ID: 1133212789

View in Genome Browser
Species Human (GRCh38)
Location 16:4272512-4272534
Sequence GTGTGGGGCTGCAGCCGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133212773_1133212789 22 Left 1133212773 16:4272467-4272489 CCCATGCTCCAAGGAAGGAGGGT 0: 1
1: 0
2: 1
3: 7
4: 158
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226
1133212783_1133212789 -2 Left 1133212783 16:4272491-4272513 CCGGGGCGGCGCGGACCCGGCGT 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226
1133212778_1133212789 14 Left 1133212778 16:4272475-4272497 CCAAGGAAGGAGGGTCCCGGGGC 0: 1
1: 0
2: 2
3: 28
4: 314
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226
1133212774_1133212789 21 Left 1133212774 16:4272468-4272490 CCATGCTCCAAGGAAGGAGGGTC 0: 1
1: 0
2: 0
3: 14
4: 226
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226
1133212771_1133212789 23 Left 1133212771 16:4272466-4272488 CCCCATGCTCCAAGGAAGGAGGG 0: 1
1: 0
2: 1
3: 24
4: 212
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226
1133212782_1133212789 -1 Left 1133212782 16:4272490-4272512 CCCGGGGCGGCGCGGACCCGGCG 0: 1
1: 1
2: 4
3: 42
4: 291
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226
1133212769_1133212789 24 Left 1133212769 16:4272465-4272487 CCCCCATGCTCCAAGGAAGGAGG 0: 1
1: 0
2: 3
3: 20
4: 243
Right 1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG 0: 1
1: 0
2: 2
3: 19
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133212789 Original CRISPR GTGTGGGGCTGCAGCCGTCC CGG Intronic
900384992 1:2406456-2406478 GTGGGAGCCTGCTGCCGTCCTGG - Intronic
900779958 1:4611665-4611687 GTGTGGGGCTGCCTCAGCCCCGG - Intergenic
901261391 1:7874468-7874490 TTGTGAGGCTGCAGCCTTCTGGG - Intergenic
901317214 1:8317358-8317380 GTGTGGGGCTGCAGAGGCGCTGG - Intergenic
902286943 1:15413120-15413142 GAGTGGGGCTGCAGCCTCCTGGG + Intronic
902638080 1:17748118-17748140 AGGTGAGGCTGCAGCCATCCTGG - Intergenic
904271541 1:29353546-29353568 GTGAGGGGCTGCACCACTCCTGG - Intergenic
904495467 1:30884115-30884137 GTGTGGGACTGCCGGCTTCCTGG - Intronic
904866350 1:33582043-33582065 GTGAGGAGCTCCAGCCTTCCTGG + Intronic
905392888 1:37649392-37649414 GTGTGTGTGTGCAGCTGTCCTGG - Intergenic
910449015 1:87328602-87328624 GTCGGGGGCTGCGGCCGGCCGGG - Exonic
913009595 1:114670080-114670102 GGGTGGGGCTGCAGCCGGGACGG - Intronic
913124629 1:115773503-115773525 TTGTGGGGCTGCATTCCTCCTGG - Intergenic
915511287 1:156388377-156388399 GTGCGGGGCGGTGGCCGTCCCGG + Intergenic
916305305 1:163323583-163323605 GTGTGTGCCTGCTGTCGTCCTGG + Intronic
918248463 1:182681125-182681147 GTGTGGGGCTTCTGCCTTCTCGG - Intronic
918536918 1:185584907-185584929 CTGTGTGGCTGCTGCCGGCCGGG + Intergenic
918616576 1:186551031-186551053 CTGTGAGGCTGCAGCCGGGCCGG - Intergenic
922075352 1:222238297-222238319 CTCTGGGGCTGCCGCAGTCCTGG + Intergenic
922728999 1:227940373-227940395 GTGTGGGTCTGCGGCTGTCTGGG - Intronic
922802815 1:228371907-228371929 GGTGGGGGCTGCAGCCCTCCTGG - Exonic
924807347 1:247372061-247372083 GTCTGGGAGTGCAGCCTTCCAGG + Intergenic
1062948627 10:1479044-1479066 GAGTGGGGCTGCAGCTGTCTTGG + Intronic
1063385351 10:5613120-5613142 GTATGAGGCTGCAGCAGTCCTGG + Intergenic
1064174003 10:13058355-13058377 CTGTGGGTCAGCAGCAGTCCAGG + Intronic
1064264765 10:13816906-13816928 TTGTGGGCCATCAGCCGTCCTGG + Intronic
1067851182 10:49755619-49755641 GTAAGGGGCTGCAGCCCTCCTGG + Intronic
1072624027 10:97099384-97099406 GAGTGGGGCTGCAGCCACCTCGG + Intronic
1073541048 10:104316288-104316310 GTGGGGTGCTGCTGCCATCCAGG - Intronic
1074853828 10:117458775-117458797 CTGTGTTGCTACAGCCGTCCGGG - Intergenic
1075594526 10:123718760-123718782 GGGTTGGGCTGCAGCCATGCAGG + Intronic
1075721686 10:124591200-124591222 GTGTGTGGCTCCAGCCGGCATGG + Intronic
1076609303 10:131711248-131711270 TTGTGGGGCTGGAGCGGTTCAGG - Intergenic
1076864402 10:133160026-133160048 GGGCGGGGCTGCCGCAGTCCCGG - Intergenic
1077332076 11:1988211-1988233 CTGTGGGGCTGCAGCTGCCTTGG - Intergenic
1077895654 11:6451362-6451384 GTGGGGCGCTGCAGCTGCCCAGG + Exonic
1078265898 11:9756180-9756202 GTGTGGAGGTGCAGCAGTCCTGG - Intergenic
1078538995 11:12198583-12198605 GTGTGGCTCTGCAGCCTCCCTGG - Intronic
1080637737 11:34138472-34138494 GTGTTGGGCTGCTTCCGTGCAGG + Intronic
1080847128 11:36036273-36036295 GGGTGGGGTGGCAGCCATCCTGG + Intronic
1083670030 11:64294541-64294563 GTGTTGGGCTGCAGCCTTCTGGG + Intronic
1083795558 11:65014580-65014602 GCGTGGGGCCGCTGCCCTCCCGG + Intronic
1083821015 11:65171412-65171434 CTGGGGGGCTGCAGCCGGCAAGG + Exonic
1083860757 11:65418732-65418754 TTATGGGGCTGCAGCTGACCTGG + Intergenic
1084433240 11:69123093-69123115 GTGTGTCTCTGCAGCCTTCCTGG + Intergenic
1084491379 11:69480379-69480401 GTGTGCGGCTGCAGACGTCACGG + Intergenic
1084770030 11:71336651-71336673 CTTTGGGGCTGGACCCGTCCAGG + Intergenic
1085315058 11:75539789-75539811 GTGTGGATCTGCAGCTGACCAGG + Intergenic
1089201487 11:116727198-116727220 GGGTGGGGGTGCAGCCCTCCCGG + Intergenic
1089677268 11:120098384-120098406 GAGAGGGGCTGCAGCTGTCTGGG + Intergenic
1202815057 11_KI270721v1_random:43387-43409 CTGTGGGGCTGCAGCTGCCTTGG - Intergenic
1091696949 12:2634007-2634029 GCGTGGGGCTGTGGCCGCCCCGG - Intronic
1092729025 12:11511081-11511103 ATGTGGGGGTGCAGCCACCCAGG - Intergenic
1094834182 12:34314570-34314592 GGGTGGGGCTGCAGGGATCCTGG - Intergenic
1097692287 12:62744765-62744787 GTCCTGGGCTGCAGCTGTCCTGG - Intronic
1098381379 12:69873304-69873326 GTGTTGGGCTGCATCCGTCCTGG + Intronic
1102956582 12:117062966-117062988 GTGTGGCCCTGGAGCCCTCCTGG - Intronic
1103276972 12:119720089-119720111 GTATGGGGCTTCAGCAGTTCAGG - Intronic
1105722955 13:23134836-23134858 GAGTGGGGATGCAGCAGTCCAGG - Intergenic
1106248980 13:27969804-27969826 GTTTGGGGCTGCAGTCGTCCGGG - Exonic
1107264498 13:38536659-38536681 GATTGGGGCTGCAGCAGTCTCGG - Intergenic
1109396623 13:61766780-61766802 GGGCGCAGCTGCAGCCGTCCAGG - Intergenic
1112046376 13:95602112-95602134 GTGCCAGGCTGCAGCTGTCCAGG - Intronic
1112440334 13:99420397-99420419 GTGTGGGGCTGAAGCAGCTCTGG - Intergenic
1113088692 13:106594730-106594752 GTGGGGGTTTGCAGCCGGCCTGG + Intergenic
1113788682 13:113016084-113016106 GTGGGTGGCTGGGGCCGTCCTGG - Intronic
1116130286 14:40847671-40847693 GACTGGGGCTGCATCTGTCCAGG + Intergenic
1117524096 14:56579964-56579986 GAGTGGGGCTGCGGCGCTCCGGG + Exonic
1121912055 14:97800579-97800601 CTGTGTGAATGCAGCCGTCCTGG + Intergenic
1122124928 14:99573758-99573780 GGGTGGGACGGCAGCCCTCCAGG + Intronic
1122855007 14:104555874-104555896 GTGAGGGGCTGGACCCCTCCTGG - Intronic
1123018848 14:105388209-105388231 GGGTGGGCCAGGAGCCGTCCAGG + Intronic
1202902236 14_GL000194v1_random:50569-50591 GGGTGGGGATGGAGACGTCCAGG - Intergenic
1124613262 15:31223615-31223637 GGGGGGTGCTGCAGGCGTCCTGG + Intergenic
1128217639 15:65945383-65945405 GTGTGGGGCTGCAGGCCTGAGGG + Intronic
1129785303 15:78306252-78306274 CTGTGGGGCTGCAGCCTTAGAGG - Intergenic
1130575640 15:85090782-85090804 GAGTGGGCCTGCTGCCCTCCTGG + Intronic
1130895147 15:88164224-88164246 GTGGTGGGCTGCAGCCGGGCTGG + Intronic
1131257971 15:90873893-90873915 GGGTGGGACTGCAGCAGTCAGGG + Intronic
1132579196 16:677419-677441 GGGTGAGGGTGCAGCCGGCCAGG - Intronic
1132630287 16:914066-914088 GCGTGTAGCTGCAGCCGCCCAGG - Intronic
1132647789 16:1007083-1007105 GTGAGGGCCTGGAGCCTTCCCGG + Intergenic
1132855070 16:2041068-2041090 GGCTGGGGCTGCAGCTGGCCGGG - Intronic
1132948931 16:2549393-2549415 GGGTGGGGCCGCATCCCTCCAGG + Intronic
1132965656 16:2652734-2652756 GGGTGGGGCCGCATCCCTCCAGG - Intergenic
1133212789 16:4272512-4272534 GTGTGGGGCTGCAGCCGTCCCGG + Intronic
1133357628 16:5148246-5148268 GTGTGGGGGTGCAGGGGTGCAGG - Intergenic
1134042284 16:11077747-11077769 GCGTGGTGCTGCAGGCGGCCTGG + Intronic
1134042475 16:11079059-11079081 GTGTGGGGCTGCAGGGCTGCAGG - Intronic
1135572117 16:23557480-23557502 GAGTGCGGCCGCAGCCGTCCAGG - Exonic
1136577697 16:31134152-31134174 GGGTGGGGCTGGGGCTGTCCTGG - Intronic
1137521723 16:49200710-49200732 GTGTGCTGCTGCAGTCGCCCAGG - Intergenic
1139309703 16:66018123-66018145 GTGTGGAGTTGCAGCAGCCCTGG - Intergenic
1141594502 16:85088989-85089011 GTGTGTGCCTGCAGACGGCCCGG + Exonic
1141933816 16:87222848-87222870 GTGTGGGTGTGCACCAGTCCTGG - Intronic
1142227777 16:88885852-88885874 CTCTGGGGCTGCAGCCAGCCCGG - Intronic
1142245696 16:88969170-88969192 GTGAGGGGCTGCAGCGGACACGG + Intronic
1142626902 17:1197986-1198008 GCGTGGGGCTGCGGCCAGCCGGG - Intronic
1144732577 17:17537170-17537192 ATGTGGGGCTGCTGCTGCCCTGG + Intronic
1148205452 17:45776910-45776932 GTGTGGGGCTGTTCCCATCCAGG + Intergenic
1148262020 17:46192843-46192865 TTGTGGGGCTGAATCCGCCCGGG - Intronic
1148746614 17:49921857-49921879 GAGGGGGGCTAGAGCCGTCCAGG - Intergenic
1150315624 17:64166471-64166493 GTGTGAGGCTGCTGCTGACCCGG + Intronic
1150942347 17:69706688-69706710 GTGTGAGGCTGCAGCCCGCCAGG + Intergenic
1152614616 17:81332016-81332038 GGGTGGGGCTGCTGCCTTCTGGG + Intergenic
1157528944 18:48406102-48406124 GTGTAGGGCTGAAGGAGTCCAGG - Intronic
1159015772 18:63100727-63100749 GTTTGGGGATGCAGCTGTCAGGG - Intergenic
1160529357 18:79554539-79554561 GGGTCGGCCTGCAGCCTTCCCGG + Intergenic
1160586590 18:79916674-79916696 GAGTGGGGCTGCCGCCCTCACGG - Intronic
1160782633 19:884584-884606 GTGAGGGGCTGCAGGCGTGTGGG - Intronic
1161571818 19:5035053-5035075 GGTGGGGGCTGCTGCCGTCCCGG + Intronic
1161586888 19:5110562-5110584 GTGTGTGGAGCCAGCCGTCCAGG + Intronic
1161646484 19:5456328-5456350 GTCTGTGGCTGCAGCAGGCCTGG - Exonic
1162133593 19:8542338-8542360 GTGGGGGGCTGCAGCCTGGCGGG + Intronic
1162465168 19:10835462-10835484 GTGTGGGTGTGCCGCCGTTCAGG - Intronic
1163419402 19:17205785-17205807 GTGTGGGGCTGCAGAAGTCAAGG - Intronic
1163908686 19:20169525-20169547 CTGTGGGGCTCCAGCTTTCCAGG - Intronic
1163933665 19:20422737-20422759 CTGTGGGGCTCCAGCTTTCCAGG + Intergenic
1164685106 19:30161378-30161400 GTGTGGGGCAGGAGCCTTCAGGG - Intergenic
1164730323 19:30498828-30498850 GTCTGAGGCTGCAGTCCTCCGGG + Intronic
1165760779 19:38320106-38320128 GTGTGTGGCTGCCCCCGCCCTGG + Exonic
1165795368 19:38516225-38516247 GTGTGGGGCGGGAGCAGTGCTGG + Intronic
1165986769 19:39776450-39776472 GTGTGGTGCGGCAGCACTCCCGG - Intergenic
1166369328 19:42292503-42292525 GGGTGGGGCTGAGGCAGTCCGGG + Intronic
1166896141 19:46022922-46022944 CTATGGGGCTGCAGCAGGCCGGG + Exonic
1167043680 19:47037943-47037965 GGGTGGGGCTGGAGCTGTCATGG - Intronic
1168147933 19:54430050-54430072 GGGTGGGGGTGCAGCCTGCCAGG + Intronic
925310725 2:2879592-2879614 CTGTGGGTGTGCAGCCTTCCAGG + Intergenic
925367088 2:3317951-3317973 GTGTTCTGCTTCAGCCGTCCAGG + Intronic
925394467 2:3522822-3522844 GTGTGGGGCTGCCGCAGCCTGGG - Intergenic
926279781 2:11436517-11436539 GTATGTGGCTGTATCCGTCCGGG + Intergenic
926697707 2:15782363-15782385 GTGTGAGGCTGCGGCTGCCCCGG + Intergenic
928421262 2:31138893-31138915 GTTTGGGGCAGCAGCCCTGCCGG - Intronic
932416025 2:71574374-71574396 ATGTGGGGCTGCACTTGTCCTGG + Intronic
933974845 2:87500962-87500984 GTGTGGGGGTCCTGCCGTCTGGG - Intergenic
936153885 2:110036004-110036026 ATGTGGGGCTGCTGCTGGCCAGG + Intergenic
936190800 2:110335411-110335433 ATGTGGGGCTGCTGCTGGCCAGG - Intergenic
936318980 2:111449851-111449873 GTGTGGGGGTCCTGCCGTCTGGG + Intergenic
946153862 2:217794261-217794283 GTGTGGTCATGCAGCCCTCCAGG + Intergenic
947532933 2:230924221-230924243 CTGTGGAGCTGCAGCAGACCTGG - Intronic
948525770 2:238569995-238570017 GTGAGGGGCTGCAGGCGTGTGGG + Intergenic
948754147 2:240149490-240149512 GTCTGGGGCTCCGTCCGTCCAGG + Intergenic
1172583431 20:36065715-36065737 GTGTGTGGCTGGAGAGGTCCAGG - Intergenic
1175685465 20:61024885-61024907 TTGTGTGGCTGCATCCGCCCAGG + Intergenic
1175859401 20:62142588-62142610 GGGCCGGGCTGCAGCCGCCCGGG - Intronic
1175896501 20:62338129-62338151 GTGTGTGGCTGCAGCCCTGCAGG - Exonic
1176033661 20:63026006-63026028 GTGTTGGGCAGCTGCCGCCCTGG + Intergenic
1176621604 21:9065336-9065358 GGGTGGGGATGGAGACGTCCAGG - Intergenic
1179246190 21:39636335-39636357 GTGTGGAACTGCAGCTGTGCTGG + Intronic
1180985731 22:19903102-19903124 GGGAGGGGCTGCAGCCAGCCAGG - Intronic
1181280172 22:21714112-21714134 GTGGGGGGCAGACGCCGTCCTGG - Intronic
1182079551 22:27519172-27519194 ATCTGGGGCTGCAGTCCTCCTGG + Intergenic
1182257291 22:29048440-29048462 GTGTGGTGCTGCAGCAGCCAGGG - Exonic
1182280987 22:29217580-29217602 GTGTGTGCCTGCAGCAGCCCCGG + Intronic
1182468464 22:30532487-30532509 GTGTCCGGCTGCAGCTGCCCAGG + Intronic
1183385764 22:37513600-37513622 GGGAGGGGCTGCAGCCCTCACGG - Intronic
1183587397 22:38760840-38760862 GTTGGGGGCTGCAGCCCTGCAGG - Intronic
1184047708 22:41981847-41981869 CTGTGGGGCTGCTGCAGGCCTGG + Intronic
1184967876 22:47994761-47994783 GTGTGGAGCTGGAGCCGGGCAGG + Intergenic
1185345040 22:50307354-50307376 GAGTGGGGCGGCAGCGGCCCGGG + Intronic
952880705 3:37984600-37984622 GAGTGGGGCTGCAGCACTCCAGG + Intergenic
953610837 3:44446064-44446086 GGCTGGGGCTTCAGCCTTCCTGG - Exonic
954122499 3:48507717-48507739 ATGGAGGGCTGCAGCAGTCCTGG + Intergenic
954369231 3:50161541-50161563 GGGTGGGGCTGCAGCGCACCTGG + Intronic
954433279 3:50482703-50482725 GAGAGGGGCTGCAGCCCACCTGG - Intronic
954683656 3:52359197-52359219 GATTGGGGCTGCGGCTGTCCAGG + Intronic
954709248 3:52496817-52496839 GGATGGGGCTGCAGCAGTGCTGG + Intronic
955842432 3:63126488-63126510 GTCTGGGGCTGCAGCTGTGAAGG + Intergenic
960952526 3:123008888-123008910 CTGGGGGGCTGCAGCTGCCCAGG + Intronic
961525721 3:127496203-127496225 GGGTGCAGCTGCAGCCATCCAGG + Intergenic
962251129 3:133836741-133836763 GTGTGGGGCTGAAGCTGTCATGG - Intronic
962351081 3:134656188-134656210 GTTTGGGGATGTAGCCTTCCTGG - Intronic
964351261 3:155805956-155805978 GTGCGGGGCTGCAGAGGGCCGGG - Intronic
966464611 3:180215970-180215992 GTGTGGGGCTACTGACATCCTGG + Intergenic
967410272 3:189160110-189160132 GAGATGGGCTGCAGCCCTCCCGG + Intronic
968942504 4:3646137-3646159 CTGTGGGGCTCCAGCCGGCCAGG - Intergenic
969329201 4:6463367-6463389 GGGTGGGGCTGCAGGAGGCCAGG + Intronic
969397121 4:6929303-6929325 GTGTTGGGCTGCAGTTGTCAGGG + Intronic
969512840 4:7629507-7629529 GTGAGGGGCTTCAGCAGGCCAGG - Intronic
976416316 4:84780227-84780249 TGGTGGAGCTGCAGCCATCCTGG - Exonic
977771934 4:100870222-100870244 CTGTGGGGCTGCTGCAATCCAGG + Intronic
984747854 4:183240636-183240658 GTGTGAGCCTGCAGCTGCCCTGG + Intronic
985558175 5:568346-568368 GTCTCTGGCTGCAGCCCTCCTGG + Intergenic
990986042 5:61641952-61641974 GCCTGGGGCTGCAGCAGTGCTGG + Intronic
992852469 5:80824383-80824405 GTGGGGGGCAGCCCCCGTCCTGG - Intronic
1000232626 5:159330373-159330395 CTGTGGGCCTGCAGCTGTCCAGG - Intronic
1000233503 5:159336520-159336542 CTGTGGGGCTGCAGGGGTCATGG + Intergenic
1001280725 5:170384498-170384520 GAGTGAGGCTGCAGCAGGCCCGG + Intronic
1002765207 6:233309-233331 GTCTGGGGCTGCCGGCCTCCAGG + Intergenic
1002778737 6:350300-350322 CTCTGGGGCTGCAGGCATCCTGG + Exonic
1003761930 6:9188462-9188484 CTGTCGGGCTGCAGCCCACCAGG - Intergenic
1004418630 6:15447749-15447771 CTGTGGGGCCTCAGCCCTCCAGG - Intronic
1006370307 6:33640218-33640240 GACTGGAGCTGCAGCTGTCCTGG - Intronic
1007230527 6:40344860-40344882 GGGTGGGGCTACAGCAGGCCAGG - Intergenic
1007745544 6:44040969-44040991 TTGTGGGGCTGCAGGTGGCCTGG - Intergenic
1011700499 6:89950613-89950635 GTGTTGGGCCGCATCCTTCCTGG + Exonic
1015088182 6:129321488-129321510 CTGTAGGGCTGGAGCAGTCCTGG - Intronic
1016292290 6:142538822-142538844 GTGTGGAGCTGCAGCCCTGTGGG - Intergenic
1018628106 6:165799926-165799948 GTGTGGGCCTGCAGCTCCCCTGG + Intronic
1018897354 6:168029554-168029576 GCCTGGGTCTGGAGCCGTCCTGG + Exonic
1018897370 6:168029630-168029652 GCCTGGGTCTGGAGCCGTCCTGG + Exonic
1018969313 6:168515300-168515322 GTGTGGTGCTGCAGCTGCCAAGG + Intronic
1022099502 7:27160866-27160888 CTGCCGGGCTGCAGCTGTCCGGG - Intergenic
1022108730 7:27214682-27214704 CTTTGGGGCTGCAGCCACCCAGG - Intergenic
1022482241 7:30751909-30751931 AGCTGGGGCTGCAGCCGCCCTGG - Intronic
1023248150 7:38229336-38229358 GTGAGGGGCTGCAGTGGACCTGG - Intronic
1023870414 7:44260364-44260386 GTATGGGGCTGCTGGAGTCCAGG - Intronic
1024085566 7:45889084-45889106 GGGTGGGGCTGCAGCCGGGCAGG + Intronic
1029327544 7:99823111-99823133 GTGGGTGGCTGCAGCTGTGCAGG - Intergenic
1029346549 7:99983072-99983094 TTGTGGGGCTGCAGAGGGCCAGG - Intergenic
1029558666 7:101287793-101287815 TTGTGGGGCTGCAGAGGGCCAGG + Intergenic
1029591414 7:101509599-101509621 GAGTGGGGCTGCAGAGGTACAGG + Intronic
1034275448 7:149821943-149821965 GTGAGGGGCTGCGGCCCTGCAGG - Intergenic
1034345293 7:150382006-150382028 GTGTGGGGATGGAGGCCTCCAGG + Intronic
1034902421 7:154915687-154915709 GTGCTGGGCTGCAGGTGTCCTGG - Intergenic
1034902456 7:154915869-154915891 GTGCTGGGCTGCAGGTGTCCTGG - Intergenic
1036690208 8:10940422-10940444 TCCTGGGGCTGCAGCCCTCCTGG - Intronic
1037153092 8:15662991-15663013 GTGTGGGGCTACAGCAGTGATGG + Intronic
1037624159 8:20593062-20593084 ATGTAGGGCTGCAGGCCTCCAGG + Intergenic
1038446850 8:27610527-27610549 TTGTGGGGCTGCTGCTGACCTGG - Exonic
1039869459 8:41533343-41533365 GCCTGGGGCTCCAGCTGTCCTGG - Intronic
1040886332 8:52267294-52267316 GGCTGGGGCTGGAACCGTCCGGG + Intronic
1043167521 8:76922696-76922718 GTGTGAGGCTGCATCTGTCTAGG + Intergenic
1045029005 8:98117398-98117420 GTGAGGGGCTGGTGCCTTCCAGG + Intronic
1049180768 8:141220895-141220917 GTGTGGGGGTGCGGCTGCCCTGG - Intronic
1049277787 8:141728549-141728571 GGCTGGGGCTGCGGCCGGCCAGG - Intergenic
1049358034 8:142198394-142198416 GAGTGGGGCAGCAGCCGGACAGG - Intergenic
1049381702 8:142319520-142319542 GTGTGTGCCTGCAGCCGGGCTGG - Intronic
1049421312 8:142517808-142517830 GTGTGGGGCTGGCGCCTGCCTGG + Intronic
1049665069 8:143839383-143839405 TTGGGGGGCTGCAGGCGTGCAGG + Exonic
1050377062 9:4984788-4984810 GTGTGTGGCCGCCGCCCTCCAGG - Intergenic
1051653508 9:19354392-19354414 TTGTGGGAGTGCAGCCGTCTAGG - Intronic
1055098306 9:72437348-72437370 GTGTTGGGCTGCAGGCTTCTAGG - Intergenic
1056619607 9:88200647-88200669 CTGTGGGGCTTCAGCCATCCAGG + Intergenic
1056999817 9:91497320-91497342 GTGTGGGCCTGAAGCCATCCTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1058510632 9:105713269-105713291 TTGGGGGGCTGCAGCTGTCGGGG - Intronic
1060186744 9:121568288-121568310 GTTTGGAGCTGCAGCCCTCAGGG + Intronic
1062333395 9:136054378-136054400 GCGTGGGGCTGCAGCCTCACCGG - Intronic
1062417935 9:136462808-136462830 GTGCGGGGTTGCAGCCTTCAGGG - Intronic
1062511422 9:136908254-136908276 CTGTGTGGCTGCAGCCATGCGGG + Intronic
1062612956 9:137383165-137383187 GTCTGGGGCAGCAGCTGTGCAGG + Intronic
1187698018 X:21940612-21940634 GTTCGGGGCTGGAGGCGTCCCGG + Exonic
1188535195 X:31189319-31189341 GAGTGGGGCTGCGGCGGGCCAGG - Intronic
1190324893 X:49200267-49200289 GGGCGGGGCTGCAGCCGCCTGGG - Intergenic
1192331356 X:70177806-70177828 GAGTGAGGCTGCAGCTGTTCTGG + Intronic
1192436279 X:71145494-71145516 TTTTGGGGCTGCAGCGGTGCTGG - Intronic
1201158127 Y:11150789-11150811 GGGTGGGGATGGAGACGTCCAGG - Intergenic