ID: 1133215297

View in Genome Browser
Species Human (GRCh38)
Location 16:4288561-4288583
Sequence TGGGGCTCCCCCGACCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133215287_1133215297 12 Left 1133215287 16:4288526-4288548 CCCAAGTCAGGGGGACATCTCTG No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data
1133215281_1133215297 22 Left 1133215281 16:4288516-4288538 CCCTCCTCTCCCCAAGTCAGGGG No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data
1133215285_1133215297 18 Left 1133215285 16:4288520-4288542 CCTCTCCCCAAGTCAGGGGGACA No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data
1133215288_1133215297 11 Left 1133215288 16:4288527-4288549 CCAAGTCAGGGGGACATCTCTGG No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data
1133215286_1133215297 13 Left 1133215286 16:4288525-4288547 CCCCAAGTCAGGGGGACATCTCT No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data
1133215283_1133215297 21 Left 1133215283 16:4288517-4288539 CCTCCTCTCCCCAAGTCAGGGGG No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data
1133215278_1133215297 29 Left 1133215278 16:4288509-4288531 CCTCTGGCCCTCCTCTCCCCAAG No data
Right 1133215297 16:4288561-4288583 TGGGGCTCCCCCGACCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133215297 Original CRISPR TGGGGCTCCCCCGACCAGTA GGG Intergenic
No off target data available for this crispr