ID: 1133223124

View in Genome Browser
Species Human (GRCh38)
Location 16:4327747-4327769
Sequence GGCCGCGGGGACCACCGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133223124 Original CRISPR GGCCGCGGGGACCACCGGGA CGG (reversed) Intronic
901063782 1:6485535-6485557 GAGCGCGGGGACCCCGGGGAGGG + Intronic
901804097 1:11726795-11726817 GGCCGTGGTGACCACAGAGATGG + Intergenic
903668285 1:25021212-25021234 GGCCGCAGGGACCTCAGGGAGGG + Intergenic
904774939 1:32900928-32900950 GCCCTCGGGGACCCCCGGGTGGG - Intronic
905043169 1:34976848-34976870 GGCCGCGAGCACCAGCAGGAAGG + Intergenic
905066890 1:35192251-35192273 GGCCGCCGGGCCCGCCGGGCGGG + Exonic
905553021 1:38859335-38859357 GGTAGCGGGGACGCCCGGGAGGG - Intronic
906650355 1:47508446-47508468 GGCCGCGGCGGCCCCAGGGAGGG - Intergenic
908477702 1:64505696-64505718 GGCGGCGGGGTCCAGGGGGATGG - Intronic
913118935 1:115721936-115721958 GGCCACGTGGCCCACAGGGATGG + Intronic
914813668 1:151047840-151047862 GGCGGCGGGGACCATGGGGCTGG - Exonic
915463126 1:156081515-156081537 GGGCGCCGGGACCACTGAGAGGG - Intronic
916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG + Exonic
920340511 1:205272586-205272608 GGCCGCAGAGAACACAGGGATGG + Exonic
921944949 1:220879949-220879971 GGCGGCGGGGTCCAAGGGGAAGG - Exonic
922234484 1:223712789-223712811 GGCCGAGGGGATGGCCGGGAAGG - Exonic
924800078 1:247322959-247322981 GGCGGCTGGGACCACAGGGAAGG + Intronic
1062822949 10:548422-548444 AGCCGCGGAGGCCACCGGGATGG + Intronic
1063664223 10:8051913-8051935 GGCCTCGGGACCCACGGGGAAGG - Intergenic
1066747473 10:38615712-38615734 GACCCCGGGGGCCACCGCGAAGG - Intergenic
1071527271 10:86366040-86366062 CGCTTCGGGGAACACCGGGATGG - Intronic
1072253623 10:93600852-93600874 GGCCGCGGGGAGGGCGGGGATGG + Intronic
1074703386 10:116111406-116111428 GGCTGTGGGGACCACTGGAAGGG - Intronic
1075733870 10:124652366-124652388 GGCCCTGGGCAACACCGGGATGG + Intronic
1075885545 10:125896360-125896382 GGCCGCGGGGGCCGCCAGGGAGG + Intronic
1076554095 10:131311173-131311195 GGCGGCGAGGACCGCCGGGGAGG + Intronic
1076628192 10:131834538-131834560 TGCCTCAGAGACCACCGGGAGGG + Intergenic
1076638965 10:131901173-131901195 GCCGGCGGGGACCACGGGGGCGG + Intronic
1076674725 10:132142089-132142111 GGCCACGGGGTCAAGCGGGAAGG - Intronic
1076713896 10:132353713-132353735 GGGCCCAGGGAGCACCGGGAAGG + Intronic
1077065675 11:640053-640075 GGCCGCAGGGACCCCGGGGAAGG - Exonic
1077185092 11:1232229-1232251 GGCCACGGGGACCCCTGGGTGGG + Intronic
1083428741 11:62602732-62602754 GGCCGCGGGGATCGCCGGGGTGG - Intronic
1083596185 11:63919190-63919212 GGCCACGGGGTCCAGAGGGAAGG + Intergenic
1083702240 11:64487139-64487161 GGCAGCAAGGACCACCAGGATGG + Intergenic
1084070190 11:66728537-66728559 AGCGGCGGGGAGCACCGAGAGGG - Intronic
1085477928 11:76799357-76799379 GGCCGCGCGGACTCCCGGGTCGG - Intergenic
1091582072 12:1796277-1796299 GGCCGCTGGGACTGCTGGGAAGG - Intronic
1091616370 12:2053669-2053691 GGCCGCGGGGAGCGCGGGTAGGG - Intronic
1093561837 12:20551888-20551910 GCCCACGGGGATCCCCGGGATGG - Intronic
1096102483 12:48978255-48978277 GGAGGCGGGGGCCACCGGGCAGG + Intergenic
1096647513 12:53046937-53046959 GGCCGCGGAGGACACGGGGACGG - Intergenic
1099574276 12:84361680-84361702 TGCCCAGGGGACCACCGTGACGG + Intergenic
1102025452 12:109712117-109712139 GGCTGCGGGGACGTCAGGGAGGG - Intergenic
1104719993 12:131039923-131039945 GGCCTCAGGGACCGCCGGCAGGG - Intronic
1104841504 12:131828180-131828202 GGCGGCGGGGACGCGCGGGATGG - Intergenic
1104847328 12:131853043-131853065 GGACGTGGGGACCACGGGGCTGG - Intergenic
1105578435 13:21673725-21673747 GGCCGCGGCGGCCACCCGCAGGG + Intronic
1110436459 13:75482090-75482112 GGCCGCGGGGACCCTCGGCGTGG - Exonic
1113542020 13:111115923-111115945 GGCGGCGGGGGTCCCCGGGAAGG + Intronic
1113807329 13:113117525-113117547 GGCCGCGGAGACCACCCAGATGG - Exonic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118592592 14:67412328-67412350 GGGCGCGGGGCGCACCTGGATGG - Intergenic
1118854684 14:69611800-69611822 GCCGGCGGAGACCTCCGGGATGG - Exonic
1118874031 14:69767584-69767606 GGCCGCAGTGACCCCCGAGAAGG + Intronic
1119854280 14:77887519-77887541 GGCCAAGGGGACCTCAGGGAAGG + Intronic
1122220801 14:100238433-100238455 GGCCCCGGGCACCACGGGGGCGG - Intronic
1122273715 14:100580432-100580454 GGCAGCGGGGAGCACGGGGCGGG - Intronic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1202872521 14_GL000225v1_random:177580-177602 GGCCGCGGGGGCCGCCAGGGAGG - Intergenic
1125421471 15:39508832-39508854 GGCCGAGGTGGCCACAGGGAAGG - Intergenic
1126035007 15:44537380-44537402 GCCGGCGGGGACCGCTGGGAAGG + Exonic
1126837252 15:52679438-52679460 GGCCGCGGAGGCCGCCGGGGAGG - Intronic
1128797121 15:70474166-70474188 GCCCGGGGGGATCACTGGGAGGG + Intergenic
1129393691 15:75233208-75233230 GGCTCCAGGGACCACGGGGAAGG - Intergenic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130650424 15:85759461-85759483 GGCCGCGGGGACTGCAGGGAGGG - Exonic
1131829616 15:96345734-96345756 GACCTCGGGGACCTCCGGGCAGG + Intergenic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1135406493 16:22201857-22201879 GGCCGCAGGCACCACAGGAAGGG - Intergenic
1136136238 16:28258527-28258549 GGCCTCGGGGAGCAGAGGGAAGG - Intergenic
1139544688 16:67644827-67644849 GGCCGCGGGGATCCCCAGGCAGG + Intergenic
1139854842 16:69972171-69972193 GGCCGCGGGAAGCACAGGGGTGG - Intergenic
1140368681 16:74400433-74400455 GGCCGCGGGAAGCACAGGGGTGG + Intergenic
1142090389 16:88206831-88206853 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090427 16:88206908-88206930 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090438 16:88206932-88206954 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090450 16:88206957-88206979 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090462 16:88206982-88207004 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090474 16:88207007-88207029 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090499 16:88207058-88207080 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090536 16:88207135-88207157 GGCCGCGGGGACAGAGGGGAGGG + Intergenic
1142090547 16:88207159-88207181 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090559 16:88207184-88207206 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090584 16:88207235-88207257 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090609 16:88207286-88207308 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090621 16:88207311-88207333 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090646 16:88207362-88207384 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142090658 16:88207387-88207409 GGCCGCGGGGACGGAGGGGAGGG + Intergenic
1142474317 17:180590-180612 GGCCGCCGGGACCACGCGGGAGG + Intronic
1142631346 17:1228705-1228727 GGCCGCGGAGTCGGCCGGGAAGG + Intronic
1142970530 17:3608504-3608526 GGACGTGGGGAACACAGGGACGG + Exonic
1143485372 17:7251316-7251338 GGCCGCGGGGGCCCCGGGGCCGG - Exonic
1144169984 17:12650060-12650082 GGTCACTGGGACCACAGGGAGGG + Intergenic
1147792545 17:43022403-43022425 GGCTGCGGGATCCAGCGGGAGGG + Exonic
1148128363 17:45248137-45248159 GGGCGCCGGGACCCGCGGGAGGG - Intergenic
1148178455 17:45586558-45586580 GGCTGTGGGGACCACAAGGAGGG - Intergenic
1148356580 17:46979319-46979341 TGCCGCGGGGACCGGCGGGGCGG - Intronic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1152923710 17:83078544-83078566 CGCAGCGGGGACCGCCGGGCGGG + Intergenic
1160767604 19:815352-815374 GGCCTCGGTGCCCACAGGGAGGG + Intronic
1160826735 19:1083640-1083662 GGCTGCAGGCAGCACCGGGATGG - Intronic
1160874171 19:1289661-1289683 GTCCGTGGGGAACCCCGGGAGGG - Intronic
1161325581 19:3662123-3662145 AGCCCCGGGGACCACCAGGAGGG - Intronic
1161556247 19:4944404-4944426 GCCCACGGGGATCCCCGGGATGG - Exonic
1161642367 19:5432307-5432329 GGGCGCTGGGACCCCCAGGAGGG + Intergenic
1163666544 19:18606442-18606464 GGGCGCGGGCGCCACCTGGACGG - Intronic
1165848486 19:38834800-38834822 GGTGGCGGGTACCACCCGGAAGG - Intronic
1165899367 19:39161682-39161704 GGCTTTGGGGGCCACCGGGAGGG - Intronic
1165940770 19:39413700-39413722 GGCCGCGGGGTCCCAGGGGAGGG - Intronic
1166109352 19:40613090-40613112 GGCCGTGGGGACCACAGGGAGGG - Exonic
1167466249 19:49652277-49652299 CACCGCGGGAAACACCGGGACGG + Exonic
1168339537 19:55615211-55615233 CGGCGCGGGGACCAGCGGGGCGG + Exonic
926268259 2:11344934-11344956 GTCCGCGGGGTCCGGCGGGAGGG - Intronic
926811259 2:16757077-16757099 GGACGTGGGGACCACAGGGCAGG + Intergenic
927698366 2:25252307-25252329 GGCGGAGGGGGCCACTGGGAGGG + Intronic
928511681 2:32009795-32009817 GGCCGCTGCCACCCCCGGGAAGG - Intronic
929757474 2:44779272-44779294 GGCCTCGGTGCCCACCGGGAAGG - Intergenic
936955837 2:118021264-118021286 GACCTTGGGGACCACCAGGAGGG + Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
947593194 2:231396316-231396338 GGTCGGGGGGTGCACCGGGAAGG - Intronic
947724513 2:232388566-232388588 GGCAGCGGGTACTCCCGGGAGGG + Intergenic
948433298 2:237934452-237934474 GGCCGAGTGGGCCACAGGGAGGG - Intergenic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
948788851 2:240366668-240366690 GGCCGCAGGGATCATCTGGAAGG + Intergenic
948933670 2:241149124-241149146 GGCCTCGGCGCCCACCGGGCAGG + Intronic
949057526 2:241936655-241936677 TGCCGCGGGGCCCTCAGGGAAGG + Intergenic
1169331933 20:4722995-4723017 GGCCTGGGGGAACACCAGGAGGG - Intronic
1169832390 20:9838891-9838913 GGGGGCGGGGGCCAGCGGGAGGG + Exonic
1169859107 20:10132897-10132919 GGCAGCTGGGAGCACCGGGGAGG - Intergenic
1173865963 20:46312778-46312800 GGCCGACGGGACCGCAGGGAGGG + Intergenic
1175519111 20:59588402-59588424 GGCCCCAGGGACCAGGGGGACGG - Intronic
1175878846 20:62244772-62244794 GGCCGCGAGGCCCAGTGGGAAGG + Intronic
1179024226 21:37667018-37667040 GGCCGCAGGGACCACTGGCTAGG + Intronic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1180064712 21:45406278-45406300 GGCTGCGTGGACCCCCGGGTGGG - Intronic
1180285577 22:10741896-10741918 GGCCGCGGGGGCCGCCAGGGAGG + Intergenic
1182064643 22:27421591-27421613 TGCAGTGGGGACCACTGGGATGG - Intergenic
1183358035 22:37369830-37369852 GGCAGGGGGGGCCACAGGGAGGG - Exonic
1183578303 22:38706325-38706347 GGGTGCGGGGACCATGGGGACGG - Intronic
1183617928 22:38956332-38956354 GGCAGCAGGAGCCACCGGGAAGG + Intronic
1185237862 22:49725155-49725177 AGGCGCGGGGACCACCCGGCCGG - Intergenic
952382419 3:32816031-32816053 GGCCTCGGGCACCACCCAGATGG + Intergenic
954176236 3:48847818-48847840 CGCCGCGGGGACCGACGGGCAGG + Exonic
960942890 3:122946004-122946026 GGCCAAGGGGACCAGAGGGAAGG + Intronic
968090568 3:195895971-195895993 GGCCGCGGGGGCCTCGGGGCGGG - Intronic
968582962 4:1403456-1403478 GGGCGCGGGGACCACCCCGCAGG - Exonic
968629169 4:1641369-1641391 AGCAGCGGGGACCCCCGTGATGG - Exonic
968746464 4:2362992-2363014 GGTTGAGGGGACCACGGGGATGG - Intronic
968985229 4:3871367-3871389 GATCGCGGGCTCCACCGGGAGGG + Intergenic
970441446 4:16083763-16083785 GGCTTCTGGGACCACCGCGACGG + Intronic
984474050 4:180215179-180215201 GGCCGCTAGGGCCACCAGGAGGG - Intergenic
985576912 5:677853-677875 GGACGCCAGGGCCACCGGGAGGG - Exonic
985622153 5:961359-961381 GGCAGTGTGGACCACCAGGAAGG - Intergenic
986353637 5:6903499-6903521 GGCAACAGGGACCACTGGGATGG + Intergenic
991216866 5:64165896-64165918 GGCGGCCGGGAGCGCCGGGACGG + Exonic
992104206 5:73436818-73436840 GGCCGCGGGGCCCGGCGGGGCGG - Intergenic
998815827 5:146013326-146013348 GGCTGCTGGGAGCACCAGGAAGG + Intronic
999223468 5:150000705-150000727 CGCCGCGAGGGCCGCCGGGACGG + Exonic
1002169244 5:177366244-177366266 GGCTGCTGGGACCACTGGGGAGG - Exonic
1002487713 5:179550843-179550865 GGCGGCGGGGACAGCGGGGACGG + Exonic
1002896795 6:1384238-1384260 GGCCGCGGGGCCCACCCAGGAGG - Intergenic
1003632263 6:7798318-7798340 CCCAGCGGGGACCACAGGGATGG + Intronic
1004512254 6:16292492-16292514 GGCCTCGGGGGCTACCTGGAAGG - Intronic
1011640478 6:89412350-89412372 GGCCGCGGGCACCACTCGGCGGG + Intergenic
1018023963 6:159789645-159789667 GGCCGCGGGGCACGGCGGGAAGG + Exonic
1019112169 6:169724686-169724708 CGGGGCGGGGACCCCCGGGAGGG - Intronic
1019276670 7:179524-179546 GGCAGCGGGGAACAGTGGGAGGG + Intergenic
1020278584 7:6638396-6638418 GGCAGCGGGGGCCACCCAGAGGG + Intronic
1022111655 7:27235904-27235926 GGCCGGGTGGCTCACCGGGAGGG - Intergenic
1022943216 7:35258465-35258487 GGCCGCGGGGAGGAGCGAGAGGG - Intergenic
1023125628 7:36951513-36951535 GGCCACTGGAACCACCTGGAGGG + Intronic
1023638595 7:42237134-42237156 GGCCGCGGGGCGCGCGGGGAAGG + Intronic
1023648310 7:42342227-42342249 GGGAGCGGGGAGCACAGGGAGGG + Intergenic
1023864629 7:44232921-44232943 GGAAGCGGAGACCACCAGGAGGG + Intronic
1034556895 7:151855758-151855780 GGCGGCAGGAACCACAGGGATGG + Intronic
1035021379 7:155803063-155803085 GGCGGCGGGGACCGCGGGGGCGG - Exonic
1035680231 8:1482662-1482684 GGCCGTGGGAACCACCGCGCAGG - Intergenic
1037760329 8:21737706-21737728 TGCGGCGGGGACCAGAGGGAGGG - Intronic
1037890042 8:22619238-22619260 GGCCGAGGAGACCGCCCGGACGG + Exonic
1038540428 8:28386109-28386131 GGCCGCGGGCCGCGCCGGGAGGG - Intronic
1040109866 8:43562490-43562512 TGGCGCAGGGTCCACCGGGAAGG + Intergenic
1040111145 8:43567683-43567705 GGTCGCGGGGGCTGCCGGGAAGG + Intergenic
1049229943 8:141476788-141476810 GGCCCCGGGAGCCACGGGGAAGG - Intergenic
1049667662 8:143853842-143853864 TGCCGCGGGGAGCATCGGGCTGG - Intergenic
1049748704 8:144273677-144273699 AGCCGCTGGGACCCCCGGGGAGG - Intronic
1049803987 8:144530672-144530694 AGCAGCGGGGACCCCCGGGGAGG + Intronic
1053022035 9:34701623-34701645 GCGCGCGGGGACCCCAGGGACGG - Intergenic
1053557693 9:39154829-39154851 GGCCTCGGGGAGCACCTGCAGGG + Intronic
1053821807 9:41975117-41975139 GGCCTCGGGGAGCACCTGCAGGG + Intronic
1054139421 9:61464122-61464144 GGCCTCGGGGAGCACCTGCAGGG - Intergenic
1054608764 9:67212291-67212313 GGCCTCGGGGAGCACCTGCAGGG - Intergenic
1060477937 9:123999658-123999680 GGCGGCGGCGAGCGCCGGGAGGG - Intergenic
1060966782 9:127716117-127716139 GGCCTCGGGGTCCTCCTGGAAGG + Exonic
1062348110 9:136124797-136124819 GGCTGAGGGGACCGCAGGGAGGG - Intergenic
1062500245 9:136849017-136849039 GGCGGTGGGGGCCACGGGGAGGG + Intronic
1062579711 9:137223840-137223862 GGCCCAGGGGAGCACCAGGAAGG - Intergenic
1203731933 Un_GL000216v2:98962-98984 GGCCGCGGGGGCCGCCAGGGAGG + Intergenic
1186871807 X:13781197-13781219 CGCAGCGGGGACCTCTGGGAGGG - Intronic
1193724368 X:85021582-85021604 GGCACCTGGGACCACTGGGATGG - Intronic
1193962099 X:87939258-87939280 GGCAAGGGAGACCACCGGGAGGG - Intergenic
1198750409 X:139932498-139932520 GGCCGCGGAGTCCAGCGGGGAGG - Intronic