ID: 1133222175

View in Genome Browser
Species Human (GRCh38)
Location 16:4323485-4323507
Sequence GGGGCCCGGAGCCACCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 291}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133222175 Original CRISPR GGGGCCCGGAGCCACCAGGA TGG Intronic
900174329 1:1285150-1285172 GGGGCCTGGGGACACCAGGTGGG - Intronic
900299249 1:1968925-1968947 CAGGACCGGAGCCCCCAGGAGGG - Intronic
900481434 1:2901355-2901377 GGGTCCTGGAGCCCTCAGGAAGG - Intergenic
900522693 1:3113302-3113324 GGGGCCCGGAGGAGACAGGACGG + Intronic
900584219 1:3424748-3424770 GGGGCCCCCAGCCACCTCGAGGG + Intronic
902113530 1:14102643-14102665 GGGCCCTGAAGGCACCAGGATGG - Intergenic
902836936 1:19053541-19053563 GAGGCCAGGAGCCGGCAGGAGGG - Intergenic
903071712 1:20730101-20730123 GGGGCCAGGATCGGCCAGGATGG + Intronic
903168953 1:21540388-21540410 GGGTCCCTGAGGCTCCAGGACGG - Intronic
903235724 1:21949423-21949445 GGGTCCCTTAGCCAGCAGGATGG + Intergenic
903420852 1:23217195-23217217 GGGCCCCCGAGGCCCCAGGAGGG + Intergenic
904162247 1:28530608-28530630 CGGGCGCGGAGCCACCTGGTCGG - Exonic
904343124 1:29850964-29850986 GGGTCACTGAGCCAGCAGGATGG + Intergenic
904444054 1:30553302-30553324 GGGGCACAGAGCTCCCAGGAAGG - Intergenic
904746968 1:32717318-32717340 GGGGCAGTGAGTCACCAGGAAGG - Intergenic
905905916 1:41618462-41618484 GCTGCCAGGAGCCACAAGGATGG - Intronic
906641487 1:47443556-47443578 GAGGCCCGAGGCCACAAGGAAGG + Intergenic
907040119 1:51251422-51251444 GGGGCCCGGAGGCCCTGGGATGG - Intronic
908017302 1:59856829-59856851 GAGGCCCTGAGCAAACAGGAAGG - Intronic
914916510 1:151822519-151822541 GGGTGGCGGAGGCACCAGGAGGG - Intronic
915553952 1:156651026-156651048 AGGGGCTGGAGCCAGCAGGATGG - Intronic
916147092 1:161749800-161749822 CGGGCCCGGAGCCTCCAACATGG - Exonic
919765547 1:201124911-201124933 GAGGGCCTCAGCCACCAGGAGGG - Intronic
920535191 1:206732549-206732571 GGGGCACGGCAGCACCAGGAAGG - Intronic
920822708 1:209396220-209396242 GGGGCCAGGGGTCAGCAGGAGGG + Intergenic
920964481 1:210690736-210690758 GAGGCCCTGAGCCTCGAGGAGGG + Intronic
921049459 1:211500799-211500821 GGGGGCAGGAGCCACAGGGAAGG - Intergenic
921070904 1:211656839-211656861 GAGGCCCTGAGCCACCACGCAGG - Intergenic
922573419 1:226646812-226646834 GGTGCGGGGAGCCACCAGGTAGG - Intronic
923749595 1:236735287-236735309 GAGGACCGGAGTCACGAGGAAGG + Intronic
1067860598 10:49843563-49843585 TGGTCCCGGAGCCACGAAGATGG - Exonic
1069928609 10:71868262-71868284 GGGGCCCGAAGGCCCCAGGAGGG - Intergenic
1070813823 10:79311374-79311396 GGGGACAGGAGCCAGCAGGGTGG - Intronic
1074995577 10:118754759-118754781 GGTGCCGGGGGCCAGCAGGATGG - Exonic
1075191672 10:120315335-120315357 GAGGCCTGGAGTCACCAAGAGGG - Intergenic
1076504793 10:130964482-130964504 GGAGCATGGAGCCGCCAGGAAGG - Intergenic
1076565538 10:131396312-131396334 GGGGACTGGAGCCATCAGGAGGG + Intergenic
1076841199 10:133046442-133046464 GGGGCCCAGGACCACCAGCATGG - Intergenic
1077017824 11:404709-404731 AGGGTCCTGGGCCACCAGGAGGG + Exonic
1077332091 11:1988263-1988285 TGGGCACGGAGCCAGCAGGGGGG - Intergenic
1077540603 11:3144852-3144874 GGCACCCGGATCCTCCAGGATGG + Intronic
1079451245 11:20601446-20601468 CGGGCCCGGAGCTCCCGGGAGGG - Exonic
1080898119 11:36462683-36462705 GGGGCCAGGGGCAGCCAGGAGGG + Exonic
1083633763 11:64109229-64109251 AGGGCCAGGAGCCAGCAGCAGGG + Intronic
1084404035 11:68960786-68960808 GGGGCCCGGATCTGCCAGGCGGG - Intergenic
1084492634 11:69486984-69487006 GGGGCCAGGACCCCCCAGCACGG - Intergenic
1085273116 11:75281961-75281983 GGGGCCCGAAGACACGGGGAAGG - Exonic
1085446583 11:76604815-76604837 GGGAGCAGGAGCCCCCAGGAAGG + Intergenic
1085524406 11:77155920-77155942 GGGGTTCACAGCCACCAGGATGG - Exonic
1086293389 11:85336623-85336645 GGGGTCCTGAGCCAGGAGGAGGG + Intronic
1089363962 11:117909747-117909769 AGGGTCGGGAACCACCAGGAAGG - Intronic
1089732820 11:120529998-120530020 AGGCCACTGAGCCACCAGGAAGG - Intronic
1089790862 11:120942497-120942519 GGGCCACTGAGTCACCAGGAAGG - Intronic
1090349798 11:126100781-126100803 GGAGCACAGAGACACCAGGAGGG + Intergenic
1090387229 11:126364272-126364294 GGGACCAGGAGACACCAGGATGG + Intronic
1090389793 11:126381470-126381492 GGGACCAGGAGACACCAGGATGG + Intronic
1090660802 11:128880466-128880488 GGGGCCTGGGGACACCAGAAAGG + Intergenic
1091286870 11:134412584-134412606 GGCGCCAGGAGCAGCCAGGATGG - Intergenic
1091327456 11:134701745-134701767 GGGGCCCCGAGGCAGCAGAATGG + Intergenic
1202815072 11_KI270721v1_random:43439-43461 TGGGCACGGAGCCAGCAGGGGGG - Intergenic
1098181432 12:67850830-67850852 GGGTCCCTGAGCCACCATGCAGG + Intergenic
1098204461 12:68093382-68093404 AGGGCCCTGAGCCACCAGACAGG + Intergenic
1100618491 12:96249858-96249880 GGAGCCAGAAGCCACCAGCATGG + Intronic
1102527242 12:113520649-113520671 AGTGCCAGGAGCCTCCAGGAGGG - Intergenic
1102931163 12:116863383-116863405 GGGACCTGGAGTCTCCAGGAGGG - Intronic
1103848229 12:123914557-123914579 GGCACCCTGAGCCAGCAGGAGGG + Intronic
1104666459 12:130650524-130650546 GGGACACGGAGCCCCCAGGTGGG - Intronic
1104901591 12:132192222-132192244 GGGGCTCGGAGCAGCCAGTACGG - Intergenic
1104929513 12:132330155-132330177 GGGCCCTGGAGCCACCAGGAGGG + Intergenic
1104958453 12:132477067-132477089 GGAGCCGGGAGCCACCTGGAGGG - Intergenic
1105803660 13:23935756-23935778 GGGGCCCTGAGCCACTAGATAGG - Intergenic
1106138402 13:26991400-26991422 GGTGCCAGGAGACCCCAGGATGG - Intergenic
1107194875 13:37638225-37638247 GGGGCAGGAAGCCACCAAGAAGG - Intronic
1110808895 13:79790744-79790766 GGAGCCCGGATCCACTAGGGTGG + Intergenic
1113878000 13:113606581-113606603 GGGGCACACAGCCTCCAGGAAGG - Intronic
1114367097 14:22040904-22040926 GAGGCCCTGAGACTCCAGGAGGG + Intergenic
1115813969 14:37142623-37142645 AGGGCCATGAGCCACCATGATGG + Intronic
1118843033 14:69526952-69526974 GGGGGATGGAGCCACCACGAGGG + Intronic
1119654588 14:76408076-76408098 GGGGCCCTGAGTCAACAGGCGGG + Intronic
1121410503 14:93745579-93745601 GGGGGCCTGAGCCAGGAGGAAGG - Intronic
1121447188 14:93986690-93986712 GGGGCCCTGAGCTTCCTGGAAGG - Intergenic
1121583746 14:95048916-95048938 GGGGCCAGGAGCCACAAGTGTGG - Intergenic
1121626010 14:95385881-95385903 GGGGGATGGAGCCACCAGGAAGG - Intergenic
1122116874 14:99532136-99532158 GGGGCCAGGATCCACAAGGGTGG + Intronic
1123132684 14:106000571-106000593 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132721 14:106000729-106000751 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132745 14:106000810-106000832 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132788 14:106000988-106001010 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132812 14:106001069-106001091 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132836 14:106001150-106001172 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132860 14:106001231-106001253 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132884 14:106001312-106001334 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123132908 14:106001393-106001415 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123582935 15:21731839-21731861 GGTGCACAGAACCACCAGGAGGG - Intergenic
1123619585 15:22174435-22174457 GGTGCACAGAACCACCAGGAGGG - Intergenic
1124005456 15:25792415-25792437 AGGTCCCATAGCCACCAGGAGGG + Intronic
1124637336 15:31373580-31373602 GTGGCCTGGAGCCTCCAGGCAGG - Exonic
1125191797 15:37002235-37002257 GGGGGCTGGAGCCAGCAGGACGG - Intronic
1125676712 15:41505932-41505954 GGGGACTGGAGTCCCCAGGAAGG + Exonic
1129193474 15:73951209-73951231 GGCGCCTGGAGCAGCCAGGAGGG + Intronic
1129217041 15:74106498-74106520 AGAGCCCAGAGCCAACAGGATGG - Intronic
1129465238 15:75721151-75721173 GCGTCCTGGAGCCAGCAGGAGGG + Intergenic
1132386168 15:101401529-101401551 GAGCCTCGGAGCCAGCAGGAGGG + Intronic
1132648455 16:1009845-1009867 GGCGCTCGGAGTCCCCAGGAAGG + Intergenic
1133222175 16:4323485-4323507 GGGGCCCGGAGCCACCAGGATGG + Intronic
1136016803 16:27405837-27405859 GGGGGCAGGGGCCACAAGGAGGG + Intronic
1136933487 16:34437790-34437812 GGGGCCCGGAGCCAGGACGCCGG - Intergenic
1136971085 16:34974024-34974046 GGGGCCCGGAGCCAGGACGCCGG + Intergenic
1137559381 16:49493035-49493057 GGGACCCAGAGGCACCAGGCAGG + Intronic
1138449426 16:57084590-57084612 GGGGCCAGGAACAACCTGGAGGG - Intergenic
1138508932 16:57496786-57496808 GGGGCCCTGAGGTTCCAGGAAGG - Intergenic
1139653861 16:68375904-68375926 GGGACCTGGAGTCACTAGGAGGG - Intronic
1139666530 16:68460748-68460770 GAGACCAGGAGCCACCATGATGG - Intergenic
1140808502 16:78554979-78555001 GGGGCCCGGATAAACCAGCAGGG + Intronic
1141611140 16:85181802-85181824 GAGGCCAGGAGGCACCTGGATGG + Intronic
1141628885 16:85276211-85276233 TGGGCTGGCAGCCACCAGGAGGG - Intergenic
1141665420 16:85463038-85463060 GGGACCCGGGGCCTCTAGGAGGG - Intergenic
1142202986 16:88769986-88770008 GGGGTCCCGAGCCTCCAGGTTGG - Intronic
1142231063 16:88900534-88900556 GGGACCCGGGGCAAGCAGGACGG + Intronic
1142283412 16:89160936-89160958 AGTGCCCGGAGCCAGCAGGGCGG - Intergenic
1142284051 16:89164483-89164505 GGAGCCCTGATCCCCCAGGACGG + Intergenic
1142504841 17:356781-356803 TGGGCCCGGAGACACCAGGCCGG + Intronic
1143859564 17:9878661-9878683 GGGTGCAGGAGCCACCAGGACGG - Intronic
1144873978 17:18387414-18387436 GGGGCCAGGTGGCACCAGGGAGG - Intronic
1148764368 17:50028656-50028678 GGGGCCAGGAGGCACATGGAGGG - Intergenic
1148862060 17:50609646-50609668 GGGGCAGGGAGGCACCGGGAGGG - Intronic
1150581714 17:66480279-66480301 GGGGCCAGGAGCCTCCAAAAAGG - Intronic
1151422811 17:74009655-74009677 GGGGCCCGGAGGAAGGAGGAGGG + Intergenic
1151966247 17:77433324-77433346 TGGGGCAGGAGCCACCAGGTCGG - Intronic
1152312273 17:79558558-79558580 GGGGCCCGAAGCCACCTTGGAGG - Intergenic
1152640498 17:81447354-81447376 GGGGCCCCCTGCCTCCAGGAGGG - Exonic
1152821323 17:82439240-82439262 GGGGCCCGGAGGCCCTAGGAGGG + Intronic
1152862862 17:82705852-82705874 GCCGGCGGGAGCCACCAGGACGG - Intergenic
1152870693 17:82751721-82751743 GGGGCCGGGGGCCGCCAGGGCGG - Intergenic
1153994183 18:10425552-10425574 GGGGCCAGCAGGTACCAGGAAGG - Intergenic
1155073864 18:22338512-22338534 GGGTCCCGGAGCCTGCAGGTGGG + Intergenic
1155928692 18:31684690-31684712 GGGGCCCGGGGACGGCAGGACGG + Exonic
1156460080 18:37316677-37316699 GTGGCCTGGAGCAAGCAGGAAGG - Intronic
1157582380 18:48781165-48781187 GGAGCCAGGAGGCACTAGGAGGG - Intronic
1157592413 18:48843556-48843578 GGGGCCCTGAGGCACGGGGAAGG + Intronic
1157626117 18:49052634-49052656 GGGGCCCTGGGCCACCAAGAGGG - Intronic
1159045711 18:63367134-63367156 GGGGCCCGGAGCGGCCGGGCGGG + Exonic
1160510032 18:79448266-79448288 GGGGCAGGGAGCCATCAGGAAGG + Intronic
1160797430 19:952545-952567 CGAGCCCTGAGCCTCCAGGAGGG - Intronic
1160833470 19:1113796-1113818 GGGGCCCGGGGCAACCCTGAGGG + Intronic
1160903737 19:1442168-1442190 GGGGCCCGTAGCCAGTGGGACGG + Intergenic
1161024976 19:2032560-2032582 GGGGCTCGGTGCCACCCGGGAGG + Intronic
1161398588 19:4058013-4058035 GGGGCTCTGAGTCAGCAGGAAGG + Intronic
1161584085 19:5095762-5095784 AGGGCCCGGAGCAGCCAGGTCGG + Intronic
1161883213 19:6972243-6972265 GGGGGCAAGAGCCACGAGGACGG + Intergenic
1162043566 19:7984712-7984734 GGTGCCTGGAGGCAGCAGGAAGG + Intronic
1162128426 19:8511586-8511608 GGGGTCGGGGGCCTCCAGGAGGG - Intronic
1162560777 19:11417048-11417070 GGGGCTGGGAGCCTGCAGGAGGG + Exonic
1165894887 19:39135768-39135790 GGGGCCGGGAGCCTCCAGCCCGG - Intronic
1166518323 19:43463451-43463473 GGGGCCAAGAGGCAGCAGGAGGG - Intronic
1166641732 19:44499793-44499815 GGGGCCCAGAGCCACCTGCTCGG + Intronic
1166732056 19:45064595-45064617 GGGGCCCGTAACCACCACGCCGG - Exonic
1166735233 19:45080005-45080027 GAGCACCGGGGCCACCAGGAGGG + Exonic
1166846819 19:45733609-45733631 GGGGCCCGGAGAAACCAGAACGG + Exonic
1167094510 19:47367170-47367192 GGGGCCCTGAGTGATCAGGAGGG - Intronic
1167151588 19:47713390-47713412 GGGGCCCGGAGCGGGGAGGACGG - Exonic
1167620358 19:50556872-50556894 GGGCCCCGGAACGTCCAGGAGGG + Intronic
1167636317 19:50658148-50658170 GGGGCCTGGAGCGAGCGGGAGGG + Intronic
1168413621 19:56155462-56155484 GGGGCCCTGGGCCACCCGGGTGG - Intronic
1168414464 19:56159729-56159751 GGTGCCCGGGGCCGCTAGGAAGG - Exonic
925176686 2:1789717-1789739 GGGGCCCTGGGCCACACGGACGG + Intronic
926934392 2:18072581-18072603 GGGGCCAGGAGCCCAGAGGAGGG - Intronic
929571711 2:43026952-43026974 GGGGCCTGAAGCCAGCAGGGTGG - Intergenic
931764594 2:65443705-65443727 GATGCCAGGAGCTACCAGGAGGG + Intergenic
932332129 2:70903788-70903810 CGGGCCCAGAGCCAGAAGGAGGG - Intronic
932405005 2:71506932-71506954 AGGGCCCAGAGCAACCCGGATGG + Intronic
932524603 2:72450900-72450922 GGAGCCAGGTTCCACCAGGAAGG + Intronic
932777260 2:74535721-74535743 GGGGGCCGCAGCCAACATGAGGG - Exonic
933695796 2:85216238-85216260 GCTGCCCGGAGCCACGGGGAAGG - Intronic
935198308 2:100834120-100834142 GAAGCACTGAGCCACCAGGAAGG - Intronic
935631659 2:105217130-105217152 GCGGCCTGGAGCTCCCAGGAAGG + Intergenic
938098244 2:128477146-128477168 GAGGCACTGAGCCCCCAGGATGG - Intergenic
938584768 2:132679378-132679400 GGGGCCCAGAGACTCCAGGAGGG + Intronic
940481960 2:154244367-154244389 GGGGTCCAGAGTCACCAAGAAGG + Intronic
946109157 2:217398962-217398984 GGGGCCAGCAGCCAGCAGCAGGG - Intronic
946359275 2:219209381-219209403 GAGGCCCGGAGCACCCTGGAGGG + Exonic
948682946 2:239648728-239648750 GGGGCCCACTGACACCAGGATGG - Intergenic
948735685 2:240003403-240003425 AGGGCCTGGAGGCACAAGGATGG - Intronic
948902768 2:240964667-240964689 GGAGCCGGGACCCACCAGGCGGG - Intronic
1170567645 20:17615896-17615918 GGGGCTGAGAGCCACCAGGCAGG + Intronic
1171201310 20:23244652-23244674 GGCGCCCTGGGCCACCTGGAGGG + Intergenic
1171201460 20:23245278-23245300 GTGGGCAGGAGCCATCAGGACGG - Intergenic
1171439241 20:25147759-25147781 GGGGTCTGGAGCCACAGGGACGG - Intergenic
1172310680 20:33915963-33915985 GGAGGCCAGAGCCAGCAGGAAGG - Intergenic
1172799250 20:37564684-37564706 GACGCCCAGAGCCCCCAGGAAGG + Intergenic
1172843406 20:37915435-37915457 GGGGCCCGGAGCCTTGAAGAAGG + Intronic
1174365745 20:50055212-50055234 GGGGCTCAGAGCCAGCAGGCTGG - Intergenic
1174444306 20:50580185-50580207 GGGGCTCGGAGCCACCGAGTAGG + Intronic
1175926848 20:62475438-62475460 GGCGCCCGGAGCGTGCAGGAAGG + Exonic
1176022046 20:62966968-62966990 GGGACCCTGGGCTACCAGGATGG - Intronic
1178738322 21:35172399-35172421 GGGGCCCTAAACCAACAGGAAGG + Intronic
1179657127 21:42852427-42852449 GGGGTCCCCAGGCACCAGGAGGG - Intronic
1179801287 21:43812564-43812586 GGAGGGAGGAGCCACCAGGAAGG - Intergenic
1179827623 21:43975838-43975860 GCGGCCCCGTGCCACCAGGTGGG - Intronic
1179892830 21:44345550-44345572 GGAGCCCAGAGCCTCCAGGGTGG - Intergenic
1180252545 21:46598636-46598658 GGGGCTCTGAGCCACCGCGAGGG - Intergenic
1181267934 22:21642130-21642152 GGGGACTGGAGACACGAGGAGGG - Intergenic
1182105465 22:27685895-27685917 GGGGCAAGAAGCCACCAGGTTGG - Intergenic
1182708950 22:32308406-32308428 AGGGCCTGGCGCCACCAGGCTGG + Intergenic
1183512137 22:38242585-38242607 GGGGCCAGGAGGGCCCAGGAGGG - Intronic
1183640757 22:39090968-39090990 GGGGCCCTGAGCCTGCAGGACGG + Intergenic
1183736998 22:39649710-39649732 GGGGCCCGGAGCAGCGAGGACGG + Exonic
1183739294 22:39661234-39661256 GGAGCCCAGGGCCACCAGCATGG - Exonic
1184445007 22:44541910-44541932 GGGGTCCAGCCCCACCAGGATGG + Intergenic
1184858370 22:47158805-47158827 GGGTCCCGCAGCCACCAGCCAGG + Intronic
1185041510 22:48506776-48506798 GGGGTCCCCAACCACCAGGATGG + Intronic
1185152308 22:49171156-49171178 GGTGACTGGAGCCAGCAGGACGG - Intergenic
1185371464 22:50462808-50462830 GGAGACCTCAGCCACCAGGAAGG + Intronic
1185418598 22:50722736-50722758 GGGGCCAAGAGCCTCCAGGAGGG - Intergenic
950141653 3:10620151-10620173 TGGGCCAGGTGCCAGCAGGATGG + Intronic
950316374 3:12004866-12004888 CGCGCCCGCAGCCGCCAGGAAGG + Exonic
952943351 3:38459632-38459654 TGGGCCTGGAGCCCCCAGGCCGG + Intronic
954130313 3:48557231-48557253 GGAGCCCAGGGCCCCCAGGAGGG + Intronic
954379198 3:50210735-50210757 GGGGCCAGGAGCCACAGGGATGG - Intronic
954414132 3:50384747-50384769 GGGGCCCTGAGCTCCTAGGAGGG - Intronic
961429131 3:126867986-126868008 AGGGCCTGGAGCCACAAGCAGGG - Intronic
961475002 3:127140812-127140834 GGGGCCCGGTGTCATCAGGCTGG + Intergenic
965734851 3:171809812-171809834 GGGGCCGGGGGCCAGCAGCAGGG - Intronic
966808604 3:183825070-183825092 GAGGCCCGGAGCCAGAGGGATGG - Intronic
968647547 4:1748144-1748166 GGGGCCGCCAGCCACCAGGCTGG + Intergenic
968731330 4:2270673-2270695 CGGGCCAGGAACCCCCAGGAAGG - Exonic
968811762 4:2803211-2803233 GAGGTCAGGAGCCACCACGATGG - Intronic
968816688 4:2825081-2825103 TGGGCACGGTGCCACCAGGGTGG - Intronic
968944868 4:3658360-3658382 GGGGAGGGGAGGCACCAGGAGGG - Intergenic
969274657 4:6127307-6127329 GAGGCTCGGAGCCACAAGCATGG + Intronic
969321423 4:6415235-6415257 GGGGCTCTGAGCCCCCAGGCCGG - Intronic
969489236 4:7489877-7489899 GGGCTCTGGAGCCACAAGGAGGG + Intronic
970424422 4:15933186-15933208 GTGGCCAGGAGCCACCATTATGG - Intergenic
970432045 4:15997923-15997945 AGGGCACAGAGCCTCCAGGAGGG + Intronic
977668037 4:99663609-99663631 GGGGCACGGAGGGAGCAGGAGGG - Intergenic
984253737 4:177365316-177365338 GGTGCCCTGAGCTGCCAGGATGG + Intergenic
985536061 5:466309-466331 GGGGCCTGGAGCCAGCATGGTGG - Intronic
985791973 5:1933821-1933843 GAGGCCCGGAGTTACCAGCAAGG + Intergenic
985801536 5:2007886-2007908 AGGACCCGGAGCCAGCGGGAGGG + Intergenic
988707612 5:33741154-33741176 GGAGCCCTGTGCCAGCAGGATGG + Intronic
988993065 5:36690204-36690226 GGGGCCCGCGGCCACCCGGAAGG - Intergenic
993701707 5:91126550-91126572 GTGGCCTTGAGCAACCAGGAAGG + Intronic
996845499 5:127894694-127894716 GGTGCCTGGAGTCACCAGTATGG + Intergenic
997407226 5:133660466-133660488 GGGGCCTGTGGCCAGCAGGAGGG - Intergenic
997869924 5:137498323-137498345 GGGGCGCGGAGCCTCTCGGAGGG - Intronic
1002449042 5:179308765-179308787 GGGGCCAGGAACCTGCAGGAGGG - Intronic
1002564236 5:180100934-180100956 GGGGCCAGCAGCATCCAGGAAGG + Exonic
1006801192 6:36760653-36760675 GGTGCCCTGAGCCCCCATGATGG + Intronic
1007217261 6:40250042-40250064 GGGTCCCTGTGCCAGCAGGAGGG - Intergenic
1016454386 6:144215909-144215931 GGTGCCTTCAGCCACCAGGAAGG + Intergenic
1016988251 6:149910786-149910808 GGGGCCGGGAGCCCCGGGGACGG + Intergenic
1017871951 6:158493994-158494016 GGGGCACTGAGGGACCAGGAGGG - Intronic
1018419696 6:163630943-163630965 GGGGCCCGGAGAGAGGAGGATGG - Intergenic
1019285850 7:222545-222567 GGGTCTCAGAGCCCCCAGGAGGG - Intronic
1019331928 7:464566-464588 TGGGCTTGAAGCCACCAGGAGGG + Intergenic
1019708974 7:2509777-2509799 GGGGCTCAGAGCCCCGAGGAGGG + Intergenic
1019713808 7:2529405-2529427 GGGGTGCAGAGGCACCAGGAGGG - Intergenic
1020272594 7:6606289-6606311 TGGGCCCAGGGCCCCCAGGAGGG - Intronic
1020445244 7:8261714-8261736 TGGGGCCGGAGCCGCCGGGAAGG + Intronic
1023092311 7:36628607-36628629 GGAGCCAGGAGCACCCAGGAGGG + Intronic
1025261918 7:57425631-57425653 CGCGCCCTGAGCCAGCAGGACGG + Intergenic
1025739241 7:64182846-64182868 CGCGCCCTGAGCCAGCAGGATGG + Intronic
1026442472 7:70456547-70456569 GGGGCCAGAAGCCACTAGCAGGG + Intronic
1029207491 7:98878419-98878441 AGGGCCGGGACCCACCCGGACGG + Intronic
1029216968 7:98957533-98957555 GGGGCCAAGAGCCATCAGCAGGG - Intronic
1029269262 7:99366968-99366990 GGGGCCCGGTGCCCACAGCATGG + Intronic
1029592961 7:101519491-101519513 GTGGCAGGGAGCCACCAGCAGGG - Intronic
1029654991 7:101918453-101918475 GGGGCTAGAACCCACCAGGAAGG + Intronic
1032162667 7:129522760-129522782 GGATCCTGGAGCCACCAGGCTGG - Intergenic
1033118172 7:138644702-138644724 GGGGCCAGCACTCACCAGGACGG + Exonic
1034399677 7:150854108-150854130 GGAACCCAGAGCCAGCAGGAAGG - Intronic
1034474142 7:151273221-151273243 GGGGCCAGGTGTCACTAGGATGG + Intronic
1035304865 7:157925489-157925511 GGGACCCGGGACCACGAGGAAGG - Intronic
1035580872 8:738342-738364 GGGGGCGGGGGCGACCAGGATGG + Intergenic
1035592057 8:823800-823822 GGAGCCCGGGGCAGCCAGGACGG + Intergenic
1036134823 8:6151192-6151214 GGATTCAGGAGCCACCAGGAAGG + Intergenic
1036182996 8:6601009-6601031 AGGGACTGGAGCCCCCAGGAAGG + Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037829622 8:22179892-22179914 GGTGCCTGGTGCCACCAAGAAGG + Intronic
1038575715 8:28701841-28701863 GGGCCCCCGAGCCACCGGGCAGG - Intronic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1043929053 8:86069598-86069620 GGGGTGCGGCGCCAGCAGGAAGG - Exonic
1045674021 8:104588744-104588766 GGGCCCCGAGGCCTCCAGGACGG - Intronic
1047201317 8:122770158-122770180 GGGACCCCCAGCCACCAGGCTGG + Intergenic
1049362691 8:142219791-142219813 GAGGCCGGGAGCCAGAAGGACGG - Intronic
1049560906 8:143309821-143309843 GGGACTCGGAGGCATCAGGAGGG - Intronic
1049569038 8:143359837-143359859 AGGGCGCAGGGCCACCAGGAGGG - Intronic
1049746281 8:144264659-144264681 GGGTCCTGGAGGCACCAGCAGGG - Intronic
1051758449 9:20433148-20433170 GGGGCTGGGAGCCACCAAAAGGG + Intronic
1053221687 9:36318014-36318036 GTGGCCAGGAGCCAACAGGAAGG + Intergenic
1053418376 9:37961152-37961174 AGGGCTGGGAGCCACCAAGAGGG - Intronic
1056291751 9:85150509-85150531 GGGCCCCCGAGGCACTAGGATGG - Intergenic
1056424791 9:86465484-86465506 GTGGCCCAGAGACACCAGGCTGG - Intergenic
1057554008 9:96073060-96073082 GGGGCCAGCAGCCCCCAGCATGG - Intergenic
1058826171 9:108777894-108777916 ATGGACCGGAGCCACTAGGAGGG + Intergenic
1058908221 9:109498231-109498253 GGGGCGCGGAGCGCCCAGGTAGG + Exonic
1059329287 9:113524842-113524864 GGGGCCTGGGGCCTCCAGAAGGG - Intronic
1059467547 9:114478602-114478624 GGTGCCCTGAGGCAGCAGGAGGG - Exonic
1060909994 9:127341881-127341903 GGGGCCAGGAAGGACCAGGAGGG + Intronic
1061132898 9:128718250-128718272 AGGGCAGGGAGGCACCAGGATGG - Intronic
1061257771 9:129462605-129462627 GGAGCCGGCAGCCACCAGCAAGG + Intergenic
1061357307 9:130116206-130116228 GGGGCCCACAGCCACCCAGAGGG + Intronic
1061559458 9:131393763-131393785 GGGGCCAGGAGCCAAGAGAAGGG - Intergenic
1062053665 9:134459741-134459763 GGGCCACAGAGCCAGCAGGAGGG - Intergenic
1062186706 9:135222197-135222219 GGGGCCACCAGCCACCAGCAGGG + Intergenic
1062478845 9:136742345-136742367 GGGGCCGGGGGCCGGCAGGAAGG - Intronic
1062546190 9:137064687-137064709 CGCGCCCTGAGCCAGCAGGACGG - Exonic
1062580242 9:137226181-137226203 GGGGCTCAGACCCACCAGGAAGG + Exonic
1185449769 X:275936-275958 GTCTCCCGGAGCCCCCAGGACGG - Intergenic
1187075102 X:15927133-15927155 GGGGCCCTGAGCAACCTGAAGGG + Intergenic
1195086560 X:101418732-101418754 GGGGCACGCAGCCACCTGGCCGG + Intronic
1200049127 X:153419410-153419432 GGGGGCCGGAGCACTCAGGAAGG + Intronic
1200073163 X:153538817-153538839 GGGACCCCGAGCCCACAGGAAGG + Intronic
1202376962 Y:24246578-24246600 GGGGCCTGGAGCTCTCAGGATGG - Intergenic
1202493818 Y:25423543-25423565 GGGGCCTGGAGCTCTCAGGATGG + Intergenic