ID: 1133214235

View in Genome Browser
Species Human (GRCh38)
Location 16:4281638-4281660
Sequence GTATCTACAGCCACTCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133214235_1133214237 -6 Left 1133214235 16:4281638-4281660 CCATGTGGAGTGGCTGTAGATAC No data
Right 1133214237 16:4281655-4281677 AGATACAGATGAAGCTTGGCTGG No data
1133214235_1133214238 -2 Left 1133214235 16:4281638-4281660 CCATGTGGAGTGGCTGTAGATAC No data
Right 1133214238 16:4281659-4281681 ACAGATGAAGCTTGGCTGGCTGG No data
1133214235_1133214236 -10 Left 1133214235 16:4281638-4281660 CCATGTGGAGTGGCTGTAGATAC No data
Right 1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133214235 Original CRISPR GTATCTACAGCCACTCCACA TGG (reversed) Intergenic
No off target data available for this crispr