ID: 1133214236

View in Genome Browser
Species Human (GRCh38)
Location 16:4281651-4281673
Sequence CTGTAGATACAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133214235_1133214236 -10 Left 1133214235 16:4281638-4281660 CCATGTGGAGTGGCTGTAGATAC No data
Right 1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG No data
1133214234_1133214236 -3 Left 1133214234 16:4281631-4281653 CCGCTAGCCATGTGGAGTGGCTG No data
Right 1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133214236 Original CRISPR CTGTAGATACAGATGAAGCT TGG Intergenic
No off target data available for this crispr