ID: 1133218806

View in Genome Browser
Species Human (GRCh38)
Location 16:4309418-4309440
Sequence GCTTCTCCCTCCCATCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133218806_1133218810 16 Left 1133218806 16:4309418-4309440 CCACACTGATGGGAGGGAGAAGC No data
Right 1133218810 16:4309457-4309479 CGAAACCATGAAGGCAGGACAGG No data
1133218806_1133218809 11 Left 1133218806 16:4309418-4309440 CCACACTGATGGGAGGGAGAAGC No data
Right 1133218809 16:4309452-4309474 AGAAACGAAACCATGAAGGCAGG No data
1133218806_1133218808 7 Left 1133218806 16:4309418-4309440 CCACACTGATGGGAGGGAGAAGC No data
Right 1133218808 16:4309448-4309470 TAGGAGAAACGAAACCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133218806 Original CRISPR GCTTCTCCCTCCCATCAGTG TGG (reversed) Intergenic
No off target data available for this crispr