ID: 1133223586

View in Genome Browser
Species Human (GRCh38)
Location 16:4329421-4329443
Sequence AGGGCAGCTGCACTAGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133223586_1133223595 9 Left 1133223586 16:4329421-4329443 CCACGGCCTAGTGCAGCTGCCCT 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1133223595 16:4329453-4329475 GATGCAGCCTTGGGAGAGGTGGG 0: 1
1: 0
2: 1
3: 27
4: 285
1133223586_1133223592 0 Left 1133223586 16:4329421-4329443 CCACGGCCTAGTGCAGCTGCCCT 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1133223592 16:4329444-4329466 GGCTCTGATGATGCAGCCTTGGG 0: 1
1: 0
2: 0
3: 16
4: 188
1133223586_1133223591 -1 Left 1133223586 16:4329421-4329443 CCACGGCCTAGTGCAGCTGCCCT 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1133223591 16:4329443-4329465 TGGCTCTGATGATGCAGCCTTGG 0: 1
1: 0
2: 3
3: 29
4: 215
1133223586_1133223593 5 Left 1133223586 16:4329421-4329443 CCACGGCCTAGTGCAGCTGCCCT 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1133223593 16:4329449-4329471 TGATGATGCAGCCTTGGGAGAGG 0: 1
1: 0
2: 2
3: 24
4: 234
1133223586_1133223594 8 Left 1133223586 16:4329421-4329443 CCACGGCCTAGTGCAGCTGCCCT 0: 1
1: 0
2: 2
3: 14
4: 227
Right 1133223594 16:4329452-4329474 TGATGCAGCCTTGGGAGAGGTGG 0: 1
1: 0
2: 3
3: 38
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133223586 Original CRISPR AGGGCAGCTGCACTAGGCCG TGG (reversed) Intronic
900179383 1:1304605-1304627 AGGGCAGCTGCTCTCGGTCCTGG + Intronic
900332722 1:2144305-2144327 AGGTCAGCGGGACGAGGCCGTGG - Exonic
900341919 1:2193665-2193687 GGGGCAGCTGCGCAGGGCCGCGG + Exonic
900528071 1:3138844-3138866 ATGGCAGCTGCACCAAGCCCAGG - Intronic
900539130 1:3194036-3194058 AGGTCAGCTGCTCTCGGCCCAGG - Intronic
900833751 1:4984536-4984558 AAGGCAGCTGCAGTGGGCTGGGG - Intergenic
902931492 1:19734704-19734726 ACGGCAGCTGGACTAGGGCAGGG - Intronic
904114302 1:28150259-28150281 AGGGCAGCTGCACCACGTGGTGG + Exonic
904702304 1:32365053-32365075 TTGGCAGCTGCACTGGGCCAGGG - Intergenic
905546518 1:38804424-38804446 AGGGCAGCTACGTTCGGCCGCGG - Intergenic
905914973 1:41678441-41678463 AGCCCAGCTGCTCTAGGCCAGGG + Intronic
909806116 1:79875747-79875769 GGGGCAGCTGCACTGTGCTGGGG - Intergenic
910513884 1:88036819-88036841 AGGGCAGCTGCACTGTGCCAGGG - Intergenic
911548468 1:99250842-99250864 AGGTAACCTGCACTGGGCCGTGG - Intergenic
912849860 1:113114188-113114210 AGGGCAGCTGCAATAGCTGGAGG - Intronic
914676918 1:149912981-149913003 AGGGCAGCTGGACTGGGGCTTGG - Intronic
914848713 1:151297916-151297938 AGGACAGCTGCCCTGTGCCGAGG + Intronic
920800570 1:209183623-209183645 AGTGGAGCTGCCCAAGGCCGTGG + Intergenic
921498604 1:215871944-215871966 AGGGCAGCTGCAGAATGCCTGGG + Intronic
923093112 1:230754176-230754198 AGGGCAGCTCCACCAGGGCAGGG + Intronic
1064691788 10:17926250-17926272 ATGGCGGCTGCACTAGGGAGTGG - Intergenic
1067824485 10:49560199-49560221 AGGGAAGCTGGACCAGGCAGAGG - Intergenic
1068051136 10:51950733-51950755 AGGGCAGCTGCTCCATGCCATGG - Intronic
1069082556 10:64103866-64103888 AGGGCAGCAGGCATAGGCCGAGG + Intergenic
1070593792 10:77818604-77818626 AGGCCAGCTGCACAAGACCTGGG - Intronic
1071285417 10:84139761-84139783 AGGGCGGCGGCACAAGGCCCTGG + Intronic
1073110708 10:101061641-101061663 AGGGCAGCTGCATAAGGGGGAGG - Intergenic
1075349699 10:121712596-121712618 AGGGTGGCTGCCCCAGGCCGAGG + Intergenic
1076029236 10:127143537-127143559 AGGGCAGGTGCACCAGGATGTGG + Intronic
1077108289 11:851214-851236 AGGGCAGCTGCAGTTGGGGGTGG + Intronic
1077174261 11:1181502-1181524 AGGGCAGCTGTGCCAGGCAGTGG - Intronic
1077326269 11:1965390-1965412 AGGGCAGCTGGGCCTGGCCGTGG + Intronic
1078816110 11:14823759-14823781 AGGGCTGCTGCAGTATGCTGGGG - Intronic
1078993073 11:16669444-16669466 AGGGCTGCTGCAGTATGCTGGGG - Intronic
1084594337 11:70108032-70108054 AGGACACCAGCACTAGGCCCAGG + Intronic
1084653303 11:70501406-70501428 AGGCCAGCTGGACTGGACCGTGG + Intronic
1085066401 11:73499238-73499260 AGGGCTGCTGCAGTTTGCCGGGG - Intronic
1086821976 11:91446051-91446073 GGGGCAGCTGCACTGTGCTGGGG - Intergenic
1087812976 11:102628491-102628513 AGGGCAGCTGGAATAAGCCTAGG - Intergenic
1089792691 11:120956052-120956074 AGGGCCACTGCTCTAGGCTGAGG + Intronic
1091327005 11:134699060-134699082 ATGGCAGCTGCACGATGCCTTGG + Intergenic
1202809250 11_KI270721v1_random:20569-20591 AGGGCAGCTGGGCCTGGCCGTGG + Intergenic
1093528722 12:20135760-20135782 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1093690385 12:22102597-22102619 AGGGCTGCTGCAGTATGCTGGGG + Intronic
1094199505 12:27781210-27781232 AAGGCAGCAGCACTCTGCCGGGG - Intronic
1095096025 12:38149760-38149782 AGGGCAGATGGACTAGGGCTGGG - Intergenic
1095320291 12:40818943-40818965 AGGGCTGCTGCAGTTTGCCGGGG + Intronic
1097474195 12:60033773-60033795 AGTGCAGCTGCCCAAGGCTGTGG - Intergenic
1098145146 12:67490042-67490064 AGAGCAGCTGTGCTATGCCGGGG - Intergenic
1102787475 12:115616567-115616589 AGGGCTGCTGCCCTAGACCCAGG - Intergenic
1105299033 13:19116965-19116987 TGGCCAGCTGCACTTGGCTGGGG - Intergenic
1106421468 13:29589497-29589519 GGGGCAGCTGCGCTGGGACGTGG - Intronic
1107518300 13:41153546-41153568 AGTGCAGCAGCTCTATGCCGTGG - Intergenic
1111398737 13:87703726-87703748 AGGGAAGATGCACTAGCCTGGGG + Intergenic
1113593579 13:111517031-111517053 AGCTCAGCTGCACTAGACCCGGG - Intergenic
1113827580 13:113268358-113268380 CGGGCTGCTGCACAAGGCCTGGG - Intergenic
1116373196 14:44162400-44162422 AGGGCAGCAGGCATAGGCCGAGG + Intergenic
1116932282 14:50702433-50702455 AGGGCAGCTGTACTGTGCCGGGG + Intergenic
1117452614 14:55865696-55865718 AGGGCAGCTGCACTGTGCCGGGG + Intergenic
1121192166 14:92040260-92040282 AACGCAGCTGCAGGAGGCCGAGG - Exonic
1122886226 14:104711646-104711668 GGGGCAGCTGCAGGAGGTCGGGG - Exonic
1123404582 15:20012187-20012209 TGGGCACCTGCACTAGACCCTGG + Intergenic
1123513915 15:21018834-21018856 TGGGCACCTGCACTAGACCCTGG + Intergenic
1124923594 15:34048938-34048960 AGGGCTGCTGCAGTTTGCCGTGG - Intronic
1129473657 15:75768764-75768786 TGGGCAGGGCCACTAGGCCGAGG - Intergenic
1132605494 16:792154-792176 AGGGCAGCCTCCCAAGGCCGGGG - Intronic
1132677841 16:1127970-1127992 TGGGCAGCAGCACCAGGCCCTGG + Intergenic
1132870081 16:2112069-2112091 AGTGCAGCTGCACTTGGAGGCGG - Intronic
1133223586 16:4329421-4329443 AGGGCAGCTGCACTAGGCCGTGG - Intronic
1133689893 16:8203304-8203326 AGGGCAGCAGCAATGGGCCCAGG + Intergenic
1134522458 16:14924881-14924903 AGTGCAGCTGCACTTGGAGGCGG + Intronic
1134531045 16:14984117-14984139 AGTGCCGCTGCACTTGGCCTGGG + Intronic
1134710128 16:16323532-16323554 AGTGCAGCTGCACTTGGAGGCGG + Intergenic
1134717342 16:16363532-16363554 AGTGCAGCTGCACTTGGAGGCGG + Intergenic
1134949475 16:18345113-18345135 AGTGCAGCTGCACTTGGAGGCGG - Intergenic
1134957410 16:18388627-18388649 AGTGCAGCTGCACTTGGAGGCGG - Intergenic
1138154176 16:54687129-54687151 AGTGGAGCTGCACAAGGCCTTGG - Intergenic
1139865304 16:70056912-70056934 AGTGCCGCTGCACTTGGCCTGGG - Intergenic
1140131651 16:72167147-72167169 AGGACCCCTGCACAAGGCCGAGG + Intronic
1142302821 16:89268627-89268649 GCGGCAGCAGCACGAGGCCGCGG - Exonic
1142331738 16:89458850-89458872 TGGGCAGCTTCATGAGGCCGGGG - Intronic
1142380262 16:89727966-89727988 AGGGCAGCTGTGCCAGGCTGGGG + Intronic
1143200703 17:5111484-5111506 CGGGCACCTGCCCGAGGCCGGGG - Intronic
1143655489 17:8291261-8291283 GGGCAAGCTGCACTAGGCCCTGG - Intronic
1148128854 17:45250665-45250687 TGGGCAGCTTCACAAGGCCCTGG + Intergenic
1151803247 17:76390154-76390176 AGAGCAGCTGCACAAGGCCAGGG - Exonic
1153187636 18:2502540-2502562 TGTGCAGCTGCACAAGGCCTGGG - Intergenic
1153424233 18:4945102-4945124 GGGGCGGCTGCACTGGGCTGGGG - Intergenic
1154181395 18:12142653-12142675 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1154181686 18:12144332-12144354 AGGGCTGCTGCAGTATGCTGGGG + Intergenic
1154182218 18:12147252-12147274 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1154182509 18:12148931-12148953 AGGGCTGCTGCAGTATGCTGAGG - Intergenic
1154229110 18:12538505-12538527 AGGGCAGCTACAGTAAGCAGAGG - Intronic
1155550035 18:26955008-26955030 AGGGCAGCTGCTCCTGGCCCTGG + Intronic
1160241672 18:77129376-77129398 AAGGCAGCTTCAGTCGGCCGGGG + Intronic
1160578680 18:79871470-79871492 AGGGCAGCTGCTCTGGGCCATGG + Intronic
1162057253 19:8072020-8072042 ATGGGTGCTGCACTAGGCAGGGG - Intronic
1162938217 19:13992551-13992573 AGGGCGGCTGCTCTAGGAAGGGG + Intronic
1163593218 19:18205622-18205644 AGGGCAGCTGGTCCAGGCCCTGG + Intergenic
1167041678 19:47026490-47026512 AGGGCAGCTAGACTGGGCTGGGG + Intronic
1167270432 19:48502853-48502875 GGGGCAGCTGGACAAGGCCGGGG - Intronic
1168021006 19:53608601-53608623 GTGGCAGCTGCACAATGCCGTGG + Intergenic
926120146 2:10237402-10237424 AGGGAAGGTGCACCAGGGCGGGG - Intergenic
930230182 2:48835336-48835358 AGTGCAGCTGCCCAAGGCCATGG + Intergenic
930552371 2:52852131-52852153 AGGGCTGCTGCACTTTGCTGGGG + Intergenic
931463882 2:62470415-62470437 AGGGCAGCCACACCAGGCAGGGG - Intergenic
932826846 2:74948592-74948614 AGGGCTGCTGCAGTTTGCCGAGG - Intergenic
933021663 2:77202035-77202057 AGAGCACCTGCACAATGCCGGGG - Intronic
933354215 2:81194482-81194504 GTGGCAGCAGCACGAGGCCGCGG - Intergenic
933476930 2:82803211-82803233 AGGGCAGCTGTGCTATGCTGGGG - Intergenic
934623248 2:95829218-95829240 AGGGCTGCTGCAGTATGCCCAGG + Intergenic
934810518 2:97272874-97272896 AGGGCTGCTGCAGTATGCCCAGG - Intergenic
934827174 2:97435065-97435087 AGGGCTGCTGCAGTATGCCCAGG + Intergenic
934969007 2:98748113-98748135 AGGACAACTGCACTCGCCCGAGG - Intergenic
935656433 2:105427750-105427772 AAGGCAGCTTCACTAGGCCCTGG + Intronic
937146464 2:119649588-119649610 TGGGCAGCTTCACTAAGCCTTGG - Intronic
937356237 2:121199864-121199886 AGGTCAGCTGCACTAGGTGGGGG - Intergenic
937569012 2:123333875-123333897 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
940011613 2:149060642-149060664 AGGGCAGCTTCCCAAGGCAGTGG + Intronic
941652925 2:168112851-168112873 AGGGCAGCTGGATGAGGCCTGGG - Intronic
942512511 2:176717536-176717558 AGGGCAGCAGGACTGGGCAGAGG + Intergenic
944471181 2:200055254-200055276 AAGGCAGCTGCACTGTGCTGGGG - Intergenic
945196948 2:207245631-207245653 AAGGCAGCAGGACTAGGCAGAGG - Intergenic
947311542 2:228808995-228809017 AAGGCAGCTGCTCTAGTCAGGGG - Intergenic
948205515 2:236160962-236160984 AGGGCAGCAGCACCAGGCATGGG + Intergenic
948737246 2:240017032-240017054 AGGGAGGCTGCACTGGGCAGTGG - Intronic
1171123042 20:22582185-22582207 CGGGCAGCAGCAGCAGGCCGCGG - Exonic
1171351732 20:24507714-24507736 AAGGCATCTGAGCTAGGCCGAGG + Intronic
1171385028 20:24764180-24764202 AGGACAGCAGCACCAGGCCATGG + Intergenic
1174506840 20:51022768-51022790 GGGGCGGCTGCACGTGGCCGTGG - Intronic
1175818591 20:61896406-61896428 GGCGCAGCTGCACCAGGCGGAGG + Intronic
1176295077 21:5067432-5067454 AGGGCAGCTGCTCCAGGAAGAGG - Intergenic
1177388209 21:20433834-20433856 AGGGCTGCTGCAGTTTGCCGGGG - Intergenic
1178358060 21:31924728-31924750 AGAGCACCTGCACCGGGCCGGGG + Exonic
1178539517 21:33437698-33437720 TGGGCCACTGCACTAGGCCCTGG - Intronic
1179059502 21:37966468-37966490 ACGGCAGCTGAACTGGGCCCGGG + Intronic
1179373634 21:40829465-40829487 AGAGCAGCTGCACTTGACCAAGG - Intronic
1179531379 21:42021921-42021943 AGGGGCGCTGCAGGAGGCCGGGG + Intergenic
1179861972 21:44194696-44194718 AGGGCAGCTGCTCCAGGAAGAGG + Intergenic
1180787134 22:18553461-18553483 AGGGGAGCTGCACTAGGGGCTGG - Intergenic
1181021426 22:20105523-20105545 AGGGAAGCTGCAGCAGGCTGAGG - Intronic
1181171929 22:21014836-21014858 AGGGCAGCAGCAGCAGGGCGGGG - Intronic
1181234606 22:21441845-21441867 AGGGGAGCTGCACTAGGGGCTGG + Intronic
1181244043 22:21492986-21493008 AGGGGAGCTGCACTAGGGGCTGG - Intergenic
1181440255 22:22932010-22932032 AGGCCAGCTGCACTGGGGTGAGG - Intergenic
1183384739 22:37508541-37508563 GGGGGAGCTGCAGTGGGCCGAGG - Exonic
1183702917 22:39459906-39459928 AGGCCAGCTTCACTGGGCAGCGG + Intronic
1184229785 22:43152264-43152286 AGGGCAGCTGCCAGAGGCCATGG + Intronic
1184453391 22:44596043-44596065 AGGGCTGCTCCATTAGGCAGAGG - Intergenic
1185148163 22:49150333-49150355 AGGCCAGCTGCAGGAGGCCGGGG + Intergenic
950446522 3:13041969-13041991 AGGGAAGCTGCACCGGCCCGGGG - Intronic
951168285 3:19507737-19507759 AGGGCAGCTGCATTGTGCTGGGG + Intronic
952694327 3:36248334-36248356 AGGGGAGCTGCAGTAGAACGAGG + Intergenic
953159970 3:40409624-40409646 AGGGCAGCTGAAGGAGGCAGTGG + Intronic
956761610 3:72448710-72448732 GGCGCAGCTGCACTGGGCCATGG - Intergenic
956953553 3:74310885-74310907 AGGTCAGCTGCCCAAGGCGGAGG - Intronic
960477161 3:118144401-118144423 AGGGCTGCTGCAGTTTGCCGGGG + Intergenic
963587021 3:147205073-147205095 AGGGCTGCTGCAGTAGGAAGGGG + Intergenic
966938563 3:184730670-184730692 AGGGCAGCTGAACCAGCCTGGGG + Intergenic
968554160 4:1238840-1238862 AGGGCAGCTCCATGAGGCAGGGG + Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
968917451 4:3502756-3502778 AGGGCAGCTGCCCTTGGCCCAGG + Intergenic
969613191 4:8238255-8238277 AGGGCAGGTGCAGTGGGGCGGGG + Intronic
969620213 4:8275178-8275200 AGGGCAGCTGCACAGCGCCCTGG - Intronic
972948605 4:44289775-44289797 AGGGCAGCTGCAGTGGAACGTGG + Intronic
973366228 4:49211594-49211616 AGAGCAGCTGTGCTATGCCGGGG + Intergenic
975022090 4:69502546-69502568 AGGGCTGCTGCAGTATGCTGGGG - Intronic
978238378 4:106487578-106487600 AGGGCTGCTGCAATATGCTGAGG + Intergenic
980331343 4:131415120-131415142 AGGGCAGCTGCAGTATGCTGGGG - Intergenic
984766467 4:183404149-183404171 AGGGCAGCTGCACTGGGGGCTGG - Intergenic
985781031 5:1872008-1872030 AGGGCAGCTGCAGCAGGCAGAGG - Intergenic
986879625 5:12153986-12154008 AGGGCAGCAGCCCTAGTCAGGGG + Intergenic
987887701 5:23832118-23832140 AGGGAAGCTGCAGTAGGGTGAGG - Intergenic
987927793 5:24364632-24364654 AGGGCAGCTGCACTATGCCAGGG - Intergenic
987937068 5:24480178-24480200 AGGGAAGCTGCTGTAGACCGAGG + Intergenic
988335972 5:29909595-29909617 AGTGGAGCTGCACAAGGCTGTGG - Intergenic
990844584 5:60122492-60122514 AGGGCAGCAGCCCTAAGCCTTGG - Intronic
991157796 5:63459101-63459123 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
993253454 5:85556882-85556904 AGGGCAGCTGCAGTTTGCTGGGG - Intergenic
997424141 5:133791749-133791771 AGGGGAGCTGCCCTTGGCGGAGG - Intergenic
1001932520 5:175683431-175683453 AGGGCAGCACCAGGAGGCCGAGG - Exonic
1006387284 6:33738341-33738363 AGTGCAGCAGCACGAGGCCCAGG - Intronic
1007117326 6:39352060-39352082 TAGGCAGCTGCACTATGCCATGG - Intronic
1009596663 6:65745378-65745400 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1011442070 6:87398016-87398038 AGGGTAGCAGGAATAGGCCGAGG + Exonic
1013170520 6:107634011-107634033 TGGGCAGCGGCACCGGGCCGCGG - Exonic
1013349715 6:109294198-109294220 AGGGCTGCTGCCCTGGGGCGTGG + Intergenic
1015332601 6:131997960-131997982 AGGGCAGCTGGACTATGACCTGG - Intergenic
1015863218 6:137702065-137702087 AGGGCAGCTGCTCTGAGCTGGGG - Intergenic
1016588484 6:145716597-145716619 ATGGCAGCTGCAGGAGGCTGTGG - Intronic
1016880285 6:148904905-148904927 AGGGCAGCTGCAGGAGGTGGAGG - Intronic
1017994505 6:159520618-159520640 AGGGCTGCTGCAGTATGCTGGGG + Intergenic
1019071001 6:169344811-169344833 CGGGCAGCGGCACCAGGCTGTGG + Intergenic
1019482873 7:1274485-1274507 AGGGCATCTGCTCGAGGCCATGG + Intergenic
1020011047 7:4805899-4805921 AGGGCAGCTGCTCCAGGGAGAGG + Intronic
1023886407 7:44360323-44360345 AGGGCTGCTGCAATATGCTGGGG + Intergenic
1024688513 7:51774348-51774370 AGGGCAGCTGCGCTCTGCTGGGG + Intergenic
1025108380 7:56192118-56192140 AGTGCAGCTGCCCTGGGTCGTGG - Intergenic
1026127674 7:67593904-67593926 AGGGCAGCAGCACTAGGTATTGG - Intergenic
1030874080 7:114791978-114792000 AGGTCAGCTGCAATAGACCAAGG - Intergenic
1030983224 7:116210642-116210664 AGGCCAGCTGAACCCGGCCGTGG + Exonic
1031396866 7:121284742-121284764 AGGGGAGCTGCCCAAGGCTGGGG - Intronic
1032504457 7:132424989-132425011 AGGGCAGCTGGGGTAGGGCGGGG - Intronic
1034125170 7:148664752-148664774 AGGGCAGATGCAATAGTCAGTGG + Intergenic
1035593587 8:836655-836677 AGGGCAGCGCCTGTAGGCCGGGG - Intergenic
1037835889 8:22214515-22214537 GGGGCAGCTGCACTGGGTGGGGG - Intergenic
1040312878 8:46245822-46245844 AGGGCAGTTGCAGAAGGCAGAGG + Intergenic
1041012620 8:53559245-53559267 AGGGCGGCTGCACTGCGCTGGGG - Intergenic
1042714925 8:71762224-71762246 AGGGCAGCAGGCATAGGCCGAGG - Intergenic
1043227357 8:77748771-77748793 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1044356047 8:91224447-91224469 AGGGCTGCTGCAGTTGGCTGGGG + Intronic
1045649506 8:104328916-104328938 AGGGCAGCTGGGCAAGGCTGTGG + Intergenic
1048094473 8:131276408-131276430 GGGGCAGCTTCCCTAGGCTGAGG - Intergenic
1049061008 8:140276373-140276395 AGGGCAGCTGGGCCAGGCCCTGG + Intronic
1049401555 8:142429870-142429892 AGGGCAGCTGCAATGGCCGGTGG - Intergenic
1051823298 9:21192610-21192632 AGGGCTGCTGCAATATGCTGGGG - Intergenic
1051825118 9:21211146-21211168 AGGGCTGCTGCAATATGCTGGGG - Intronic
1051827105 9:21233209-21233231 AGGGCTGCTGCAATATGCTGGGG - Intronic
1057337551 9:94166998-94167020 AGGGAGGCTGCACTTGGCCGCGG - Intergenic
1057547896 9:96031755-96031777 TGGGAAGCTGAACTAGGCAGTGG - Intergenic
1058461701 9:105189612-105189634 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1060731137 9:126037763-126037785 AGGGCAGCTGCCCTGGTCTGGGG + Intergenic
1062390889 9:136333451-136333473 AGGGCAGCTCCCCAAGGCCCAGG + Intronic
1062482507 9:136759162-136759184 GGGGGAGCTGCAGGAGGCCGGGG - Intergenic
1062622866 9:137430437-137430459 TGGGCAGCTGCACTGGGCCCAGG - Intronic
1062630847 9:137462452-137462474 AGGGTAGCAGCACCCGGCCGGGG + Intronic
1186926165 X:14335543-14335565 AGGGGAGCTGCCCAAGGCCATGG - Intergenic
1187552131 X:20316528-20316550 AGGGCAGCAGGAGTAGGCAGAGG - Intergenic
1187574821 X:20542809-20542831 AGGGGAGCTGCCCAAGGCTGTGG + Intergenic
1190060926 X:47211268-47211290 GGGGAGGCTGGACTAGGCCGGGG - Intronic
1192067707 X:67903882-67903904 AGGGCTGCTGCAGTATGCTGAGG + Intergenic
1192382924 X:70636367-70636389 AGGCCTGCTGCAGTAGGCCAAGG + Intronic
1193048284 X:77076402-77076424 AGGGCTGCTGCAGTTGGCTGGGG + Intergenic
1193425659 X:81338007-81338029 AAGGCAGCTGCACTGTGCTGGGG + Intergenic
1193911218 X:87309214-87309236 AAGGGAGCTGCCCTAGGCCTTGG - Intergenic
1194445981 X:93987273-93987295 AGGGCTGCTGCAGTTTGCCGGGG - Intergenic
1194631999 X:96296486-96296508 AGGGCTGCTGCAGTATGCTGGGG - Intergenic
1195104703 X:101593107-101593129 AGGGCTGCTGCAGTATGCTGGGG + Intergenic
1195615988 X:106912193-106912215 AGGGCTGCTGGTCTAGGCTGAGG - Intronic
1198112770 X:133516236-133516258 AGGGCAGCTTCTGTAGGCCTGGG - Intergenic
1199335987 X:146619736-146619758 GCGGCAGCAGCACGAGGCCGCGG - Intergenic
1199478763 X:148274381-148274403 AGAGCAGCTGCACTATGCTGGGG - Intergenic
1199852873 X:151737876-151737898 AGAGCAGCTGCTCTGGGCCAGGG - Intergenic
1200034650 X:153319567-153319589 AGGCCTGCTGCAGAAGGCCGTGG - Intergenic