGCCGCGGCCTGGGGAGG + Intronic
1091201889 11:133787558-133787580 GCCGGGGCCGCTGATGCGGGGGG - Intergenic
1091286643 11:134411988-134412010 GCCGGGGCGGCGGGGCCGGGCGG - Intergenic
1091372989 11:135076371-135076393 GCCGGCGCGGCGGCTTTGCGAGG + Intergenic
1092161010 12:6315655-6315677 GCCGGGGCTGGGGCTGAGGGGGG - Intronic
1092290783 12:7158423-7158445 GCTGGGGCTGGGGCTGGGGGTGG + Exonic
1092459108 12:8670953-8670975 GCTTGGGCTGTGGCTTCGGAGGG - Intergenic
1092743218 12:11649803-11649825 GCGGGGGCGCCGGCTGCGGGTGG + Intergenic
1093547851 12:20369227-20369249 GTCGGGGCGGGGGCGTCGGGGGG + Exonic
1093970219 12:25369505-25369527 CCCGGGCCAGCGGCTGCGGGGGG + Intergenic
1096651354 12:53063477-53063499 GCCGGGGCTGGGGCTGGGGCTGG - Intronic
1097267761 12:57755626-57755648 GCCGGGGAGGCGGCTGCGGCTGG + Exonic
1098893192 12:76030703-76030725 GCTGGGGCTGAGGCTTGGGTTGG + Exonic
1098893220 12:76030799-76030821 GCTGCGGCTGCGGCTGCGAGGGG + Exonic
1100277079 12:93081254-93081276 GCCGGGGCTGGGGTCTGGGGTGG - Intergenic
1101592955 12:106139375-106139397 GCCGGGGCGGCGGTTGCGGCTGG + Exonic
1101778366 12:107814550-107814572 GCCGGGCCTCTGGCTTCAGGTGG - Intergenic
1102068662 12:109999635-109999657 GCCGGGGCCGAGACTTGGGGCGG + Exonic
1102341065 12:112122002-112122024 AGCGGGGCTGAGGCTGCGGGAGG + Intergenic
1103377708 12:120469615-120469637 GGCGGGCCCGCGGCGTCGGGCGG - Exonic
1104127479 12:125861652-125861674 GCCGGGGTTGGGGCTGGGGGCGG - Intergenic
1104602131 12:130161592-130161614 CCCGGCTCTGCGGCTTCGGAGGG + Intergenic
1104913613 12:132252296-132252318 GGCGGGGATGCGGCTGCAGGAGG - Intronic
1105012014 12:132762101-132762123 GCCGGGGCTGGGGCCCGGGGAGG + Intergenic
1105270916 13:18875021-18875043 GGTGGGGCTGCAGCTGCGGGCGG + Intergenic
1105514069 13:21075595-21075617 GCCGGTGCGGCGACTCCGGGCGG + Intergenic
1106735835 13:32586913-32586935 GCCGGGGCGGCGGCGGCGGCGGG + Intronic
1108541644 13:51452217-51452239 GCCCGGGCTCCGGCCCCGGGCGG - Intronic
1110219651 13:73059495-73059517 GCGCGGGCTGCGCCTGCGGGCGG - Exonic
1113379063 13:109786496-109786518 GCCGGGGCTGCTGCTGCTGCTGG + Exonic
1113903996 13:113811110-113811132 GCTGGGGCTGCTCCTTCTGGTGG + Intronic
1113923539 13:113928173-113928195 GCAGGGGCCGCGGCTCCTGGGGG - Intergenic
1116014198 14:39386896-39386918 GCCGGGGCTCCTGCCCCGGGCGG - Intronic
1116186613 14:41606984-41607006 TCCGGGGCTGCGGCCGCGGCCGG - Intergenic
1116817922 14:49599939-49599961 GCCGGGGCGGGGGCTCCGGGGGG + Intronic
1116945252 14:50830575-50830597 GCCGGCGCAGCGGTTCCGGGCGG + Intronic
1117156820 14:52950635-52950657 GCCGGCGCTGCGAATTCGGTGGG - Intronic
1117722092 14:58638117-58638139 GCTAGGGCTGCGGCCGCGGGTGG - Intronic
1117867467 14:60165012-60165034 GCAGGGGCTGCGGGTTGGGGAGG - Intronic
1119431846 14:74573532-74573554 GACAGGGCTGCGGCCTCTGGTGG - Intronic
1119519993 14:75278411-75278433 GCGGGGGCCGCGGCTGGGGGAGG - Intergenic
1121074998 14:91060500-91060522 GCCGCGGCAGCGGCTGCGAGGGG - Exonic
1121413391 14:93762876-93762898 GCCAGGGCTGAGGCCTGGGGTGG - Intronic
1121595247 14:95157311-95157333 GCGGGGGCGGCGGCGCCGGGCGG - Intronic
1122688245 14:103520090-103520112 GCAGGTGCTGCGGCTTCCCGTGG - Intronic
1122811322 14:104290840-104290862 ACCGGGGCTGGGGCTTCTCGAGG + Intergenic
1122975213 14:105168217-105168239 GCGGCGGCTGGGGCTCCGGGCGG - Intronic
1123039955 14:105486440-105486462 GCGGGGGCTGGGGTTTCGGCCGG - Intergenic
1124014186 15:25862476-25862498 GGCGGCGCTGTGGCTTCGGTCGG + Intronic
1126163509 15:45634915-45634937 GCCTGGGCTGCGGCGCCGGGCGG + Exonic
1126436715 15:48645118-48645140 GCCGGGGCTGCTGCCGCCGGGGG - Intronic
1128153551 15:65377872-65377894 GCCGGGGCTGGGGCTCCGGCCGG + Exonic
1129856793 15:78830616-78830638 GCTGGAGCTGCGTCCTCGGGCGG + Intronic
1129983582 15:79896841-79896863 GCCGCGGCTTCCGCTACGGGCGG + Intronic
1130059478 15:80559329-80559351 GCCGGGGCTGGGGCTGGGGCTGG - Intronic
1130520579 15:84658159-84658181 GCCCGGGCCGCGGCTTCGTTCGG + Exonic
1130903270 15:88223094-88223116 GCCAGAGCTGCGGGCTCGGGAGG + Intronic
1130954999 15:88621402-88621424 ACCGGGGCGGCGGGGTCGGGCGG + Intronic
1131115165 15:89790895-89790917 GCCGAGGCTGGGGCCCCGGGGGG - Intronic
1131186139 15:90275586-90275608 ACTGGGCCTGCGGCTTTGGGTGG + Exonic
1132510357 16:337830-337852 GCCGGGCGTGCGGCCTCTGGGGG + Intronic
1132573407 16:653812-653834 GCCCTGGCTGCGGGTTGGGGTGG + Intronic
1132719724 16:1309752-1309774 GCCGGGGCTGCGGCCGCCCGAGG + Intronic
1132741367 16:1414827-1414849 GCCGGGGGCGGGGCTGCGGGGGG - Intergenic
1132788322 16:1670556-1670578 GCCGGGGCTAGGGCTTGGGCTGG + Intronic
1132843552 16:1990018-1990040 GCAGCGGCAGCGGCCTCGGGCGG + Exonic
1133027382 16:2994733-2994755 GGCGGGGCTGGGGTTTGGGGAGG + Intergenic
1133211133 16:4264007-4264029 GCCGGGGCTGCGGCTTCGGGTGG - Intronic
1133230588 16:4364727-4364749 GCGGGGGCTGGGGAGTCGGGGGG - Intronic
1133281012 16:4665230-4665252 GCAGGGGCTGGGGCTTGGTGGGG + Intronic
1134531845 16:14989722-14989744 GGCGGTGCTGCTGCTGCGGGAGG - Intronic
1136144318 16:28307029-28307051 GCTGGGGCTGGGGCTGCTGGAGG - Intronic
1136251679 16:29009495-29009517 GCGGGGGCTGGGGCTGGGGGTGG + Intergenic
1136497261 16:30651868-30651890 GCCGAGGCTGCAGCTCCCGGGGG + Exonic
1136711489 16:32240583-32240605 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136811690 16:33181551-33181573 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136818166 16:33291631-33291653 GCGGGAGCTGCTGCTCCGGGAGG - Intronic
1136824730 16:33348160-33348182 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136829796 16:33446931-33446953 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1136933445 16:34437647-34437669 AGCGGGGCTGCGGCTCCCGGCGG + Intergenic
1136971127 16:34974167-34974189 AGCGGGGCTGCGGCTCCCGGCGG - Intergenic
1137031213 16:35526351-35526373 GCTGGAGCTGCTGCTCCGGGAGG + Intergenic
1138178734 16:54928870-54928892 CCAGGGGCTGCGGCTGCGGCGGG + Intergenic
1140475755 16:75238568-75238590 GCCAGGCCTGCGGCTGCTGGGGG - Intronic
1141231266 16:82170043-82170065 GCCGGGGCCGAGGCGGCGGGCGG - Intronic
1141531220 16:84648425-84648447 GCGGGGCCTGCGGCTGAGGGCGG - Intergenic
1141598605 16:85112228-85112250 GCAGGGCCTGCTGCTTGGGGTGG - Intronic
1141840122 16:86568559-86568581 CCCCGGGCTGCGGCGTCGGCTGG - Exonic
1141972419 16:87492678-87492700 GCCGGGGCGGCTCCGTCGGGGGG - Intergenic
1142163323 16:88570596-88570618 GCCGGGCCGGCGGCGGCGGGAGG + Intronic
1202990268 16_KI270728v1_random:4520-4542 GCGGGAGCTGCTGCTCCGGGAGG - Intergenic
1203058565 16_KI270728v1_random:949176-949198 GCGGGAGCTGCTGCTCCGGGAGG + Intergenic
1142699558 17:1650755-1650777 GCTGAGGCTTCGGCCTCGGGAGG + Exonic
1143044354 17:4064631-4064653 GCAGGGGGTGCGGCTTCAGTGGG + Exonic
1143107850 17:4538343-4538365 GCCAGGGCTCCGGCTGCTGGAGG + Exonic
1143498134 17:7324069-7324091 GCTGGGGCTGGGGGTTAGGGTGG - Intronic
1143550580 17:7627935-7627957 GTCGGGGGTGGGGCTTGGGGGGG - Intronic
1143747304 17:9003687-9003709 GCCGGGGCCGGGGCACCGGGAGG - Intergenic
1146174040 17:30653468-30653490 GCCAGGGCTGCAGCTCCAGGAGG + Intergenic
1146332316 17:31937340-31937362 GCGGCGGCGACGGCTTCGGGCGG + Exonic
1146347495 17:32069495-32069517 GCCAGGGCTGCAGCTCCAGGAGG + Intergenic
1147139585 17:38453782-38453804 CCCGGGCCCGCGGCTCCGGGGGG + Intronic
1147317425 17:39627533-39627555 GCCGGGGCAGCGCCTTGGGAGGG - Intronic
1147767170 17:42844924-42844946 GCCAGGGCTGCAGCCTTGGGGGG - Exonic
1147768367 17:42851653-42851675 GCCAGGGCTGCAGCCTTGGGAGG - Exonic
1147770957 17:42867585-42867607 GCCAGGGCTGCAGCCTTGGGAGG - Intergenic
1148165087 17:45477937-45477959 GCTGGGGCAGAGGCTTCTGGTGG + Exonic
1149774759 17:59348478-59348500 GCCGGGGAGGCGGCATGGGGTGG + Intronic
1150265167 17:63827590-63827612 GCCGGGGCAGGAGCGTCGGGTGG + Exonic
1150396319 17:64824662-64824684 GCTGGGGCAGAGGCTTCTGGTGG + Intergenic
1151558696 17:74859896-74859918 GCGGCGGCGGCGGCTCCGGGCGG + Intronic
1151660502 17:75515880-75515902 GCCCGGCCGGCGGCTGCGGGTGG - Intergenic
1151675502 17:75595375-75595397 GCCAGGGCTGGGGCTTGTGGTGG - Intergenic
1151854415 17:76710804-76710826 GCCGGGGGCGCGGGTTCCGGGGG + Exonic
1152394517 17:80024132-80024154 GCCGGGGCTGCGGGTAGGGCCGG - Intronic
1152656959 17:81524223-81524245 GCCGAGGCTCAGGCCTCGGGAGG + Intergenic
1152675289 17:81637001-81637023 GCCGGGGCTGAGGCCGCGGCCGG - Exonic
1152689524 17:81711861-81711883 GCCGGGGCTGAGCCCTCGGTGGG + Intergenic
1155218334 18:23662640-23662662 GCCGGGCCCGCGGGGTCGGGTGG - Intronic
1156350443 18:36297673-36297695 GCCCGGGCTCCGGCCGCGGGGGG - Intergenic
1157384258 18:47248153-47248175 TCTGTGGCTGCTGCTTCGGGCGG - Intronic
1159098689 18:63936148-63936170 GCCGGGGCTAAGGCTACTGGGGG - Intergenic
1159798463 18:72869093-72869115 GCCGCGGCTGGGGCTTGGGTTGG + Intergenic
1160515812 18:79478634-79478656 GCCGTGGCGGGGGCTTTGGGAGG + Intronic
1160722823 19:604808-604830 GCGGGGGCTGTGGATTTGGGGGG + Intronic
1160775427 19:853102-853124 GCCGGGGCCGGGGCTGCTGGCGG + Intronic
1160847796 19:1174053-1174075 CCCGGGGCTGGGGGTTCTGGGGG - Intronic
1160860872 19:1236836-1236858 GCGGGGGCGGCGGCCTGGGGGGG + Intronic
1160860882 19:1236854-1236876 GGGGGGGCGGCGGCCTCGGGGGG + Intronic
1160930463 19:1567638-1567660 GCCGGGGCGGCGGCGGCGGCGGG + Exonic
1160961881 19:1725778-1725800 GCCGGGGGGGCGGGGTCGGGCGG - Intergenic
1161008437 19:1948074-1948096 GCAGGAGGTGTGGCTTCGGGGGG + Intronic
1161313858 19:3608885-3608907 CCCGTGGCTGCGGTTTCCGGCGG + Intergenic
1161317363 19:3623885-3623907 GGAGCGGCTGCGGCTGCGGGAGG - Exonic
1161703015 19:5805220-5805242 GCGGGGGCTGGGGCTGGGGGTGG - Intergenic
1162036552 19:7943296-7943318 GCCGGGGCGGCGGCGTCCCGTGG - Intronic
1162988371 19:14286562-14286584 GCCAGGGCTGCAGCTCCAGGAGG - Intergenic
1163018832 19:14472232-14472254 GCCGGGGCTGGGGCTCCGCTGGG - Intergenic
1163441198 19:17323553-17323575 GCTGGGGCTGGGGCTAGGGGAGG + Exonic
1163674907 19:18650823-18650845 GGCGGGGCTGCGGCTGGGGATGG + Intronic
1163699880 19:18781737-18781759 GCAGGGGCTGGGCCTTGGGGTGG + Exonic
1165384337 19:35501746-35501768 GCCTAGGCTGCGGCATGGGGAGG - Intronic
1165827442 19:38713409-38713431 GCCAGGGCTGCAGCTTGTGGGGG - Intronic
1166072790 19:40396716-40396738 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166072802 19:40396794-40396816 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166072815 19:40396872-40396894 GCCGGAGGTGCGGCTTCCAGAGG - Exonic
1166090634 19:40506399-40506421 GCTGGGGCTGGGGCTATGGGTGG + Intronic
1166995806 19:46719216-46719238 GGCGGGGCTGAGGCTTCAGCTGG + Intergenic
1167056081 19:47112384-47112406 GCCGGGGCTGCGTCCCCGGGGGG - Intronic
1167278390 19:48552415-48552437 GCCAGGCCTGCGGCTGCGGGTGG - Intronic
1167286011 19:48599348-48599370 GCCGGGGCTGGGGCTGGGGCTGG - Exonic
1167622755 19:50568340-50568362 GCCGGGGCCGGGGCCTGGGGGGG - Intergenic
1168239550 19:55082259-55082281 GCCGGGCCTGGGGCGTGGGGAGG - Exonic
1168240417 19:55086407-55086429 GCCGGGGCTGGGGCTGGTGGTGG - Exonic
1168365253 19:55781141-55781163 GCCGGGGCTGGGGCTGGGGCTGG + Intergenic
1168718964 19:58544540-58544562 GCGCGGGCGGCGCCTTCGGGAGG + Exonic
1202681422 1_KI270712v1_random:7111-7133 GCCGGGGCGGCGGCGGCGGAGGG + Intergenic
926238245 2:11066192-11066214 GCGGTGGCTGCTGCTTCAGGTGG - Intergenic
927641074 2:24845920-24845942 GCCTGGGCTGTGGCTTCAGAGGG + Intronic
927920779 2:26970719-26970741 GCAGAGGCTGCGGCTCCGGCCGG - Exonic
929966915 2:46542995-46543017 GCCGGGGCGGGGGCTCCGGGGGG + Exonic
931355795 2:61537346-61537368 GGCGGGGAGGCGGCCTCGGGAGG - Intronic
931665901 2:64609429-64609451 GGCGGACCTGCGGCTCCGGGCGG - Intergenic
931762744 2:65431887-65431909 GCCGGGGCTGAGGATGCGGGCGG - Intronic
932821644 2:74906527-74906549 GCTTGGGCTGCGGCTTCAGAAGG - Intergenic
934105555 2:88691762-88691784 GCCGGGGGCGCGGCCTCCGGCGG + Exonic
934555785 2:95286490-95286512 GCTGGGGCAGCGGCTGCAGGAGG + Exonic
937286725 2:120758650-120758672 GCTCGGCCTGCAGCTTCGGGCGG + Intronic
937716283 2:125037347-125037369 GCGGGAGCTGGGGCTTCGAGCGG + Intergenic
937730342 2:125222673-125222695 GCTTGGGCTGCGGCTTCAGAAGG - Intergenic
938301048 2:130213520-130213542 ACCGGGGCGGGGGCTCCGGGGGG - Intergenic
938455672 2:131460947-131460969 GCCGGGGCGGGGGCTCCGGGGGG + Intergenic
938496626 2:131801400-131801422 GCCGAGGCTGCAGCGCCGGGTGG + Exonic
939956493 2:148531860-148531882 CCTGGGGCTGGGGCTTGGGGTGG - Intergenic
941104923 2:161341184-161341206 GCCGGGGGCGCGGGTTCCGGGGG + Intronic
942890492 2:180981010-180981032 GCCGGGGCGGCGGCGGCGGTGGG + Intronic
943637219 2:190319554-190319576 ACGGGGGCTGGGGCTTGGGGAGG + Intronic
944412449 2:199457747-199457769 GCCGGGGCTGCTGGTTCGCAGGG + Exonic
944413546 2:199463369-199463391 GCCGGGGTTGGGGCCCCGGGTGG + Intronic
944579150 2:201116905-201116927 TCTGGGGCTGCGGCTGCAGGGGG - Intronic
944582118 2:201140136-201140158 GCGGGGGCTGCGGCAGCGGCGGG + Intronic
944728602 2:202497049-202497071 CCCGGGCCAGCGGCTGCGGGGGG + Intronic
946366777 2:219253643-219253665 GCTGGGGTTGGGGCTTGGGGTGG - Intronic
947345610 2:229186525-229186547 GCTTGGGCTGTGGCTTCGGAGGG - Intronic
947549835 2:231038036-231038058 GCCGGGGCTGCGGCTGCTGGAGG + Exonic
947860568 2:233354709-233354731 GCCGGGGCTGCCGCGGCGTGAGG - Intronic
948505911 2:238426945-238426967 GTCGGGGTCGCGGCTTCCGGCGG - Exonic
948696989 2:239737547-239737569 GCCGGGGCTGTGGCTGGGGCTGG - Intergenic
948697031 2:239737641-239737663 GCCGGGGCTGTGGCTGGGGCTGG - Intergenic
948697223 2:239738037-239738059 GCCGGGGCTGGGGCTGGGGCCGG - Intergenic
948697269 2:239738133-239738155 GCCGGGGCTGGGGCTGGGGCCGG - Intergenic
948697279 2:239738151-239738173 GCCGGGGCTGGGGCTGGGGCCGG - Intergenic
948770248 2:240248110-240248132 GCCGGGGCTGGGGGTTGGGCTGG + Intergenic
948805695 2:240452748-240452770 GGCGGGGCGGGGGCTGCGGGAGG + Intronic
1170601082 20:17842128-17842150 GCCGGGGCTGCAGCTGGTGGCGG + Intergenic
1170889801 20:20367863-20367885 GGCGGGGCGGCGGCGCCGGGCGG + Intergenic
1171427526 20:25058067-25058089 CCCTGGGCCGCGGCGTCGGGAGG - Exonic
1172095245 20:32457237-32457259 GCCGGGGCTGGGGCTGGGGCTGG - Intronic
1172389715 20:34558728-34558750 ACGGCGGCTGCGGCTGCGGGAGG - Intronic
1174357785 20:50009966-50009988 GCCGGGGCCGCGGCCTGGAGGGG - Intergenic
1174405289 20:50298933-50298955 GCCTGGGCTCCGGCAGCGGGTGG + Intergenic
1175367718 20:58467216-58467238 CCCGGGGCTGCGGCTGCAGGCGG + Exonic
1175399627 20:58693017-58693039 CCCGGGGCTGCAGCTTCCCGCGG - Exonic
1175517205 20:59577340-59577362 GGCGAGGCTGCGGCTCCGGGCGG + Intergenic
1175518995 20:59587751-59587773 GCCGGGGCTGGGGCTGGGGCTGG + Intronic
1175920048 20:62446454-62446476 CCTGGGGCTGCTGCTTTGGGTGG - Intergenic
1176005652 20:62861162-62861184 GGCGCGGCTGCGGCTGCGGCTGG - Exonic
1176223555 20:63981310-63981332 GCCGGGGGTGAGGCCTGGGGCGG + Exonic
1178015880 21:28345754-28345776 GCCGGGGGTGGGGGTGCGGGGGG - Intergenic
1179805779 21:43836022-43836044 GCCGGGACTGCTGCGTCTGGAGG - Intergenic
1180867104 22:19126019-19126041 GCTGGGGCTGGGGCTTGGGCTGG + Intergenic
1180934423 22:19615384-19615406 GACGGGGCTGCAGCTTCGACGGG - Intergenic
1181280592 22:21717129-21717151 GCCGGGGCTGGGGGGGCGGGGGG + Intronic
1181440269 22:22932074-22932096 GCCAGGGCTGAGGCTTGGTGGGG - Intergenic
1182485145 22:30634988-30635010 GCCGGGGCTGGGGCACAGGGTGG + Intergenic
1183641817 22:39097421-39097443 GCTGGGGCTGGGGCAGCGGGAGG - Intronic
1183701728 22:39454799-39454821 GCAGGGGCTGGGGCTTGGGCAGG + Intergenic
1184243882 22:43226342-43226364 GCCAAGGCTGCGGCTCTGGGTGG + Intronic
1184412181 22:44331727-44331749 GCCGGGGCTGGGGCTGGGGCCGG + Intergenic
1184426337 22:44411216-44411238 GGCTGGGCTGAGGCTTCGCGAGG + Intergenic
1184945335 22:47798534-47798556 GCCAGGGCTGAGGTTTCCGGTGG + Intergenic
1185184611 22:49391548-49391570 GCCGGAGCTGGGGCTGCGTGAGG - Intergenic
1185289478 22:50016357-50016379 GCCTGGGCTGGGGCTCCTGGTGG + Intronic
950012129 3:9731411-9731433 GCTGGCGCCGCGGCTGCGGGAGG - Intergenic
950428191 3:12935935-12935957 GCAGGAGCAGCGGCTGCGGGTGG - Exonic
950650305 3:14402913-14402935 GCCGGGACTGCGGCGACGCGGGG - Intronic
952377804 3:32781579-32781601 GCCGGCGCGGCGGCGCCGGGCGG + Intergenic
954796092 3:53161901-53161923 GCCGGGGGCGCGGCTCCGGGAGG - Intronic
955826289 3:62951346-62951368 GCTTGGGCTGTGGCTTCAGGGGG + Intergenic
957981716 3:87519567-87519589 GCCTGGGCTGTGGCTTCAGAGGG + Intergenic
960024339 3:112991008-112991030 GCCCGGGCTGCGGCTGGGAGCGG + Exonic
960937724 3:122913528-122913550 GCCTGGGCTGCGGCGTGGTGAGG - Exonic
960991475 3:123314364-123314386 GGCAGGGCTGCAGCTTCTGGGGG + Intronic
961213280 3:125141709-125141731 GCCGCGGCGGGGGCTTCCGGCGG + Intronic
961627547 3:128274378-128274400 GCAGGGGCTGAGGCTTCCTGTGG - Intronic
964836153 3:160940555-160940577 GCTCGGGCTGTGGCTTCGGAGGG + Intronic
966874517 3:184314754-184314776 GCCGGGGCGGCGGCGCAGGGTGG - Intronic
966913007 3:184569620-184569642 CCAGGGGCTGCGGCAGCGGGAGG + Intronic
968657393 4:1784644-1784666 GCCAGGGCAGGGGCTTCAGGTGG - Intergenic
969308458 4:6338804-6338826 GGCGGGGCAGGGGCTACGGGAGG - Intronic
969330767 4:6472436-6472458 GCGGCGGCCGCGGGTTCGGGCGG + Intronic
970202890 4:13627515-13627537 GCTGCGGCTGCGGCTGCGGCGGG + Exonic
971852097 4:31996528-31996550 GCCGGGCCAGCGGCTGCGGAGGG + Intergenic
986422249 5:7597237-7597259 GCCAGGGCTGCGGTTTGGGCTGG + Intronic
996765416 5:127030601-127030623 GGCGGGGCTGCCGCTAGGGGCGG + Exonic
997583979 5:135034036-135034058 CCCGGGGCTGCGGCGCCGGGCGG + Exonic
998364356 5:141619097-141619119 GTAGGGGCTGCGGGTCCGGGCGG - Intergenic
998406686 5:141878281-141878303 GCCTGGGCTGCGGCTCCGCACGG + Exonic
1002162106 5:177320476-177320498 GCCTGGGCAGCAGCTCCGGGAGG - Intergenic
1002259507 5:177983968-177983990 GAAGGGGCTGCGACTCCGGGTGG - Intergenic
1002512742 5:179733341-179733363 GCCGGGGCCGTGGCGGCGGGCGG - Exonic
1002710183 5:181190599-181190621 GCGGGGTCTGCGGCTCCGGCCGG - Intergenic
1002888173 6:1313422-1313444 GCCGGGGCGGCGGGCGCGGGCGG - Exonic
1002927871 6:1615107-1615129 GCCGGCGCTGCGGCCCCAGGCGG + Intergenic
1003360564 6:5421211-5421233 GCTCGGGCTGTGGCTTCGGAGGG - Intronic
1004561989 6:16760629-16760651 GCCGGGTGTGCGGCTGCGGGCGG - Intronic
1004650079 6:17600273-17600295 GGCGGGGCTTCCGCTTCCGGCGG + Intergenic
1005854908 6:29853220-29853242 CCCAGGGCTGCTGCTTGGGGAGG + Intergenic
1006180391 6:32150528-32150550 GGCGGGGCGGCGGCAGCGGGCGG + Exonic
1006475272 6:34248978-34249000 GTCGGGGCTGCAGCGGCGGGAGG - Exonic
1006634494 6:35452359-35452381 GGAACGGCTGCGGCTTCGGGCGG + Exonic
1006860785 6:37170457-37170479 GCTGTGGCTGTGGCTGCGGGTGG - Exonic
1006950795 6:37819851-37819873 GCGGTGGCGGCGGCGTCGGGGGG - Exonic
1007588314 6:43006465-43006487 GCTGGGGCTGGGGCTGCGGCTGG - Exonic
1008545113 6:52577103-52577125 GCGGGGGCTGCGGCCGGGGGCGG - Intergenic
1014205526 6:118651618-118651640 GCCGGGGCTGGGGCCGCGAGGGG + Intronic
1016034652 6:139373809-139373831 GCTGGGGCTGCTGCTGCTGGTGG + Exonic
1016368283 6:143342274-143342296 GCTGGGGCTGCGGCTCAGCGTGG + Intergenic
1016590148 6:145735309-145735331 GCCGGGCCTGTGGCTCGGGGAGG - Exonic
1016827867 6:148404807-148404829 GCCTGGGCTGGGGCTGGGGGTGG - Intronic
1017164128 6:151391425-151391447 GCCGGTGCTGCTGCGGCGGGGGG + Exonic
1017877667 6:158537277-158537299 GCGCGCGCTGCGGCGTCGGGAGG + Intronic
1018422584 6:163652386-163652408 GCAGGGGCTGCTGCTGCTGGTGG - Intergenic
1018613054 6:165662157-165662179 GCCGGGGCGGCGGCGGCGGCCGG + Intronic
1018700363 6:166421556-166421578 CCAGGGGCTGCAGCTTGGGGAGG - Intronic
1018914617 6:168125421-168125443 GCAGGGGCTGCGGCTCCCCGGGG + Intergenic
1019421903 7:954556-954578 GCAGGGGCGGCGGCGGCGGGCGG - Intronic
1019485931 7:1289188-1289210 TCCGGGGCTGCGGGGACGGGAGG - Intergenic
1019521882 7:1464405-1464427 GCCGGTGCTGCGGCTGGGGCTGG + Intergenic
1019594010 7:1850147-1850169 GCCGGGGCAGCGGCTTCCCCTGG + Intronic
1020006224 7:4784981-4785003 GCCCCGGGAGCGGCTTCGGGAGG + Exonic
1020418281 7:7969681-7969703 GCCGGGGCTGCGGCCGCCGGCGG - Exonic
1023418221 7:39951103-39951125 GCAGGGGCTGCTGCTGGGGGGGG + Exonic
1026009987 7:66629028-66629050 GCAGTGGGCGCGGCTTCGGGCGG - Exonic
1026732665 7:72925189-72925211 GCCGGGGCCGGGGCTGCGGCGGG + Intronic
1026909485 7:74083945-74083967 GGCGGGGCTGGGGCTGGGGGCGG - Exonic
1026949348 7:74337228-74337250 GGCTGGGCTGCAGCTTGGGGAGG + Intronic
1027111400 7:75442630-75442652 GCCGGGGCCGGGGCTGCGGCGGG - Intronic
1027374510 7:77537115-77537137 GCTGCGGCTGCGGCTGCTGGCGG + Intergenic
1029123118 7:98281518-98281540 GCCGGCGGGGCGGCTTCGGGAGG + Intronic
1030598070 7:111562555-111562577 GCCGGGGGCGGAGCTTCGGGCGG - Intergenic
1030806811 7:113929638-113929660 GCCTGGGCTGCAGCTTCAGAGGG + Intronic
1032020725 7:128406000-128406022 GCGGGGGCTGCGGCAGCGGCAGG + Intronic
1032083177 7:128870012-128870034 GCCGGGCCGGGGGCTTCGGGCGG + Intronic
1033099837 7:138460591-138460613 GCCTCGGCTGCGGCCTCCGGGGG + Exonic
1034257021 7:149730243-149730265 GCCGGGGCTGGGGCTGGGGCTGG - Exonic
1034522621 7:151632313-151632335 GCGGCGGCGGCGGCCTCGGGCGG - Intronic
1034963634 7:155377993-155378015 CGCGGGGCTGGGGCTTCCGGGGG - Intergenic
1036693939 8:10962445-10962467 CCCGGGGCTGCAGCCTAGGGAGG + Intronic
1036910362 8:12754035-12754057 GCCGGGCTTGGGGCTTGGGGCGG - Intronic
1037767188 8:21779474-21779496 GACTGGGCAGCGGGTTCGGGTGG - Intronic
1037819033 8:22126969-22126991 GCCGGGGCTGGGGCTTCGCATGG - Intronic
1039476480 8:37841694-37841716 GCCGCTGCTGCCGCTTGGGGAGG - Exonic
1039949011 8:42153266-42153288 CCCGGCGCCGCGGCTGCGGGCGG + Intronic
1042916179 8:73878383-73878405 GCCGGGGCAGGGGCGGCGGGGGG - Intronic
1043502780 8:80873777-80873799 GCCGGTGCTGCTGCTTCTAGGGG - Intronic
1045023575 8:98064754-98064776 GCCCGGGCTGGGGACTCGGGTGG + Intronic
1049532400 8:143160840-143160862 CCTGGGGCTGCGGCTTCTGGTGG - Intergenic
1049565258 8:143334828-143334850 GCGGCTGCTGCGGCTCCGGGCGG - Exonic
1049608749 8:143542227-143542249 GACTGAGCTGCAGCTTCGGGAGG - Intergenic
1049680633 8:143916425-143916447 CACGGGGCTGCGGCTGCTGGAGG - Exonic
1051015839 9:12474881-12474903 GCTTGGGCTGTGGCTTCAGGGGG + Intergenic
1053239944 9:36487407-36487429 GCCGGGGCGGCGGCGGTGGGGGG + Intronic
1057133423 9:92670144-92670166 GCCGGGGGCGTGGCTTCCGGCGG - Exonic
1057314704 9:93960787-93960809 GCCGGGTCTGCAGCTTCCAGGGG - Intergenic
1057478650 9:95426814-95426836 GCGGCGGCTGCGGCTCTGGGCGG + Intergenic
1059452082 9:114376837-114376859 GCCTGGGCTGGGGATTCAGGGGG + Exonic
1060793219 9:126499359-126499381 GCCGGGCCTGCGCCCTCTGGTGG - Intronic
1060829770 9:126706141-126706163 GCTGGGGCTGCGGGTGAGGGTGG - Intergenic
1060856049 9:126915306-126915328 GCCGCGGCTGCAGGTGCGGGGGG + Intronic
1060979854 9:127785813-127785835 GCCGGAGCTGGGGCTCGGGGTGG - Intronic
1061050398 9:128191594-128191616 GCCGGGGCAGCGCCCTCTGGGGG + Intronic
1061592039 9:131603879-131603901 GCGGGGGAAGCGGCCTCGGGAGG + Intronic
1061799408 9:133105810-133105832 GCGGGGGCTGGGGCGGCGGGCGG - Intronic
1061986933 9:134135505-134135527 GCCCGGGCTGCGCCTTCCCGCGG - Intronic
1062037065 9:134387068-134387090 GCTGTGGCTGCGGTGTCGGGTGG + Intronic
1062041563 9:134406758-134406780 GCAGAGGCTGCGGCTCAGGGAGG - Intronic
1062220210 9:135410997-135411019 GCCCGGGCTGCAGCTGCGGCAGG + Intergenic
1062536597 9:137023786-137023808 GCCTGGGCAGCAGCTGCGGGGGG - Intronic
1062550968 9:137086396-137086418 GCCTGGTCCGCGACTTCGGGAGG + Intergenic
1062558870 9:137130214-137130236 GCCGGGTCCGCGACCTCGGGAGG - Intergenic
1062595249 9:137296297-137296319 GCGGGGGGAGCGGCTCCGGGCGG + Intergenic
1062651175 9:137578600-137578622 GCGCGCGCCGCGGCTTCGGGAGG - Intronic
1203561144 Un_KI270744v1:59792-59814 GCTGGGGCTGCAGCTCTGGGCGG + Intergenic
1185610837 X:1392822-1392844 GCCGGGGCTGGGGGTTCCGTGGG + Intergenic
1192495777 X:71616030-71616052 GCCTGGGCTGTGGCTTCATGGGG + Exonic
1194864906 X:99053846-99053868 GCTTGGGCTGCAGCTTCAGGGGG + Intergenic
1197753227 X:129979844-129979866 GCTGGGGCTGCGCCCGCGGGCGG + Intergenic
1199291125 X:146105960-146105982 GCTCGGGCTGCGGCTTCAGAGGG - Intergenic
1199924661 X:152450256-152450278 GCTGTGGCTGTGGCTGCGGGTGG - Intronic
1200060568 X:153481958-153481980 GCCGGGGCTGGGGCTGGGGCTGG + Intronic