ID: 1133221694

View in Genome Browser
Species Human (GRCh38)
Location 16:4321667-4321689
Sequence GCCAGGGGCCGTGGGAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 410}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133221676_1133221694 19 Left 1133221676 16:4321625-4321647 CCTCACTGCCCAGTTCACTCTGG 0: 1
1: 0
2: 2
3: 33
4: 302
Right 1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG 0: 1
1: 0
2: 2
3: 42
4: 410
1133221674_1133221694 24 Left 1133221674 16:4321620-4321642 CCCTGCCTCACTGCCCAGTTCAC 0: 1
1: 0
2: 3
3: 27
4: 340
Right 1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG 0: 1
1: 0
2: 2
3: 42
4: 410
1133221675_1133221694 23 Left 1133221675 16:4321621-4321643 CCTGCCTCACTGCCCAGTTCACT 0: 1
1: 0
2: 3
3: 45
4: 375
Right 1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG 0: 1
1: 0
2: 2
3: 42
4: 410
1133221680_1133221694 11 Left 1133221680 16:4321633-4321655 CCCAGTTCACTCTGGTGGATGGG 0: 1
1: 0
2: 1
3: 7
4: 143
Right 1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG 0: 1
1: 0
2: 2
3: 42
4: 410
1133221682_1133221694 10 Left 1133221682 16:4321634-4321656 CCAGTTCACTCTGGTGGATGGGG 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG 0: 1
1: 0
2: 2
3: 42
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133221694 Original CRISPR GCCAGGGGCCGTGGGAACTG GGG Intronic
900340025 1:2183950-2183972 GCCATGAGTCGGGGGAACTGAGG + Intronic
900410068 1:2508385-2508407 GCCCGGGGCCATGGGGTCTGCGG + Intergenic
900607613 1:3530901-3530923 GACAGGGTCCGTGGGCGCTGAGG - Intronic
901038334 1:6349621-6349643 GCACTGGGCCTTGGGAACTGTGG - Intronic
901144633 1:7056740-7056762 GCCAGGAGCCTTGGGAGATGGGG + Intronic
901221936 1:7588247-7588269 GTCAGAGGCAGTGAGAACTGGGG - Intronic
901500819 1:9651852-9651874 GCCAGGGGCTTTGGGAGCTGCGG + Intronic
902681583 1:18047609-18047631 GCCAGGGGCCATGGGGAGGGTGG + Intergenic
902747195 1:18481947-18481969 GCCAGGGTCCCTGGGAACAGGGG + Exonic
902792480 1:18778609-18778631 GCCAGGGACCCTGGGGACAGGGG + Intergenic
903445256 1:23418800-23418822 GCCCAGGGCCTTGGGAATTGGGG + Intronic
903888617 1:26555467-26555489 GACAGGGGCCGGGGGAGATGGGG + Intronic
903956915 1:27032027-27032049 GGCAGGGGCCGTGGTTCCTGGGG + Intergenic
904327941 1:29739570-29739592 TCCAGGGGCCATTGGGACTGTGG + Intergenic
904622721 1:31784963-31784985 GCCTGGGGCAGTGGGGGCTGAGG + Intergenic
904873520 1:33636291-33636313 GCCAGGGGCAGAGGGTGCTGTGG - Intronic
905008623 1:34731258-34731280 GTCAGGGGCAGAGGGAACAGTGG - Intronic
905903700 1:41600541-41600563 GCCAGAGGCTGTGGGAATGGGGG + Intronic
907867190 1:58409829-58409851 GCCAAGGGACCTGGGAACTTTGG + Intronic
909462763 1:75937803-75937825 GCCAGGGGCTGTGGGGATGGAGG - Intergenic
910804323 1:91175324-91175346 CCCAGAGGCCGTGGGAAATCAGG + Intergenic
910980300 1:92953727-92953749 GCCAGGGGCAGGAGGAAATGAGG + Intronic
912946120 1:114086242-114086264 GCCAGGGGCTGGGGGAAGGGAGG + Intergenic
914431655 1:147624557-147624579 TCCAGGGCCAGTGGGAACTCCGG + Exonic
914675522 1:149904770-149904792 GTCAAGGGCAGTGGGAAATGGGG + Exonic
914902898 1:151721418-151721440 GCTAGGGGCTGAGGGAACTGAGG - Intronic
915469299 1:156115992-156116014 GCCAAGGGCTGTGGGAGCTGCGG - Intronic
915527535 1:156485219-156485241 GCCATTGGCAGTGGGAGCTGGGG - Intronic
916060507 1:161095254-161095276 GACATGGGCAGAGGGAACTGTGG + Intergenic
917456507 1:175190680-175190702 GACAATGGCAGTGGGAACTGAGG - Intronic
917645939 1:177028958-177028980 GTCAGAGGCAGTGGGAGCTGTGG + Intronic
917937461 1:179882654-179882676 GCCAGGGCCGGCGGGAAGTGAGG + Exonic
917992490 1:180396129-180396151 GCCAGGGGCTGAGGGAATGGAGG + Intronic
917993103 1:180403905-180403927 GCCAGGGGCCAGGGGAAGGGAGG + Intronic
919914214 1:202130021-202130043 GCCGGGGGCAGTGGGAGCTCTGG - Exonic
919914431 1:202130802-202130824 GGAAGGGGCCGGGTGAACTGAGG + Exonic
920053363 1:203176289-203176311 GCGAGAGTCCCTGGGAACTGTGG - Intergenic
920195785 1:204226191-204226213 GCCAGGGGCGGTGGGAACAGTGG + Intronic
922279848 1:224113541-224113563 GCCAGAGGCTGGGGGAAATGGGG - Intergenic
922455259 1:225769109-225769131 GCCAGGGGAGCTGGGAACAGTGG + Intergenic
922504587 1:226119142-226119164 GCCTGGGGCTCTGGGGACTGTGG - Intergenic
922640090 1:227221539-227221561 GCCAGGGGTAGTGGGAAGGGAGG - Intronic
923015012 1:230120074-230120096 GCCAGGTGCCGAGGGCACAGGGG - Intronic
923094426 1:230763404-230763426 GCCAGGGGCTGGGGGAAGGGAGG - Intronic
923545695 1:234921746-234921768 GCCAGGTGCCCTGGGAACTCCGG - Intergenic
923564678 1:235068006-235068028 GCCAGGTGCGGTGGCATCTGTGG - Intergenic
1063730162 10:8687415-8687437 GACAAGGGCAGTGGGAAATGGGG - Intergenic
1065280943 10:24137254-24137276 GCCTGGGGCAGGGGGAACTATGG - Intronic
1066658733 10:37719885-37719907 GCCAGGGCCAGTGGTCACTGAGG - Intergenic
1067263460 10:44714954-44714976 CCCAGGGTCCCTGGGAACTCTGG + Intergenic
1067474742 10:46557700-46557722 GCCAGCGGTTGTGGAAACTGGGG - Intergenic
1072070664 10:91913355-91913377 GCCAGGGGCTGGGGGAAGGGAGG - Intergenic
1072635680 10:97176404-97176426 GCCAGGGGTCTTGGGGAATGTGG - Intronic
1073306049 10:102504187-102504209 GCCAGGGGCCGGGGGCGCGGTGG - Exonic
1073317653 10:102593987-102594009 GCCAGGGGCCGCCAGCACTGTGG - Exonic
1073331690 10:102674190-102674212 CCCAGCAGCCGTGGGAGCTGCGG + Exonic
1073441732 10:103556314-103556336 TCCCTGGGCCCTGGGAACTGGGG + Intronic
1074994484 10:118744467-118744489 GCCAGGGGCAGGGAGAAGTGAGG + Intronic
1075234074 10:120710802-120710824 CACAGGGGCAGTGGGAGCTGAGG - Intergenic
1076100499 10:127773999-127774021 TCCAGGGGCTGTGGGAAAGGTGG + Intergenic
1076234370 10:128852410-128852432 GCCAAGGGACGTGGGTACTAGGG - Intergenic
1076299672 10:129415484-129415506 CCCAGGGGCCTTGACAACTGCGG + Intergenic
1076832180 10:133001238-133001260 GCCAGGGGACCTGGGGACTGTGG - Intergenic
1076901892 10:133343427-133343449 GCCAGTGGCTCAGGGAACTGGGG - Intronic
1077042805 11:532054-532076 GCCAGAAGCCGTGGACACTGGGG + Intergenic
1077244152 11:1527897-1527919 GCCGGGGGCCGGGGGAGCTGGGG - Intergenic
1077414203 11:2417041-2417063 CCCAGGGGCTGGGGGAAATGGGG + Intronic
1077477156 11:2795868-2795890 GGCGGGGGCCGGGGGAACAGGGG + Intronic
1078823842 11:14907628-14907650 CCCAGGGGCAGTGGGAGCAGAGG - Intronic
1081927906 11:46846046-46846068 GCCGGAGGCCGGGGGACCTGCGG - Intronic
1082762945 11:57144576-57144598 GCCATGGGCCATGGGGAATGGGG - Intergenic
1083637137 11:64126822-64126844 GCTGGGGGGCGTGGGAAGTGGGG - Intronic
1083893730 11:65609957-65609979 GCCAGGGGCTGTGGGGGCTGAGG - Intronic
1084005002 11:66317888-66317910 GCCTGGGGCCCTGGGAACCTGGG + Intergenic
1084465571 11:69321092-69321114 GCCAGAGGGCATGGGAGCTGAGG - Intronic
1085982810 11:81744780-81744802 GCCACTGGCCCTGGGCACTGAGG - Intergenic
1086622960 11:88910070-88910092 GACTGGGGAAGTGGGAACTGGGG - Intronic
1088341108 11:108768211-108768233 GCCTGGGGTGGTGGGAAGTGAGG + Intronic
1089133025 11:116226956-116226978 GCCAGGGCCAGTGGGAAAGGAGG + Intergenic
1089413921 11:118271006-118271028 GCCAGGGGCTGGGGGAAGAGGGG + Intergenic
1090487461 11:127126896-127126918 GCCAGAGGCCATGGGAACGAGGG - Intergenic
1091594984 12:1872232-1872254 GCAGGGGGCTCTGGGAACTGTGG - Intronic
1091596906 12:1884476-1884498 GCCCAGGGCCATGGGGACTGCGG + Intronic
1094470247 12:30796098-30796120 ACCCGGAGCGGTGGGAACTGCGG - Intergenic
1095628269 12:44343548-44343570 GCCAGGGGCCTGGGGGACAGGGG + Intronic
1096133678 12:49181703-49181725 GCCAGGGGCTGTGGAGACGGAGG + Intergenic
1096815435 12:54198939-54198961 ACAAGGGGCAGTGGGAGCTGGGG - Intergenic
1097270165 12:57769184-57769206 GCCAGGGGCAGTCTGAACAGTGG - Intronic
1097724238 12:63056479-63056501 GCCAGGGGCTGGAGGGACTGCGG - Intergenic
1100199361 12:92281801-92281823 GACAGTGGCCCTGGGAACTGTGG - Intergenic
1101705960 12:107221588-107221610 GCCAGGCGCCGTGGGGGTTGGGG + Intergenic
1102586324 12:113925596-113925618 GACAGGAGCCCTGGGAACTACGG + Intronic
1103613632 12:122138785-122138807 GACAGGAGCCGTGGGAGCTGTGG - Intronic
1104640424 12:130463492-130463514 GCCAGGAGCTGGGGGAGCTGTGG - Intronic
1104757177 12:131276622-131276644 GACAGGAGCTGTGGGAACAGAGG - Intergenic
1104962324 12:132494084-132494106 ACCAGGGGCCGTGGTATGTGGGG + Intronic
1106227245 13:27794559-27794581 GAGAGGAGCCGTGGGGACTGAGG - Exonic
1106397155 13:29392225-29392247 GCCAGGGGCTGCGGGAAGAGGGG - Intronic
1106425230 13:29622426-29622448 GCCAAGGGCCAGGGGAAGTGGGG + Intergenic
1106425232 13:29622433-29622455 GCCAGGGGAAGTGGGGAATGAGG + Intergenic
1108089617 13:46834811-46834833 GCTAGTTGCCGTGGCAACTGTGG - Exonic
1111854924 13:93625671-93625693 GCCTGGGGCCTTGGGAAAAGAGG - Intronic
1113610602 13:111642275-111642297 CCCTGGGGCCATGGCAACTGAGG + Intronic
1113885653 13:113657216-113657238 GCCGGGCACCGTGGGAATTGAGG + Intronic
1114257362 14:21014817-21014839 ACCAAGGGACCTGGGAACTGGGG + Intergenic
1114547293 14:23512382-23512404 CACAGGGGCCCTGGGAACTGGGG + Intergenic
1114616160 14:24069470-24069492 GCAGGGGGCCCTGGGGACTGGGG - Exonic
1115545452 14:34462018-34462040 GCCCGGGGCCTGGGGAAATGCGG + Intronic
1116430018 14:44835864-44835886 GACATGAGCAGTGGGAACTGAGG + Intergenic
1117993751 14:61459468-61459490 AACAGGGGCCTTGAGAACTGAGG + Intronic
1118265084 14:64287204-64287226 GCCAGGGGCTGGGGGAAGGGAGG - Intronic
1118794668 14:69130410-69130432 GCCAGGGGCTGGGGGAAAAGAGG + Intronic
1119055146 14:71411740-71411762 GCCAGGGGCTGTGGGTAGTGGGG - Intronic
1119454152 14:74739992-74740014 GCCAGTGGCTGTGGGGATTGGGG + Intergenic
1119831626 14:77707971-77707993 GGCAGCGGCCGTGGGCTCTGTGG - Exonic
1121084183 14:91132819-91132841 GCCAGGGGCTGGGGGAAGGGAGG - Intronic
1121112570 14:91322212-91322234 CCCAGGGGCTGTGGGTACAGGGG + Intronic
1121245799 14:92460032-92460054 GCCAGGGGCCGCGGGAAGAGGGG + Intronic
1121339890 14:93099018-93099040 GCCCGGGGCCCTCGGAACTGGGG + Intronic
1122153662 14:99737915-99737937 GCCAGTCGCCGAGGGCACTGGGG + Intronic
1122305429 14:100763108-100763130 GCCAGGGGCCTTGGGTACAGCGG + Intergenic
1122707241 14:103629101-103629123 GCCCGGGGCTGGGGAAACTGAGG - Intronic
1123046613 14:105520654-105520676 GCCAGGGGCTGGGAAAACTGGGG + Intergenic
1123106011 14:105841367-105841389 TCCAGGGGCTGGGGGATCTGTGG + Intergenic
1123133002 14:106002002-106002024 GCCAGGGCCTGAGGGAACAGGGG + Intergenic
1123583029 15:21732448-21732470 GCCAGGGCCTGAGGGAACAGGGG + Intergenic
1123619679 15:22175045-22175067 GCCAGGGCCTGAGGGAACAGGGG + Intergenic
1124269236 15:28265831-28265853 ACCTGGGGCCGCGGGAACTACGG - Exonic
1125070232 15:35545933-35545955 GCCAGGGGCCGAGGCACATGCGG + Intronic
1125482894 15:40092782-40092804 GCCTGGGGGGGTGGAAACTGGGG + Intronic
1126066564 15:44830413-44830435 CCCAGCGGCCTTGGGAGCTGAGG - Intergenic
1126093318 15:45070456-45070478 CCCAGCGGCCTTGGGAGCTGAGG + Intronic
1127142618 15:55993351-55993373 GCGAGGCGCCGCGGGGACTGTGG - Intronic
1127971600 15:63966387-63966409 GCCAGGGGCTGAGGGAGGTGTGG + Intronic
1128061951 15:64740923-64740945 CCCGGGGGCAGTGGGAACTCGGG + Exonic
1128980273 15:72180519-72180541 GCCAGGGGCTGTGGCTACTCTGG + Intronic
1129322258 15:74781978-74782000 GCCGGGCGCCGGGGGCACTGCGG - Intergenic
1129364103 15:75043871-75043893 CCCGGCGGCCGTGGGAAGTGAGG - Intronic
1129737635 15:77974965-77974987 GGCAGGACCCGTGGGACCTGGGG - Intergenic
1129764094 15:78149896-78149918 GCCAGTGCCCGTGGCACCTGCGG - Intronic
1130008604 15:80128158-80128180 GCCAGAAACCGTGGGAAGTGGGG + Intronic
1130966801 15:88703770-88703792 GCCAGGGGATGTGGGAGATGGGG - Intergenic
1131110564 15:89761963-89761985 GTGAGGGGCCTTGGGAGCTGAGG - Intronic
1131492827 15:92877649-92877671 ACCAGGGACCGTTGGGACTGAGG - Intergenic
1132224316 15:100128669-100128691 TCCTGGGGCCATGGGACCTGGGG + Intronic
1132553951 16:564614-564636 GGCAGGGGCCGGGGGCGCTGTGG + Intronic
1132758455 16:1497227-1497249 TCCTGGGCCCGTGGGATCTGGGG + Intronic
1132836922 16:1958820-1958842 GCCAGGGGCCGTGCCAGGTGTGG + Intergenic
1133036340 16:3036224-3036246 GCCAGGGCCCTGGGAAACTGGGG - Intronic
1133184211 16:4083840-4083862 GCCAGGGGCTGGGAGCACTGGGG + Intronic
1133221694 16:4321667-4321689 GCCAGGGGCCGTGGGAACTGGGG + Intronic
1133278362 16:4651484-4651506 GGCAGGGGGCCTGGGAACAGAGG + Intronic
1134849861 16:17470863-17470885 GCCGGCGGCCGCGGGAGCTGCGG - Exonic
1135721517 16:24822183-24822205 GCCAGGGAGCATGGGAACAGAGG + Intronic
1136029201 16:27490440-27490462 GCCCGGGGCAGTGGGAGCTCAGG + Intronic
1136109738 16:28057268-28057290 GCCAGGAGCAGGGGGAGCTGCGG + Intronic
1138123626 16:54421136-54421158 GCCAGGGCCTGGGGGAAATGGGG - Intergenic
1138201454 16:55091588-55091610 GCCAGGGGCCGCAGGGATTGAGG - Intergenic
1138580154 16:57935698-57935720 GCCTGTGGCGGTGGGAGCTGGGG + Intronic
1139497769 16:67333547-67333569 GCCAGGGGTAGTGGGAAATGAGG - Intronic
1139955357 16:70690548-70690570 GCCAGGGGGTGGGGGAGCTGAGG + Intronic
1140272227 16:73477588-73477610 GGCAGGGTCCGCGGGAACTGTGG - Intergenic
1140456612 16:75109426-75109448 GCCAGGGGCCGTGGCAGCAGGGG - Exonic
1140782908 16:78312877-78312899 GACAGAGGCAGTGGGAAGTGAGG - Intronic
1141059959 16:80857824-80857846 ACCAAGGGCCGTGGAAGCTGAGG - Intergenic
1141816923 16:86417225-86417247 GCCAGGGAGCCTGGGAAGTGCGG + Intergenic
1141988043 16:87592853-87592875 GCCAGGGGCTGAGGGCACTGTGG + Intergenic
1142054600 16:87985159-87985181 GCCAGGGGGTGTGGGAAGTCTGG + Intronic
1142274809 16:89112817-89112839 GGCAGGCGCCGTGGGACATGTGG - Intronic
1142535826 17:617141-617163 GCCAGAGGCCGTGGGAGCTCAGG + Intronic
1143103599 17:4517243-4517265 GCCAGGGTCCCTGGAAACAGAGG - Intronic
1143136711 17:4716356-4716378 GCCAGGGGACTGGGGAAGTGGGG + Intronic
1143384208 17:6517425-6517447 GCCAGGGGCCATGGGAGCTGGGG + Intronic
1143631974 17:8144758-8144780 GCCAAGGGCTGAGGGAGCTGTGG + Exonic
1143806273 17:9430374-9430396 GCTAGGGGCAGGGGGAAATGGGG - Intronic
1144443268 17:15303298-15303320 TTCAGGGGCTGGGGGAACTGAGG + Intergenic
1144954080 17:19010423-19010445 GCTGGGGGCAGTGAGAACTGGGG - Intronic
1145019307 17:19417105-19417127 ACCAGGCCCCCTGGGAACTGGGG + Exonic
1145940175 17:28739180-28739202 GCCTGGGGCCGTGGAGACAGCGG + Exonic
1146697604 17:34921682-34921704 GCCAGGGGGAGGGGGAAATGAGG + Intergenic
1146957424 17:36943505-36943527 GCCAGGAGCCGTGGGGAGGGAGG + Exonic
1147316078 17:39621095-39621117 GGGAGGGGCCATGTGAACTGCGG - Intergenic
1147341606 17:39755901-39755923 GCCAGGGGGCCAGGGTACTGGGG + Intergenic
1147898895 17:43770682-43770704 GGCAGAGGCCCTGGGAGCTGGGG + Intronic
1148027983 17:44601507-44601529 GGCAGGGGCCGTGGGCCCTGTGG + Intergenic
1148694891 17:49552793-49552815 GACAGGGGCCGTGGAAAGAGGGG - Intergenic
1148820329 17:50356269-50356291 GCCAGGGGCCTTGGGGCCTCGGG - Intronic
1149568094 17:57653474-57653496 GCCCGGGGCTGGGGGGACTGAGG - Intronic
1150236709 17:63599155-63599177 GCCTAGGGCTGTGGGAATTGGGG + Intergenic
1151585172 17:75004337-75004359 GCCAGGGGCTGGGGGAGCTGGGG - Exonic
1151698263 17:75729197-75729219 GCCAGGGGCACTGGGGTCTGCGG + Intronic
1152636368 17:81432178-81432200 GCCAGTGGCCTTGGTCACTGGGG + Intronic
1152734594 17:81991253-81991275 GCCAGGGGCCGGGCACACTGGGG - Intronic
1154173670 18:12067962-12067984 GCCAGCTGCCGTGGGGCCTGCGG + Intergenic
1157762824 18:50276727-50276749 CCCAGGTGCTGTGAGAACTGTGG - Exonic
1159998762 18:74995244-74995266 GCCAGGAGCCGTGGCACCTTAGG + Intronic
1160837949 19:1133294-1133316 GCCAGGGGCCCTGGGAAAGAAGG + Intronic
1161061409 19:2217025-2217047 GACAGGGGCCGCGGGTCCTGAGG - Exonic
1161101548 19:2424371-2424393 GCCTGGGGCAGTGGGAGCCGGGG - Intronic
1161173063 19:2822972-2822994 GCCAAGGGCTCTGGGATCTGGGG + Intronic
1161297320 19:3526538-3526560 GTCAGGGGCCCTGGGATCTGAGG + Intronic
1161347138 19:3774115-3774137 GCCAAGGGCCGGGGGAGATGGGG + Intergenic
1161620476 19:5294393-5294415 GCCTGGGGCCCCCGGAACTGAGG + Intronic
1162208820 19:9075742-9075764 GTCATGGGCAGTGGGAACGGCGG - Intergenic
1162913377 19:13861906-13861928 GGCAGGGGCCCCAGGAACTGGGG + Intergenic
1163091151 19:15021294-15021316 GACAGGGGCTCTGGGAACGGAGG + Intronic
1163117586 19:15197721-15197743 GGGGGGGGGCGTGGGAACTGTGG - Intronic
1163282127 19:16324660-16324682 GGCAGCGGCCGTGGCCACTGCGG - Intergenic
1164972543 19:32544887-32544909 GCCAGGAGGCCTGGGAGCTGTGG - Intergenic
1165189572 19:34051379-34051401 GCCAGGGGCAGAGGGAAATGAGG + Intergenic
1165265992 19:34664223-34664245 GCCAGGGACCGTTGGCCCTGTGG - Intronic
1165398118 19:35578597-35578619 GCCAATGGCTGTGGGAAATGTGG - Intergenic
1165771364 19:38382245-38382267 GCAAGGGGCCGTGGGACCAAGGG + Intronic
1165993364 19:39828179-39828201 ATTAGGAGCCGTGGGAACTGAGG - Intronic
1166228238 19:41410682-41410704 GCCGAGGCCCCTGGGAACTGGGG - Exonic
1166703825 19:44897286-44897308 TCCAGGGACTGTTGGAACTGAGG - Intronic
1167071768 19:47226270-47226292 GCCCGCGGCCGCGGGGACTGAGG - Intronic
1167260006 19:48452954-48452976 ACCAGGAGCCCTGGGCACTGCGG - Exonic
926227010 2:10973916-10973938 GCCTGGGGGCGTGGGAGATGGGG - Intergenic
927463052 2:23315976-23315998 GACAGGGGCCATGGGAATAGTGG + Intergenic
927847051 2:26477061-26477083 GCCAGGGGCAGTGGGTAAGGGGG + Intronic
928124779 2:28607741-28607763 GCCAGGGACCGTGGATAGTGGGG + Intronic
928169819 2:28996064-28996086 GCCTGGGGCTGTGGGAACACAGG + Intronic
928370076 2:30734295-30734317 CCCAGGGTCAGTGTGAACTGGGG + Intronic
928413674 2:31073609-31073631 GCTAGGGGCCGGCGGGACTGGGG + Intronic
928948074 2:36789942-36789964 ACCAGGGGCAGTGGTAACAGAGG - Intronic
929231472 2:39564878-39564900 TCCAGGGGCCTAGGGATCTGGGG - Intergenic
929383838 2:41382126-41382148 GCCAGGAACAGTGGTAACTGTGG - Intergenic
929606591 2:43238879-43238901 GCCAAGAGCTGTGGGAGCTGGGG + Intronic
929932593 2:46270610-46270632 GCCAGGGGCTGTGTGGGCTGGGG - Intergenic
930762325 2:55050082-55050104 GGCAGGGGCGGTGGGCACTGGGG + Exonic
932363481 2:71130124-71130146 GACAGGGAGCGTGGGAACGGCGG - Intronic
932746733 2:74340027-74340049 GCCTGGGGCAGTGAGAAATGGGG + Intronic
933416952 2:81998390-81998412 GCCAGGGCCTGTGGACACTGGGG + Intergenic
933507631 2:83199148-83199170 GCCAGGGGGTGGGGGAACGGGGG - Intergenic
933781783 2:85807597-85807619 GCAAGGGGGCTGGGGAACTGAGG + Intergenic
934035737 2:88087348-88087370 GCCAGGTTCCGTGGGGTCTGGGG - Intronic
934544807 2:95206047-95206069 GCAAGGGGCTGTGGGTGCTGGGG + Intergenic
934971208 2:98765939-98765961 GCCTGGGGCTGGGGGTACTGGGG + Intergenic
936058669 2:109280342-109280364 GCCAGTGGCAGTGGGCTCTGAGG + Intronic
937547308 2:123038274-123038296 GCCAAGAGGTGTGGGAACTGAGG - Intergenic
937855534 2:126669966-126669988 GCCCAGGGCTGTGGGAACAGAGG + Intronic
938574708 2:132593172-132593194 TCCAAGGGTCGTGGCAACTGGGG + Intronic
938976090 2:136480135-136480157 GCCAGAAGCTGTGGGGACTGTGG + Intergenic
939591082 2:144064739-144064761 GTCAGGGGCAGAGAGAACTGTGG + Intronic
942860700 2:180607677-180607699 GGCAGGTGCCTTGTGAACTGTGG + Intergenic
946412593 2:219522634-219522656 GCCCGGGGCCGGGGGCACTGAGG - Intronic
947540382 2:230973349-230973371 GCCAGGAGCTGGGGGAAGTGGGG + Intergenic
947748012 2:232519422-232519444 GCGAGGTGCGGTGGTAACTGGGG + Intergenic
947994464 2:234515455-234515477 GCCAGGGGCCGAGGCAGCCGTGG + Intergenic
948641666 2:239379207-239379229 GCCAGGGGGAGTGGGCGCTGGGG + Intronic
948738234 2:240025135-240025157 GCCAGAGGCCGGGGGAGATGTGG + Intronic
1168745201 20:233365-233387 GGCAGGGGCTGTGGGGGCTGAGG + Intergenic
1168838480 20:893687-893709 GACAGGGGCGATGGGAGCTGAGG - Intronic
1169016608 20:2297811-2297833 GCCAGGTGCAGTGGGAAATATGG + Intronic
1170121443 20:12916837-12916859 GCCCTGGGCCCTGTGAACTGTGG + Intergenic
1170191705 20:13651243-13651265 GCCAGGTGCGGTGGGCACGGTGG - Intergenic
1170889904 20:20368183-20368205 GCAATGGGCCGGGGGCACTGAGG + Exonic
1171214641 20:23343302-23343324 GCCAGGGGCTGTGGGCAGGGAGG - Intergenic
1171344083 20:24452599-24452621 CCCTGGGGCAGAGGGAACTGTGG - Intergenic
1172042525 20:32055829-32055851 GCCAGGGGCCGGGGGAATGGGGG - Intronic
1172213132 20:33214850-33214872 GTCAGGAGCCGTGGGCTCTGGGG - Intergenic
1172881164 20:38200870-38200892 GCCAGGGGCCCTGGGAGTTCTGG - Intergenic
1173828393 20:46062258-46062280 GCCAGGGGATGAGGGGACTGGGG + Exonic
1174252521 20:49230362-49230384 GCCTGGGGCCCAGGGCACTGTGG + Intronic
1174404785 20:50296099-50296121 GCCAGGGGAGGTGGGCACGGGGG + Intergenic
1174406658 20:50307182-50307204 CCCAAGGGCTGTGGCAACTGTGG + Intergenic
1175288945 20:57860402-57860424 GCCAGGGACAATGGGAAATGAGG + Intergenic
1175389682 20:58619139-58619161 GGCAGGGGCAGAAGGAACTGGGG + Intergenic
1175816412 20:61885308-61885330 GCCAGGGGCTGGGGGAGCTGGGG - Intronic
1175823856 20:61925958-61925980 GCAAGGGGCGCTGGGAAATGGGG + Intronic
1175898398 20:62350343-62350365 GCCAGGAGCTGTGGGCCCTGGGG - Intronic
1175988186 20:62774683-62774705 GGCAGGGGCTGAGGGGACTGTGG + Intergenic
1176081037 20:63273085-63273107 GCCCAGCGCCGAGGGAACTGGGG - Intronic
1176976274 21:15326246-15326268 GCCAGGGTCTGGAGGAACTGAGG - Intergenic
1177504027 21:21998144-21998166 GCCAGGGGATGTGGGAAGGGTGG + Intergenic
1178297709 21:31424622-31424644 GCCAGGGGCTGGGGGAGCAGAGG + Intronic
1178914930 21:36700863-36700885 GCCAGGGGCGCTGGGACCCGCGG + Intronic
1179168606 21:38955267-38955289 GCCAGGGGCTGTAGGGAATGGGG + Intergenic
1179489431 21:41730604-41730626 GCCAGGGGCTGGGGGAGGTGTGG - Intergenic
1179716426 21:43291067-43291089 GGCACGGGCCGTGGGCACCGTGG - Intergenic
1179992044 21:44953250-44953272 TTCAGGGGCCCTGGGCACTGTGG + Intronic
1181236572 22:21450799-21450821 GGCATGAGCGGTGGGAACTGAGG + Exonic
1181466249 22:23112238-23112260 GCCTGGGGCTGTGGCAGCTGGGG - Intronic
1181765998 22:25092595-25092617 GCCAGTGGCAGTGGGGACTTGGG + Intronic
1181939564 22:26464685-26464707 GTCAGGGGATGTGGGATCTGGGG + Exonic
1183700488 22:39448370-39448392 CCCAGGGGCCGTGAGGACAGAGG + Intergenic
1183717533 22:39542424-39542446 GCCAGGGGCCGTTTGGAATGTGG + Intergenic
1183931420 22:41238043-41238065 GCCAGGGGCCGCGGCGCCTGCGG - Exonic
1184120085 22:42444483-42444505 GCCAGGGGCCGTGGGGACCCAGG - Intergenic
1184785235 22:46668433-46668455 GCCAGGGGCGGTGGGGAGGGAGG - Intronic
1184942955 22:47782283-47782305 GCCAGGGGCAGTGTGGAGTGGGG + Intergenic
1185014233 22:48334041-48334063 GCCAGGGTCCCTGGGAGCGGTGG - Intergenic
1185137040 22:49079105-49079127 GCCACGGGCAGAGGGAGCTGGGG - Intergenic
1185137361 22:49080396-49080418 GCAAGGGGCTGTGGGATGTGAGG - Intergenic
1185373750 22:50472739-50472761 ACCAGGGCCGGTGGGAGCTGGGG - Intronic
1185415088 22:50705361-50705383 GCCAGGGGCTGGGGGAACGCCGG - Intergenic
950090595 3:10291664-10291686 TCCTGGGGCCGAGGGAAATGAGG - Intronic
950179579 3:10901594-10901616 GGCAGGGCCAGTGGGAACAGTGG - Intronic
950580485 3:13858666-13858688 GTCAGGGGCAGTGGGTGCTGAGG - Intronic
950640574 3:14345782-14345804 GCCAGAGGCCGTGGGATCCTGGG - Intergenic
954379754 3:50213238-50213260 GCCTGGGGCCCTAGGAAATGGGG + Intronic
957089770 3:75718145-75718167 GCCAGGGGACAACGGAACTGAGG + Intronic
959040303 3:101414642-101414664 GCCAGTGGCCATGGGGGCTGAGG + Intronic
959663525 3:108896148-108896170 GCCAGGGGCTGTGGGGTCCGGGG + Intergenic
961561224 3:127731721-127731743 GCCAGAGGGAGAGGGAACTGTGG - Intronic
961580323 3:127875549-127875571 GCCAGGGGCTATGTGAAATGTGG - Intergenic
962062603 3:131946179-131946201 GTCAGGGGCTGGGGGAAGTGAGG - Intronic
962343895 3:134606128-134606150 ACCAGGGGCCGTGAGCAGTGAGG - Intronic
962398945 3:135040686-135040708 GCCAGGGGTTGTGAGAACTCAGG + Intronic
962451780 3:135524986-135525008 GCCAGGGGCTGTGAGAAAAGAGG + Intergenic
963081836 3:141402225-141402247 GCCCGGGGCTGGGGTAACTGCGG - Intronic
963822702 3:149915825-149915847 GCCAGGGACTGAGGGGACTGAGG + Intronic
964732613 3:159883365-159883387 GACAGAGGCCCGGGGAACTGTGG + Intronic
965397357 3:168175088-168175110 GCCCGGGGCCTAGGGAACTGTGG - Intergenic
966154796 3:176903882-176903904 GCCAGAGGCCATGTGAACTTTGG - Intergenic
968089272 3:195890014-195890036 GGCAGGGCCACTGGGAACTGTGG - Intronic
968299061 3:197599488-197599510 GCCAAGTGCCTTGGGATCTGAGG + Intergenic
969530986 4:7730022-7730044 GCCAGGAGCACTGGGAAATGAGG + Intronic
969621914 4:8282944-8282966 GCTCGGGGCAGTGGGAACCGGGG + Intronic
969798384 4:9543498-9543520 AGCAGGGGCTGTGGGGACTGGGG - Intergenic
969838155 4:9860273-9860295 GGCAGGGGCTGTGGGAACAGAGG - Intronic
971841837 4:31862453-31862475 GCCAGGTGCAGTGGTGACTGTGG - Intergenic
972709560 4:41581444-41581466 GCCAGGGGCTGTGGGAAATAGGG - Intronic
973809943 4:54559820-54559842 TGCAGGGGCTCTGGGAACTGAGG - Intergenic
976103641 4:81593120-81593142 GCAATGGGCAGTGGGCACTGAGG + Intronic
980982605 4:139667443-139667465 GCAGGGGGCTGTGTGAACTGGGG + Intronic
984552323 4:181175496-181175518 TCCAGGGGCTGGGGGAAATGGGG - Intergenic
984593855 4:181645372-181645394 GGCAGGGGTCCTGGGAACTCAGG + Intergenic
985081484 4:186269581-186269603 GCCAGGGGCCGAGGGGCCAGGGG + Intronic
985423347 4:189805684-189805706 GCAAGGTGCCGCGGGCACTGAGG + Intergenic
985538060 5:475463-475485 ACCAGGGGCACTGGGACCTGGGG - Intronic
985962759 5:3315286-3315308 GCCAGGGACTGGGGGAACGGAGG - Intergenic
986002721 5:3642828-3642850 GGGAGGGGCTGTGGGAAATGAGG + Intergenic
986398420 5:7354487-7354509 GCCAGGGGTTGGGGGAAGTGGGG - Intergenic
987828831 5:23069375-23069397 GCCATGGGCCAAGGGAACTATGG + Intergenic
990447838 5:55909050-55909072 GCCAGGGGCTGTGGGAGGAGAGG - Intronic
991653042 5:68875508-68875530 GCCAGGGGGCGTGGTGTCTGTGG - Intergenic
992966471 5:82006751-82006773 GCCAGGGGCTGTGGGGATTCTGG - Intronic
993022168 5:82605196-82605218 GCCAGGGGGCGGGGGAAGTGGGG - Intergenic
995788060 5:115852624-115852646 GCCAGGGACAGTGGGGAGTGGGG - Intronic
995911810 5:117196602-117196624 GCGAGGGGTTGTGGGGACTGGGG + Intergenic
1002537690 5:179886685-179886707 GGCAGCGGGCGTGGGAGCTGGGG - Intronic
1002618463 5:180469725-180469747 GCCAGGGGCGGTGGGGAGGGGGG - Intergenic
1003455553 6:6278550-6278572 GCCTGGGGCAGAGGGAATTGTGG + Intronic
1004020810 6:11774469-11774491 GCCTGGGGCTGGGGGAACAGAGG - Intronic
1005346947 6:24900170-24900192 GGCAGTTGCTGTGGGAACTGTGG + Intronic
1005866213 6:29939343-29939365 GCCAGGGGCCGCAGCATCTGAGG - Intergenic
1006739211 6:36295290-36295312 GCCCTGGGTCGGGGGAACTGTGG + Intronic
1007216938 6:40247748-40247770 GCCAAGGGCAGTGGGGTCTGAGG - Intergenic
1007747355 6:44051370-44051392 GCCTGAGGCCCTGGGACCTGGGG + Intergenic
1008138001 6:47799645-47799667 GGCTGGGGCCCTGGGAAGTGAGG + Intronic
1008644134 6:53496003-53496025 GCCAGGGGGAGGGGGACCTGTGG - Intergenic
1008934119 6:56971134-56971156 GCCAGGGGCTAGGGGAAGTGAGG - Intronic
1010302946 6:74282686-74282708 GCCAGTGGCCATCGGGACTGAGG + Intergenic
1013373975 6:109496331-109496353 GCCAGGAGGCGAGGGACCTGAGG - Intronic
1014115059 6:117661234-117661256 GCCAGGAACAGTGGTAACTGTGG + Intergenic
1015776326 6:136818450-136818472 GCCAGGGGCAAGGGGAAGTGGGG - Intergenic
1017432870 6:154388168-154388190 GCCAGGGGCTGAGGGGAGTGGGG - Exonic
1018427697 6:163698395-163698417 GCAAGGGGGCCTGGGAAGTGTGG + Intergenic
1018854698 6:167667079-167667101 GCCAGGGGCTGTGGGAGGGGAGG + Intergenic
1019136033 6:169908131-169908153 GCCAGGGGCCCTGGGGACCGGGG + Intergenic
1019338377 7:495664-495686 GCCAGGGGTCATGAGAGCTGGGG - Intergenic
1019404607 7:876994-877016 GTCAGAGGCCGAGGGAACGGGGG - Intronic
1019838500 7:3414747-3414769 GCCAGGGGCTGGGGGAATGGAGG - Intronic
1020383133 7:7567255-7567277 GCGGGCGGCCGTGGGACCTGCGG + Intronic
1020975369 7:14999588-14999610 CACAGGGGCCGTGGGGCCTGGGG - Intergenic
1024565019 7:50673678-50673700 GCCAGGGGTCGTGGGGGCAGTGG - Intronic
1024968804 7:55050249-55050271 GCCAGGGGCTGGGGGAACGGAGG - Intronic
1026079610 7:67205907-67205929 GCTAGGGGCCTTGGGATCTGAGG - Intronic
1026697238 7:72606075-72606097 GCTAGGGGCCTTGGGATCTGAGG + Intronic
1027055780 7:75048460-75048482 CTCAGGGGCCGTGAGACCTGGGG + Intronic
1027187566 7:75981215-75981237 GGCAGGGGCCGTGGAACGTGAGG + Intronic
1028358242 7:89935784-89935806 GCCAGGGGCTGAGGTAAATGGGG - Intergenic
1030873306 7:114783723-114783745 TCCTGGGGCAGTGGGAAGTGAGG + Intergenic
1031997529 7:128242375-128242397 GCCATGGGCAGCTGGAACTGGGG + Intronic
1033332496 7:140428161-140428183 TCCAGGGTCCCAGGGAACTGTGG + Intergenic
1033686329 7:143644408-143644430 GGCAGATGCCGTGGGAACTGTGG - Intronic
1033689409 7:143722907-143722929 GGCAGATGCCGTGGGAACTGTGG + Intronic
1033698284 7:143813213-143813235 GGCAGATGCCGTGGGAACTGTGG + Intergenic
1034269380 7:149796269-149796291 GGGAGGGGCCGTGAAAACTGGGG + Intergenic
1034656199 7:152731390-152731412 GCCCGGGGCCTCGGGTACTGTGG + Intergenic
1035266253 7:157691773-157691795 GCCAGGGGCCGGGGGTTATGTGG - Intronic
1035589712 8:803104-803126 GCCAGGAGCCGTGGGAGCCACGG - Intergenic
1037250907 8:16893089-16893111 GCTAGAGGCTGAGGGAACTGGGG - Intergenic
1037430185 8:18803757-18803779 GCCAGGGGCTGGGGGAAAGGAGG + Intronic
1037772745 8:21812022-21812044 GCCAGGGGCTGGGGGGAGTGCGG - Intronic
1038634424 8:29273865-29273887 GGTGGGGGCAGTGGGAACTGGGG + Intergenic
1039630893 8:39109893-39109915 GCCAGGGGCAGTGGGGAGGGAGG - Intronic
1042175908 8:66036879-66036901 GCCTGGGGCAGGGGGACCTGTGG + Intronic
1042556149 8:70035114-70035136 GTCAGGGGCACTGGGAACGGAGG - Intergenic
1044689089 8:94859138-94859160 GCCAGGTGTGGTGGGACCTGTGG + Intronic
1045008381 8:97936108-97936130 GCCAGGTGCCCTGTGAATTGAGG + Intronic
1046931654 8:119847486-119847508 GCCAGGGGCTGAGGGGACAGGGG + Intronic
1048330350 8:133466692-133466714 TGCTGGGGCCGGGGGAACTGAGG - Intronic
1048989868 8:139754980-139755002 GCCAGGGGCCCTGGGAAGGACGG + Intronic
1049219312 8:141421642-141421664 GGCAGTGGCCGTGGGGACAGCGG - Exonic
1049247656 8:141571355-141571377 GGCAGGTGCCATGGGAGCTGGGG - Intergenic
1049255447 8:141611290-141611312 TCCAGGGGCCGTTGGCTCTGGGG + Intergenic
1049709164 8:144055993-144056015 GCCTGGGGCCGTGGCATCTCTGG - Intronic
1049744482 8:144257442-144257464 GACAGGGGCTGTAGGAGCTGAGG - Intronic
1049769193 8:144372020-144372042 GGCAGGGGCTGTGGGCACTTGGG + Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1052552583 9:29969953-29969975 GCCTGGTGCCATGGGCACTGTGG - Intergenic
1053504227 9:38627469-38627491 GCCTCTGGGCGTGGGAACTGTGG + Intergenic
1054816849 9:69483820-69483842 GCCAGGGGCTGTGGGGTCTGGGG - Intronic
1057152149 9:92806147-92806169 GCCTCTGGACGTGGGAACTGTGG - Intergenic
1057152472 9:92808049-92808071 GCCAGGGGCCGCGGGGACCTGGG - Intergenic
1057221895 9:93261946-93261968 GCCAGGGAGCTGGGGAACTGAGG - Exonic
1057592322 9:96383444-96383466 GCCCGGGGCCGGGGGGTCTGCGG - Intronic
1057596231 9:96418046-96418068 GCCCGGGGCCGCCGGAGCTGGGG - Exonic
1057699248 9:97350811-97350833 GCCAGGGGCCATGGGGAAGGAGG - Intronic
1058121591 9:101145115-101145137 ACCAGGGGCTGAGGGGACTGAGG + Intronic
1058971043 9:110083186-110083208 GCTAGGGGCTGGGGGAAGTGAGG - Intronic
1059460932 9:114429592-114429614 GCCAGGGCCCCTGAGAACTTCGG + Intronic
1060767590 9:126306705-126306727 GGAAGGGGCTGTGGGAAATGTGG + Intergenic
1060941449 9:127545286-127545308 GCCAGGGGCTGTGGGAGTGGAGG - Intronic
1061312857 9:129775328-129775350 GGCAGGGGCCGTGGCTTCTGGGG - Intergenic
1061453785 9:130682656-130682678 GGCAGGGACCGAGGGAAGTGTGG - Exonic
1062468280 9:136691104-136691126 GCCAGGGCACGTGGGACCTTGGG + Intergenic
1062474491 9:136720429-136720451 GCCAGGCTCCATGGCAACTGAGG + Intronic
1062554126 9:137106384-137106406 AGCGGGGGCCGTGGGAGCTGGGG - Intronic
1062611821 9:137378898-137378920 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062611842 9:137378965-137378987 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062611861 9:137379032-137379054 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062611900 9:137379166-137379188 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062611922 9:137379234-137379256 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062611943 9:137379301-137379323 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062611964 9:137379369-137379391 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062612006 9:137379504-137379526 GCCTGGGGCCGAGGGGAATGGGG + Intronic
1062719903 9:138034696-138034718 GCTAGGGACCTTGGGACCTGAGG - Intronic
1203761555 EBV:14970-14992 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1203762484 EBV:18042-18064 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1203763413 EBV:21114-21136 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1203764342 EBV:24186-24208 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1203765271 EBV:27258-27280 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1203766200 EBV:30330-30352 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1203767129 EBV:33402-33424 GCCCGGGGACTAGGGAACTGAGG - Intergenic
1186583803 X:10850053-10850075 TCCAGGAGCCATGGGAACTAAGG + Intergenic
1186589351 X:10913474-10913496 GCTAGGGACCTTGGGACCTGAGG - Intergenic
1187508441 X:19896258-19896280 GTCAGGGGCTGGGGGAATTGAGG + Intergenic
1188552106 X:31375694-31375716 GCCAGGGGCTGGGGGAAAGGAGG + Intronic
1189110091 X:38280427-38280449 GGAAGGAGCCATGGGAACTGGGG + Intronic
1189349710 X:40267335-40267357 GCCAGCGGCACTGGGATCTGGGG - Intergenic
1190260156 X:48792325-48792347 GCCAGGGAGTGTGTGAACTGCGG + Exonic
1190285530 X:48958519-48958541 GACAGGCGCCGTGGGGACAGTGG + Intergenic
1190359700 X:49637229-49637251 GCCAGGGGCTGAGGGGAGTGGGG + Intergenic
1190472184 X:50793275-50793297 GCCAGGGGGAGAGGGAAATGGGG + Intronic
1195664143 X:107413230-107413252 GCAAGAAGCCGTGGGAAGTGTGG + Intergenic
1195705777 X:107737159-107737181 TCCAGGGGCCCTGGGAGCCGTGG - Intronic
1198232570 X:134705958-134705980 GCTAGGGACCTTGGGAACTGAGG + Intronic
1198293009 X:135257046-135257068 GCCATGGGCCTTGGGCTCTGAGG + Intronic
1199268496 X:145855731-145855753 GCCAGGGGCTGGGGGGACGGGGG + Intergenic
1199741192 X:150738138-150738160 GTCAGGGGCTGGGGGAAGTGAGG - Intronic
1200142861 X:153910451-153910473 GCCAGGGGTCGAGGGGACAGGGG - Intronic