ID: 1133224311

View in Genome Browser
Species Human (GRCh38)
Location 16:4333340-4333362
Sequence GAGTTCAGCAGGAAGCCTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 280}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133224311_1133224314 -6 Left 1133224311 16:4333340-4333362 CCCTCAGGCTTCCTGCTGAACTC 0: 1
1: 0
2: 2
3: 18
4: 280
Right 1133224314 16:4333357-4333379 GAACTCCAAGTTCCCCGAGAAGG 0: 1
1: 0
2: 1
3: 4
4: 80
1133224311_1133224322 27 Left 1133224311 16:4333340-4333362 CCCTCAGGCTTCCTGCTGAACTC 0: 1
1: 0
2: 2
3: 18
4: 280
Right 1133224322 16:4333390-4333412 CTTTTCAGCAGCCCCTCTCGTGG 0: 1
1: 0
2: 1
3: 11
4: 118
1133224311_1133224315 -3 Left 1133224311 16:4333340-4333362 CCCTCAGGCTTCCTGCTGAACTC 0: 1
1: 0
2: 2
3: 18
4: 280
Right 1133224315 16:4333360-4333382 CTCCAAGTTCCCCGAGAAGGTGG 0: 1
1: 0
2: 2
3: 13
4: 118
1133224311_1133224318 1 Left 1133224311 16:4333340-4333362 CCCTCAGGCTTCCTGCTGAACTC 0: 1
1: 0
2: 2
3: 18
4: 280
Right 1133224318 16:4333364-4333386 AAGTTCCCCGAGAAGGTGGAGGG 0: 1
1: 0
2: 3
3: 15
4: 120
1133224311_1133224317 0 Left 1133224311 16:4333340-4333362 CCCTCAGGCTTCCTGCTGAACTC 0: 1
1: 0
2: 2
3: 18
4: 280
Right 1133224317 16:4333363-4333385 CAAGTTCCCCGAGAAGGTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133224311 Original CRISPR GAGTTCAGCAGGAAGCCTGA GGG (reversed) Exonic
902884911 1:19397823-19397845 GAATGCAGGGGGAAGCCTGAGGG + Intronic
902982963 1:20138827-20138849 GCCTTCAGCAGGAATCCTGGTGG + Intergenic
904422535 1:30403441-30403463 AAGGTCAGCAGGCAGCCTGTGGG + Intergenic
905252439 1:36658380-36658402 GGGTTCAGCAGACAGCCAGATGG - Intergenic
908708942 1:66993365-66993387 GAGTTCAGCAGTGACCATGATGG + Intergenic
908783947 1:67716772-67716794 CAAATCAGCAGGAAGCGTGAAGG + Intronic
909305780 1:74075114-74075136 GTGTTCCCCAGAAAGCCTGAAGG + Intronic
911337182 1:96595168-96595190 GGGTTCAAAAGGAAGTCTGAGGG + Intergenic
915644208 1:157255701-157255723 GAGATCAGCAGTTAGTCTGATGG - Intergenic
915693994 1:157720983-157721005 CAGTTCTGCAGGAAGCATAATGG + Intergenic
916450146 1:164912794-164912816 CAGCTCAGCAGGCAGCCTTAAGG + Intergenic
916460626 1:165020781-165020803 GAGATCAGCAGTTAGTCTGATGG + Intergenic
916580414 1:166101988-166102010 GAGTTCAGCTGTTAGTCTGATGG - Intronic
917973004 1:180220374-180220396 CCGTTTAGCAGGAAGCCTGTGGG + Intergenic
918423769 1:184387731-184387753 GAGGAGAGCAGGAAGGCTGAGGG - Intronic
918610564 1:186485551-186485573 GAGTTCAAAGGGAAGACTGAGGG + Intergenic
918983113 1:191588970-191588992 GCCTTCAGCAGGAATCCTGTTGG - Intergenic
919357926 1:196549868-196549890 GAGTTCAGTAGGAAATCTCATGG + Intronic
922605966 1:226890166-226890188 GGGGTCAGCAGGCAGCCTGTGGG + Intronic
924825760 1:247536586-247536608 GCCTTCAGGAGGGAGCCTGAGGG + Intronic
1063441582 10:6077528-6077550 GAGGTCAGCAGCAAGCTGGAGGG - Intergenic
1064352892 10:14592927-14592949 GACTTGAGCTGGAAGCCTGGGGG - Intronic
1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG + Intergenic
1067693756 10:48520770-48520792 GAGAGCAGCAGGAAGGGTGAGGG + Intronic
1068296820 10:55081138-55081160 GAGATCAGCTGGGAGCCTGAAGG - Intronic
1069256176 10:66334595-66334617 GAGGTCAGCTGTAAGTCTGATGG + Intronic
1073586701 10:104717378-104717400 GAGAACAGAAGGAAACCTGAAGG - Intronic
1076694804 10:132242314-132242336 GAGTGCAGCAGGAGGACGGAAGG + Intronic
1076747055 10:132519779-132519801 CAGTTCCTCAGGAAGCCTGGAGG + Intergenic
1077212993 11:1382157-1382179 GAGGTGACCAGGAAGCCTGGAGG - Intergenic
1078507367 11:11962240-11962262 GAGTTTATCAGGAAGCCAGAGGG - Intergenic
1079454017 11:20621887-20621909 GCGACCAGCAGGCAGCCTGAAGG + Intronic
1079883259 11:25952976-25952998 CAGATCAGGAGGAAACCTGAGGG - Intergenic
1080330409 11:31130839-31130861 GAGGTCAGGAGGAATCCTAAGGG + Intronic
1081431641 11:42982963-42982985 CATTTCAGCAGGAAGGATGAGGG - Intergenic
1082816845 11:57514855-57514877 GACTTCGGCAGGAAGTCTGGCGG + Intronic
1083489081 11:63001566-63001588 CAGAACAGCAGGAAGCCTGACGG - Intronic
1084491436 11:69480767-69480789 GAGGTCAGCAGGGACCCTGCCGG - Intergenic
1084553030 11:69860052-69860074 GATTTGTGTAGGAAGCCTGAAGG - Intergenic
1085035266 11:73296201-73296223 AAGTTCACTAGGAAGGCTGAAGG + Intronic
1086370501 11:86151389-86151411 GGGTTCAGCAGGGAGTCTGTTGG - Intergenic
1086393888 11:86394177-86394199 AAGTTCAGCAGAATCCCTGAGGG - Intronic
1088734761 11:112719526-112719548 CAGTCCAGCAGCAGGCCTGAAGG + Intergenic
1088915192 11:114222343-114222365 AAGTTAAGAAAGAAGCCTGAAGG + Intronic
1089384150 11:118057062-118057084 GAGAGCAGCCGGAAGCCTCAAGG + Intergenic
1089707378 11:120289494-120289516 GAGTTCAGAAGGGACTCTGAGGG - Intronic
1089708035 11:120294734-120294756 GAGTTCAACAGGAAGGAGGAAGG - Intronic
1090953783 11:131496947-131496969 AGGTTCAGTAGGAAGCCAGAGGG - Intronic
1091301009 11:134508289-134508311 GAAACCAGCTGGAAGCCTGAGGG - Intergenic
1092771688 12:11902842-11902864 GAGTCCAGCAGGGAGCAAGATGG - Intergenic
1093813897 12:23520017-23520039 GAGATCAGCTGTAAGTCTGATGG + Intergenic
1096177740 12:49534241-49534263 GAGCTCAGGATGAAGCCTGAGGG - Intergenic
1097220942 12:57450678-57450700 GACCTCAGCAGGAAGCCAGAGGG - Exonic
1098007472 12:66013492-66013514 TATTTCAGCAGAAAGCCTGAAGG - Intergenic
1100919432 12:99465071-99465093 GAGTTCAGCTGTTAGTCTGATGG - Intronic
1101401588 12:104392926-104392948 GAGATCAGCTGTTAGCCTGATGG + Intergenic
1101444434 12:104727447-104727469 GGGGCCAGCAGGAAGGCTGATGG + Intronic
1101456457 12:104836644-104836666 GAGTCCATCTGGAAACCTGAAGG + Intronic
1102295535 12:111733738-111733760 GAGTCCAGCTGGAAGCCAGAGGG + Intronic
1102629045 12:114260855-114260877 GAACTCAACAGGAAGCCAGAGGG - Intergenic
1103149164 12:118622164-118622186 GAATTCAGCAAGAAGCCAGAGGG - Intergenic
1103229176 12:119313770-119313792 GAGTTCTGCATGGAGCCAGAAGG - Intergenic
1103324402 12:120110877-120110899 GAGCTCAGCAGGAAGCCTCACGG - Intronic
1104199246 12:126571905-126571927 GAGTTCAACAGGAATGCTGTGGG + Intergenic
1104670473 12:130676772-130676794 GGGATCGGCAGGAAGCCTGTGGG - Intronic
1104793358 12:131498312-131498334 AAGTTCAGCATGGAGCCAGATGG - Intergenic
1104992894 12:132636160-132636182 CATTTCCCCAGGAAGCCTGAGGG - Intronic
1106136051 13:26974522-26974544 GAGCTCAGCAGGTAGCCTCCGGG - Intergenic
1107319885 13:39175032-39175054 AAGTTCAGAAGAAAGCCTGTGGG - Intergenic
1108089185 13:46828981-46829003 TTGTTCTTCAGGAAGCCTGAGGG + Intergenic
1108731920 13:53244292-53244314 AAGTTCAGCAGTGAGCCTGTAGG + Intergenic
1110773418 13:79377423-79377445 GCCATCATCAGGAAGCCTGAAGG - Exonic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1113248637 13:108427036-108427058 GGACTCAGCAGGCAGCCTGAAGG + Intergenic
1113450426 13:110405456-110405478 GAGTGGAGCAGAAAGCCAGAAGG - Intronic
1117105245 14:52391630-52391652 GGGTTTAGCAGGAAGCAAGAAGG - Intergenic
1119504255 14:75158175-75158197 GAGATCAGCAGGCAGCCACAAGG + Intronic
1119520924 14:75284532-75284554 GTGGTCAGCAGGAAGCTTGGTGG - Intergenic
1202846481 14_GL000009v2_random:182194-182216 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1202915945 14_GL000194v1_random:172796-172818 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1202876812 14_KI270722v1_random:10244-10266 GAGATCAGCAGTTAGTCTGATGG - Intergenic
1124141316 15:27079622-27079644 GAGTCTGGCAGGAAGCTTGATGG + Intronic
1124360838 15:29035621-29035643 GATTTCAGCAGGGAGACTGCTGG + Intronic
1126255221 15:46617373-46617395 GACTTCAGCAGGACACCTGCAGG - Intergenic
1128242879 15:66113396-66113418 GATTTCACCTGGAAGCTTGAGGG + Intronic
1128809615 15:70561395-70561417 GAGATTAGAATGAAGCCTGAGGG - Intergenic
1131071800 15:89470871-89470893 GAGTTCAGCATGGATTCTGAGGG + Intergenic
1132245804 15:100295336-100295358 GAGCTCAGCAGGAAGCCAGCTGG - Intronic
1132692815 16:1189137-1189159 GTGTGCAACAGGAAGCCTGTAGG + Intronic
1132797752 16:1733659-1733681 GAGTTCAGTGGGAAGCCCCATGG + Intronic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1133546620 16:6813843-6813865 GAGCTCAGATGGAAGCCAGAGGG - Intronic
1133805845 16:9125527-9125549 GAGGTCGGCAGGAAGCTTGGTGG + Intergenic
1133976972 16:10606416-10606438 GAATGCAGTAGGAAGCCTGCAGG - Intergenic
1136175760 16:28515139-28515161 GAGTCCTGCAGGCAGCCTGTTGG - Intergenic
1138448909 16:57081349-57081371 AGGTGCAGCAGGAAGGCTGAAGG - Intronic
1138561813 16:57805491-57805513 GAGTTCGGCAGGAAGGGTCAAGG - Intronic
1140752860 16:78041894-78041916 CACTTCAGCTGGAAGCCAGAAGG + Intronic
1141300631 16:82812375-82812397 GTGGTCAGCAGGAAGCCTTGAGG + Intronic
1141521174 16:84580644-84580666 GTGTTCAGGTGGAAGCCAGATGG - Intronic
1141667433 16:85473104-85473126 GAGATCAGCAGGAAGCGGGAGGG + Intergenic
1145769356 17:27481573-27481595 GAGTCAAGCAGGAAGGCTGGTGG - Intronic
1146435278 17:32840232-32840254 GAGTTCAGGAAGCAGCCTGGAGG + Intronic
1146961754 17:36986228-36986250 GAGGTCAGCAGGTAACCTGTAGG + Intronic
1147503830 17:40993889-40993911 GAGTTGAGCAGGAAGCAGGTGGG + Exonic
1147504265 17:40999645-40999667 GAGTTGAGCAGGAAGCAGGTGGG + Exonic
1152451481 17:80383970-80383992 GAGTTCCCCAGCAGGCCTGAAGG + Intronic
1153520151 18:5944084-5944106 GAACTCAAAAGGAAGCCTGAAGG - Intergenic
1153790768 18:8577585-8577607 GAGATCAGCTGGTAGTCTGATGG + Intergenic
1155069397 18:22300632-22300654 AAGTTCAGCTGGAAGTCTGTGGG - Intergenic
1155346214 18:24859754-24859776 GAAGCCAGCTGGAAGCCTGAGGG + Intergenic
1160024481 18:75207007-75207029 CAGGGCAGCAGTAAGCCTGAAGG + Intronic
1160360603 18:78273242-78273264 GTGTTCTTCAGGAAGACTGAAGG - Intergenic
1161362077 19:3856034-3856056 GAGAGCAGAAGGAAGCGTGAAGG + Intronic
1163608304 19:18287849-18287871 GAGTTAAGCAGGCAGCCGAAGGG + Intergenic
1164091288 19:21955190-21955212 GAGATCAGCTGTTAGCCTGATGG + Intronic
1164406074 19:27948036-27948058 GAGTTCAGCTGTTAGTCTGATGG + Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1167571518 19:50292010-50292032 GAAGGCAGCTGGAAGCCTGATGG - Intronic
1167668289 19:50835709-50835731 GTATTCAGCAGGAAGCCATAAGG - Intronic
1167769790 19:51507998-51508020 GAGTTCACCAGGAAGCATGAAGG + Intergenic
1168707208 19:58476977-58476999 GAGAGCAGGAGGAAGCCTCAGGG - Intronic
1202673853 1_KI270710v1_random:22575-22597 GAGATCAGCAGTTAGTCTGATGG + Intergenic
928062386 2:28127686-28127708 GAGTTGAGCAGGATGAGTGATGG + Intronic
928191433 2:29173509-29173531 GAATTCAGCGGAAAGCCTGCTGG + Intronic
928795522 2:35014212-35014234 GAGATCAGCAGTAAGTCTGATGG - Intergenic
928818104 2:35324116-35324138 GAGATCAGCTGTAAGTCTGATGG + Intergenic
930569543 2:53067529-53067551 AAATTGAGCAGGAAGCATGAAGG + Intergenic
931684648 2:64783283-64783305 GACTTCAGCATGAAGCATCATGG + Intergenic
934041116 2:88128252-88128274 CAGTCAAGCAGGAAGCCTTATGG + Intergenic
934159498 2:89234891-89234913 GAGCTGAGCAGGGAGCCTCATGG + Intergenic
934197520 2:89851756-89851778 GAGCTGAGCAGGGAGCCTCATGG - Intergenic
934207780 2:89947540-89947562 GAGCTGAGCAGGGAGCCTCATGG - Intergenic
934929735 2:98412017-98412039 GAGCTCTGCAGGCAGCCTGCAGG + Intergenic
937815644 2:126247794-126247816 GAATTTAGCAGGAAGACAGAGGG + Intergenic
939879963 2:147619842-147619864 GAGTTCAGTATGAATTCTGAAGG + Intergenic
941565182 2:167097910-167097932 GAGATCTGCAGTTAGCCTGATGG + Intronic
941932394 2:170955124-170955146 AAGCTCAGCAGGAGGCCAGAGGG + Intronic
944087827 2:195869727-195869749 GAGAGCAGGAGGCAGCCTGAGGG + Intronic
944847204 2:203680964-203680986 GAGCCCAGCTGGAAGCCAGAAGG + Intergenic
946016351 2:216607054-216607076 CAGTTCAGCAGGACGTCTGCAGG - Intergenic
946352219 2:219162571-219162593 GTGTTGAGCAGGAATCCTGTGGG - Intronic
947526789 2:230881985-230882007 GAGTTCAGCTGGATGACCGAGGG + Intergenic
948286331 2:236788388-236788410 GAGACCTGCAGAAAGCCTGAGGG - Intergenic
948705433 2:239789412-239789434 GGTTTCAGCAGGAACCCTGTGGG - Intronic
948807851 2:240460660-240460682 GAGTTGAACAGGAAGGCTGGAGG - Intronic
1170390271 20:15865758-15865780 GAGACCAACAGGAAGCCTGGAGG + Intronic
1170434837 20:16315660-16315682 GAGAACAGCAGGAAGCAGGATGG + Intronic
1171295359 20:24012402-24012424 CAGTTGAGCAGGAAGCGGGAGGG + Intergenic
1171377423 20:24702929-24702951 GACTTCTTCAGGGAGCCTGAGGG + Intergenic
1172113782 20:32562260-32562282 CAGTGAAGCCGGAAGCCTGATGG - Intronic
1172385327 20:34530120-34530142 GAGTTCATGTGGAAGCCTGGGGG - Intronic
1175088880 20:56485453-56485475 AAGAGCAGCAGGAAGCCAGAAGG + Intronic
1175468486 20:59208953-59208975 GAGCTAAGCAGGGAGGCTGACGG - Intronic
1176635299 21:9187443-9187465 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1178113802 21:29396661-29396683 GAGGGCTGCAGGAACCCTGAAGG - Intronic
1178965300 21:37110834-37110856 GAGATCAGCAGTTAGTCTGATGG - Intronic
1180370897 22:12035722-12035744 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1180377674 22:12110173-12110195 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1180414857 22:12699352-12699374 GAGATCAGCAGTTAGTCTGATGG - Intergenic
1180675860 22:17586108-17586130 GAGGTGACCTGGAAGCCTGAGGG + Intronic
1180907953 22:19428904-19428926 CTGCTCAGCCGGAAGCCTGAGGG - Intronic
1181681193 22:24496851-24496873 GAGGACAGCAGGAAGTCTGCTGG + Intronic
1184313858 22:43667132-43667154 GACTTCAGCAAGGAGCCTAATGG - Exonic
1184355254 22:43975303-43975325 GAGTTCAATTGCAAGCCTGAGGG + Intronic
950933894 3:16819220-16819242 GGGTTCAGGAAGAAGCATGAGGG - Intronic
953005076 3:38970630-38970652 GAGCTAAGCAGGGACCCTGAGGG - Intergenic
954858984 3:53671522-53671544 AATTTCAGCAGGAAGGCAGAGGG - Intronic
955817525 3:62861139-62861161 TAGGTCAGCTGGAAGCCAGATGG + Intronic
956053658 3:65275945-65275967 GGGTACAGCAGGTAGCCAGAGGG + Intergenic
957037833 3:75311468-75311490 GAGCTCAGCAGAATGCCAGAGGG + Intergenic
957102783 3:75849357-75849379 GAGATCAGCAGTTAGTCTGATGG + Intergenic
959088998 3:101882193-101882215 GAATTCAGCAGGAATGATGAAGG - Intergenic
960993111 3:123324537-123324559 GAGCTGAGCAGCATGCCTGAGGG + Intronic
961624895 3:128255062-128255084 GAGGCCAGGAGGCAGCCTGATGG + Intronic
961993551 3:131217399-131217421 GAGTTCAGCTGTCATCCTGAAGG + Intronic
966493369 3:180552818-180552840 GTGTTTAGCAGGAACCCTCATGG - Intergenic
966914926 3:184579386-184579408 GGGCTCAGCAGGGAGCCTGCTGG + Intronic
967224395 3:187276902-187276924 GAGTTCAGCCGGAAGGTCGAGGG + Intronic
967233701 3:187365278-187365300 GGGTTCAGCAGGAAGATTAAGGG - Intergenic
971300187 4:25435430-25435452 GATTTCAAAAGCAAGCCTGAGGG - Intergenic
972204058 4:36749439-36749461 GAATTCGGCTGGTAGCCTGATGG - Intergenic
972839168 4:42910635-42910657 GAATTCAGCATGAGGCCTGGAGG + Intronic
975978314 4:80125227-80125249 GAGTTCAGCAGTAAGCCATCAGG - Intronic
976097863 4:81528248-81528270 GAGTACAGGAGGAAAGCTGAGGG - Intronic
976673425 4:87678706-87678728 AGGTTCAACAGCAAGCCTGAAGG + Intergenic
978188157 4:105881933-105881955 GAGTTCAGCTGTTAGTCTGATGG - Intronic
980486393 4:133462430-133462452 GAGCTCAACAGGAAACCAGAGGG - Intergenic
981156061 4:141437558-141437580 GAGTTCTTCAGGCAGGCTGAAGG - Intergenic
981338377 4:143592603-143592625 GAGATCAGCAGTTAGTCTGATGG + Intronic
981512855 4:145576116-145576138 GAGATCAGCTGTAAGTCTGATGG - Intergenic
981714044 4:147735092-147735114 GAATTCAGCAGTAAGCCTTCAGG - Intronic
983677472 4:170312473-170312495 GTCTTCAGCAAGAAGCCTGTTGG + Intergenic
985074059 4:186195413-186195435 GACTTGAGCAAGAAGCCTGGTGG + Intronic
985282023 4:188297018-188297040 GAGTTCTGAAGGAAACCAGAGGG - Intergenic
1202759281 4_GL000008v2_random:95631-95653 GAGATCAGCAGTTAGTCTGATGG + Intergenic
986506298 5:8455664-8455686 GAAGTCAGCACCAAGCCTGAGGG - Intergenic
986909215 5:12533719-12533741 AAGTTCAGCTGTTAGCCTGATGG - Intergenic
990340232 5:54814727-54814749 GAGATCAGCTGGCAGTCTGATGG - Intergenic
990612176 5:57468593-57468615 GAGTTCAGCAGCATCCCTTACGG - Intergenic
990750622 5:59011933-59011955 GAGATCAGCTGTAAGTCTGATGG - Intronic
991085950 5:62648449-62648471 GCTCTCTGCAGGAAGCCTGAAGG - Intergenic
994290578 5:98024381-98024403 GAGTTCAGCTGTTAGTCTGATGG - Intergenic
995330014 5:110935744-110935766 GAGATCAGCTGTAAGTCTGATGG - Intergenic
995334904 5:110987370-110987392 GAGATCAGCTGTAAGTCTGATGG - Intergenic
995399346 5:111722644-111722666 ATGTTCAGAAGGAAGCCTAATGG + Intronic
996603459 5:125293185-125293207 GAGTTCAATAGGAAGCCAGAGGG + Intergenic
996871379 5:128197258-128197280 GAGTTGAGCAGCAAGGCTCAGGG - Intergenic
997059323 5:130481838-130481860 GAGCTCAGGAGGAGGACTGAAGG - Intergenic
1004707872 6:18141309-18141331 CAGATCAGTAGGAAGCTTGATGG - Intronic
1005470222 6:26156109-26156131 GAGATCTGCGTGAAGCCTGAGGG + Intergenic
1006317413 6:33298750-33298772 GAGTTCTGCAGGAAGGTTGGGGG + Intronic
1007428215 6:41760682-41760704 GATTTGAGCTGGAAGCCTGGGGG - Intergenic
1007748941 6:44060253-44060275 GAGGTCAGGAGGAACCCTGTTGG + Intergenic
1009889064 6:69658047-69658069 GAGGTCAGCTGTTAGCCTGATGG - Intergenic
1010355310 6:74925711-74925733 GAGCCCAGCTGGAAGCCAGAGGG - Intergenic
1010950073 6:82025562-82025584 GAGTTCAGCACCAAGCTTGTAGG + Intergenic
1012407145 6:98912455-98912477 GAGGTCAGCAGTTAGTCTGATGG - Intronic
1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG + Intergenic
1013301246 6:108806647-108806669 GAGTTCAGAAGGAAGACATAAGG + Intergenic
1013721840 6:113039804-113039826 AGGTTTAGCAGGAAGCATGATGG + Intergenic
1014653422 6:124069794-124069816 GAGCTCAGCAGCCAGCCTGGAGG + Intronic
1017765867 6:157606609-157606631 GAGTTCACCAAGAAGCCGGGTGG + Intronic
1018795391 6:167181386-167181408 GAGTTCACCTGGAAGCCTCCGGG + Intronic
1018820932 6:167373677-167373699 GAGTTCACCTGGAAGCCTCCGGG - Intronic
1019555048 7:1625100-1625122 GCCATCAGCAGGAAGCCTCAGGG + Intergenic
1019660317 7:2220334-2220356 GTGGTCAGGAGGAAGCCTGGCGG - Intronic
1019757966 7:2787446-2787468 GAGTGCAGCAGGGAGGCTGACGG - Intronic
1019773339 7:2897282-2897304 GAGTCGAGCCGGAAGCCTGCTGG + Intergenic
1020645502 7:10810266-10810288 GAGATCAGCTGTTAGCCTGATGG + Intergenic
1021122213 7:16808936-16808958 GACATCAGAAGGCAGCCTGATGG - Intronic
1021978486 7:26031574-26031596 GAGTGGAGCAGGAAGCCTTTGGG + Intergenic
1021999880 7:26216431-26216453 GAGTCCAGCTAGGAGCCTGAGGG - Intergenic
1022494637 7:30845116-30845138 GAGGCCAGGAGGAAGGCTGAGGG + Intronic
1026911724 7:74095025-74095047 GAGTTCAGCAGTAAGCTGGTGGG - Intronic
1026995573 7:74613830-74613852 GTTCTCAGCATGAAGCCTGAAGG - Intergenic
1028144490 7:87306134-87306156 GAGTTCAGCTGTTAGTCTGATGG - Intergenic
1028751636 7:94389974-94389996 GACTGCAGCAGGAATTCTGAGGG - Intergenic
1030449537 7:109691493-109691515 GAGTTCAGCTGTTAGTCTGATGG + Intergenic
1030730842 7:112986538-112986560 GAATTCAGCAGAAAGCCAGTTGG - Intergenic
1030857385 7:114577624-114577646 GAGATCAGGAGGAAGTCTGGTGG - Intronic
1032551881 7:132791910-132791932 GAGATCAGCAGGAAGCATGTAGG + Intronic
1032739058 7:134720812-134720834 GCTTTCAGTAGGAGGCCTGAAGG + Intergenic
1033552844 7:142463241-142463263 GAGCACAGCAGAAAGCCTGGAGG - Intergenic
1033931471 7:146528279-146528301 GAGCTCTGGAGGAAGCCTGTTGG + Intronic
1034341797 7:150361968-150361990 GAGGTCTGCAGGAACCCTGCAGG + Intergenic
1034559788 7:151872586-151872608 GGGTTCTGCAGGATGCCTCAGGG - Intronic
1034750314 7:153562181-153562203 GGCTGCAGGAGGAAGCCTGAGGG - Intergenic
1035451496 7:158980022-158980044 GAGCTCAGGAGGAAGCCTGCAGG + Intergenic
1036601365 8:10263651-10263673 GAGTCCAGCACGAAGCCTCAAGG - Intronic
1036709780 8:11070872-11070894 GGGTTCAGCAGGAGGAATGAGGG - Intronic
1038114305 8:24535563-24535585 GAGTTCAGCAGTGGGCCAGAGGG - Intergenic
1038474241 8:27852822-27852844 GTGTTAAGCAGGAAGCAGGAAGG - Intergenic
1039588875 8:38729951-38729973 GAGTTCAGCGTGGAGCCTGGGGG + Intronic
1040575813 8:48650258-48650280 GAGTGCAGAAGGATGCCAGAGGG - Intergenic
1041599424 8:59698653-59698675 GAGTGTAGAAGGAAACCTGATGG + Intergenic
1041826801 8:62103904-62103926 GAGTTCTGCTGCTAGCCTGATGG - Intergenic
1047200124 8:122758315-122758337 GAGGTCATCAGGAAGCATGCCGG + Intergenic
1047360595 8:124165287-124165309 GAGTAAAACAGGAAGGCTGAAGG + Intergenic
1048649673 8:136461549-136461571 GAGTTCAAAAGGAAGCCTCAAGG + Intergenic
1048825319 8:138418576-138418598 GAGTTCTGCTGGTAGTCTGATGG - Intronic
1050361031 9:4831214-4831236 TAGTTCAGCAAGAAGCCCAAGGG - Intronic
1052489813 9:29151041-29151063 GAGGTCTGCTGCAAGCCTGATGG - Intergenic
1053275902 9:36783173-36783195 AAGGGCAGCAGGGAGCCTGAAGG - Intergenic
1053410842 9:37915144-37915166 GAGTTCAGCAGAGATCCTGGCGG - Intronic
1055102250 9:72478179-72478201 GAGAGCAGCAGGAAAGCTGAGGG - Intergenic
1056345892 9:85694444-85694466 GAGTTCAGAAGGCAACCTGGTGG - Intronic
1056377782 9:86031291-86031313 GAATTCAGCAGAAATCCTCAGGG - Intronic
1056877384 9:90347594-90347616 GAGTCAAGCAGGAAACCAGAGGG + Intergenic
1059425030 9:114215645-114215667 GAGTGCAGCAGGAAGGATGCAGG + Intronic
1059778922 9:117506474-117506496 AAGTTCTGCAGCTAGCCTGATGG + Intergenic
1060185488 9:121561711-121561733 GAGTTCATCAGGCAGACTGGAGG - Intergenic
1060341212 9:122778609-122778631 GAGTTCAGCAGAAAGCTAGCAGG + Intergenic
1060439798 9:123627821-123627843 GAGGCCAGCAGGAAACCAGAGGG + Intronic
1061959623 9:133981435-133981457 GAGTGCAGCGGGCGGCCTGAGGG - Intronic
1062347715 9:136123038-136123060 CAGCGCAGCAGGAGGCCTGACGG - Intergenic
1203691076 Un_GL000214v1:43859-43881 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1203758076 Un_GL000218v1:154750-154772 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1203540062 Un_KI270743v1:80530-80552 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1203645219 Un_KI270751v1:60332-60354 GAGATCAGCAGTTAGTCTGATGG - Intergenic
1203651682 Un_KI270751v1:131015-131037 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1188035904 X:25317292-25317314 GAGATCAGCAGTTAGTCTGATGG + Intergenic
1191840749 X:65512228-65512250 GAGAACAGCAGGAAGCCTGCTGG + Intergenic
1191956602 X:66649194-66649216 GAGATCAGCTGTTAGCCTGATGG + Intergenic
1191990333 X:67027946-67027968 GAGATCAGCTGTTAGCCTGATGG - Intergenic
1191993391 X:67064357-67064379 GAGATCAGCTGTTAGCCTGATGG + Intergenic
1192675041 X:73186609-73186631 GAGATCAGCTGGTAGTCTGATGG - Intergenic
1192877691 X:75248838-75248860 GAGATCAGCTGGTAGTCTGATGG - Intergenic
1192879214 X:75265042-75265064 GAGATCAGCTGGTAGTCTGATGG + Intergenic
1192883926 X:75317879-75317901 GAGATCAGCTGGCAGGCTGATGG + Intergenic
1193888971 X:87018950-87018972 GAGTTCTGCTGCTAGCCTGATGG - Intergenic
1194100010 X:89692608-89692630 GAGTTCTGCTGCCAGCCTGATGG + Intergenic
1194244255 X:91492412-91492434 GAGTCCACCAGAAATCCTGAAGG - Intergenic
1195761392 X:108250094-108250116 CTGTTCAGCAGGAAGTCTGGAGG + Intronic
1195920507 X:109978679-109978701 GAGATCAGCTGGAAGGCTGTTGG + Intergenic
1196152481 X:112390655-112390677 GAAGTCTGCAGGTAGCCTGATGG + Intergenic
1196937217 X:120741957-120741979 GAGTTCAGGAGGAAGAAGGAGGG - Intergenic
1199541139 X:148959150-148959172 GAGTCCAGCAGGAGGCCTCCTGG + Intronic
1199746076 X:150772568-150772590 GAGGGCAGCAGGAAGCATAAGGG + Intronic
1200453012 Y:3353965-3353987 GAGTTCTGCTGCCAGCCTGATGG + Intergenic
1201579493 Y:15495780-15495802 CAGTTTAGCAGGAATCCTGCTGG - Intergenic