ID: 1133215946

View in Genome Browser
Species Human (GRCh38)
Location 16:4292618-4292640
Sequence GGTGAGTTTCCAGCTGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133215940_1133215946 2 Left 1133215940 16:4292593-4292615 CCTGCGCTCATGAAAACCAAAGC No data
Right 1133215946 16:4292618-4292640 GGTGAGTTTCCAGCTGGGAGAGG No data
1133215937_1133215946 25 Left 1133215937 16:4292570-4292592 CCAGGCCAGAGGAGGGCTGGAGG No data
Right 1133215946 16:4292618-4292640 GGTGAGTTTCCAGCTGGGAGAGG No data
1133215939_1133215946 20 Left 1133215939 16:4292575-4292597 CCAGAGGAGGGCTGGAGGCCTGC No data
Right 1133215946 16:4292618-4292640 GGTGAGTTTCCAGCTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133215946 Original CRISPR GGTGAGTTTCCAGCTGGGAG AGG Intergenic
No off target data available for this crispr