ID: 1133226658

View in Genome Browser
Species Human (GRCh38)
Location 16:4344160-4344182
Sequence CTCAAGACTGAGATGGGATT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133226652_1133226658 26 Left 1133226652 16:4344111-4344133 CCTGGGGACTCACTAAGATGTGA 0: 1
1: 0
2: 1
3: 11
4: 102
Right 1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG 0: 1
1: 0
2: 0
3: 11
4: 176
1133226651_1133226658 27 Left 1133226651 16:4344110-4344132 CCCTGGGGACTCACTAAGATGTG 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG 0: 1
1: 0
2: 0
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133226658 Original CRISPR CTCAAGACTGAGATGGGATT CGG Intronic
901752157 1:11416949-11416971 CTGGAGACTGGGATGGGATGAGG - Intergenic
902604652 1:17562117-17562139 CTCAAGATTGAGTCGGGGTTGGG + Intronic
903191788 1:21660627-21660649 CTCAAGACTGAGTCGGGGCTGGG - Intronic
903311942 1:22465622-22465644 CTCCAGATTGAGATCGGAGTGGG + Intronic
904332601 1:29772218-29772240 CTCCAGACTGAGAAGGGCATGGG - Intergenic
907266742 1:53266354-53266376 CTCAGGACAGAGTTGGGACTTGG - Intronic
908760041 1:67503297-67503319 CTCAAGTCCGAGATGAGATAAGG + Intergenic
909634900 1:77806448-77806470 CTCAAAACTGAACTGGAATTAGG + Intronic
913161401 1:116149087-116149109 ATCAAGACTGAGGTGGGGTGGGG - Intergenic
914926675 1:151894710-151894732 CTCAAGACGGAGAGGTGATGAGG + Intronic
915005080 1:152628372-152628394 CTCAAGGCTCAGCAGGGATTTGG + Intergenic
915687454 1:157648886-157648908 CTCTAGGCTGAGAGGGGACTGGG - Intergenic
919124496 1:193378805-193378827 CTAAAGTCTAAGATGAGATTTGG - Intergenic
920240542 1:204545421-204545443 CTCAAGACTCAGAAGAAATTGGG + Intronic
922622739 1:227002809-227002831 CTCAAGACTCAGCTGTGACTAGG - Intronic
923707332 1:236354813-236354835 CTTTAAACTGAGATGGAATTTGG - Intronic
1062805018 10:412620-412642 CTCAGGACAGATGTGGGATTTGG - Intronic
1063437216 10:6044097-6044119 CTGAGGACTGAGAGGTGATTTGG - Intronic
1068598921 10:58935222-58935244 CTCAAGAATGTGGTGGGATGGGG - Intergenic
1070563383 10:77584747-77584769 CTCAAGAGTGAGCTGGGAGAAGG + Intronic
1074506199 10:114072854-114072876 CTCATCAGTGAGATGGGTTTTGG + Intergenic
1075165813 10:120067271-120067293 CTCAGGACTCTGATGGGACTTGG + Intergenic
1076190306 10:128478652-128478674 CACAAGAATGAGATGAGGTTGGG - Intergenic
1077782989 11:5352165-5352187 CTCAAGACTGTCATGGGCATTGG + Exonic
1084576745 11:69993554-69993576 CTGAAGACCGAGCTGGGACTAGG - Intergenic
1085608604 11:77925721-77925743 ATGAAGTCTGAGAGGGGATTAGG - Intronic
1089640046 11:119842018-119842040 CTCAGCACTGGGATGGGATAAGG - Intergenic
1090985607 11:131763060-131763082 CTAAAGACTGAGTTCAGATTGGG - Intronic
1094037788 12:26089144-26089166 CTCAAGACTGAAAGTGGATGAGG + Intergenic
1096136380 12:49205271-49205293 CTGAACACTGAGTTGGGAATGGG - Intronic
1096320933 12:50612155-50612177 CAGAAGGCTGAGATGGGAATGGG + Intronic
1097701740 12:62827483-62827505 CTCAAGACAGTGATGGCAGTGGG - Intronic
1098637808 12:72805824-72805846 CTCAAGAATTAGATGGGCCTGGG - Intergenic
1099746463 12:86710436-86710458 ATCAAGCCTGAGAAGAGATTTGG + Intronic
1100465917 12:94845202-94845224 CTGAAGACGGAGAAGGGATACGG - Intergenic
1101510039 12:105384834-105384856 CTCAAGAGTGAAATGGGCTATGG - Intronic
1104907555 12:132222015-132222037 CTCAAGACAGACAGTGGATTGGG + Intronic
1105453478 13:20520568-20520590 CTCAAGACTGAAAGGGAAGTGGG - Intronic
1107770814 13:43786542-43786564 ATCTAGACTGAGAGGGGAGTGGG - Intronic
1111665099 13:91257203-91257225 TGCATGACTTAGATGGGATTAGG + Intergenic
1114902315 14:27078638-27078660 TTCAAGACAAAGATGGCATTAGG + Intergenic
1114993843 14:28321681-28321703 CTTAAAACTGTGATGGAATTTGG - Intergenic
1116024476 14:39498178-39498200 CTCAAGTCCAAGATGAGATTTGG + Intergenic
1116544051 14:46140695-46140717 CTTAGGAAGGAGATGGGATTGGG - Intergenic
1116908065 14:50425207-50425229 CTCATGCAGGAGATGGGATTTGG - Intronic
1117740108 14:58809202-58809224 TTCAGGGCTGAGATGGGGTTAGG + Intergenic
1118552121 14:66964708-66964730 CAGAAGACTGAGTTGGGATAGGG - Intronic
1120185471 14:81389380-81389402 CGCAAGAATGAAATGGAATTAGG - Intronic
1121126118 14:91407759-91407781 CCCAAGGCTGGGATGGGTTTTGG + Intronic
1123785099 15:23663581-23663603 CTCAAGGCTGGGCTGGGATGAGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125033042 15:35092196-35092218 CTCAAAACTGAGATGAGAAACGG - Intergenic
1127092218 15:55478595-55478617 CCCAAGATTGGGCTGGGATTGGG - Intronic
1130245618 15:82245643-82245665 GTCAAAACTGAGATGGGGTCAGG + Intronic
1130455078 15:84097738-84097760 GTCAAAACTGAGATGGGGTCAGG - Intergenic
1130997267 15:88910945-88910967 CTCAAGTGTGAGATGGGAGTGGG + Intronic
1133068721 16:3230874-3230896 CGCAAGACTGAGGTAAGATTTGG - Intronic
1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG + Intronic
1136587740 16:31198528-31198550 CTCAGCACAGGGATGGGATTTGG + Intergenic
1138067010 16:53952732-53952754 CACAAGACTGAGATGTGGGTGGG + Intronic
1141070523 16:80950423-80950445 CTCCCGAATGAGATGGGCTTGGG - Intergenic
1141481620 16:84310253-84310275 CTCAAGGCTGGGATGTGCTTCGG - Intronic
1142067733 16:88072414-88072436 CTCAAGAATCAGTTGGAATTTGG - Intronic
1142245776 16:88969481-88969503 CTGAAGGCTGGGGTGGGATTTGG - Intronic
1143140685 17:4740274-4740296 CTCAGGGATGAGATGGTATTTGG - Intronic
1144040119 17:11403238-11403260 CTCAAGACTCAGATTTGATAGGG + Intronic
1144140308 17:12341442-12341464 CTCAAGGCTCAGATGGGCTCTGG + Intergenic
1144193254 17:12866034-12866056 CTCAAGAGTGGGGTGGGAGTTGG + Intronic
1145763750 17:27443768-27443790 CTCCATGCTGAGATGGGATAAGG + Intergenic
1146548637 17:33761396-33761418 CTCAACACAGGGATGGGATGGGG + Intronic
1147919123 17:43905805-43905827 CTCAGGCCTGAGAAGGGAATGGG - Intronic
1150383114 17:64736213-64736235 CTCAAGAGTGAAATGGGGCTGGG + Intergenic
1150773130 17:68058563-68058585 CTCAAGAGTGAAATGGGGCTGGG - Intergenic
1152194043 17:78905777-78905799 CTCAAGGCTGAGTTGGCCTTAGG - Intronic
1152462316 17:80448053-80448075 CTCATCTCTGAAATGGGATTTGG + Intergenic
1153802616 18:8684603-8684625 CTAAAGACTGAGCTTGGGTTGGG + Intergenic
1155610372 18:27660503-27660525 CACAAGACTGTGATGGGAGTGGG - Intergenic
1158242068 18:55388749-55388771 CTGAAGGCAGAGATGGGACTGGG - Intronic
1160219021 18:76958947-76958969 CTAAAGACTGAGATTCTATTAGG + Intronic
1161227734 19:3154971-3154993 CTGGAGACTGAGACGGGAGTGGG - Intronic
1161843455 19:6696304-6696326 CTCCAGAATGAGATGGAATTTGG + Intronic
1163368112 19:16887688-16887710 CTCAAGTGTGTGATGAGATTAGG + Intergenic
1163716826 19:18877870-18877892 GTATTGACTGAGATGGGATTGGG - Intronic
1166089379 19:40498172-40498194 CTGAAGTCAGGGATGGGATTAGG - Intronic
1167558645 19:50211684-50211706 CTTAAGATTGAGATGGGGCTGGG + Intronic
927889197 2:26737989-26738011 CTCAAGTCTGAGCTGGGAACGGG - Intergenic
928222303 2:29414396-29414418 CTGGAGACTGAACTGGGATTAGG + Intronic
928971989 2:37039078-37039100 TGCAAGGCTGAGATGGGAGTGGG + Intronic
932598481 2:73108686-73108708 CCCAAGACAGGGATGGGATGTGG - Intronic
932614455 2:73223177-73223199 TTCAAGACTGGGATGGGGTAGGG + Intronic
932910485 2:75801034-75801056 CTAAAGAGTGAGTTGGAATTTGG - Intergenic
934526715 2:95056627-95056649 CACAAGCCTGAGAAAGGATTAGG + Intergenic
935427606 2:102936374-102936396 CTAATCATTGAGATGGGATTAGG - Intergenic
936168848 2:110149781-110149803 GTCAAGACTGGAATGGCATTAGG - Intronic
940367208 2:152861401-152861423 CGCAATGCTGAGATGGGATTTGG + Intergenic
942193883 2:173498105-173498127 CCCAAGACAAGGATGGGATTGGG + Intergenic
945020102 2:205561971-205561993 CTTAAGACTGAGGTGGTATCAGG - Intronic
946481589 2:220062085-220062107 CTGAAGATTGAGATGTTATTAGG - Intergenic
948407895 2:237736586-237736608 GTCACGTCTGAGATGGGCTTCGG + Intronic
1168976902 20:1973609-1973631 TTCAAGGCTGAGACGGGAGTGGG + Intergenic
1170885207 20:20334843-20334865 CCAAAGACTGAGATGGAAATCGG - Intronic
1172800736 20:37574427-37574449 GTCAGGACTGAGAAGGGAGTGGG + Intergenic
1175129281 20:56777061-56777083 CTGAAGCCTGAGTTGGTATTTGG - Intergenic
1175700166 20:61131103-61131125 ATCAAGACACAGATGGCATTCGG + Intergenic
1176079465 20:63264846-63264868 CTCAAAACAGAGATGTGAGTTGG + Intronic
1178598095 21:33972988-33973010 CTCATGACCGAGATGGGGTGGGG + Intergenic
1181361857 22:22343607-22343629 CCCAAGACTGAGAAGCGATCAGG - Intergenic
1181534566 22:23534784-23534806 CTCAAGAGGGAGATGGGGCTGGG + Intergenic
1181858748 22:25801861-25801883 CTAAAGCTAGAGATGGGATTTGG + Intronic
1183300237 22:37055419-37055441 CTGAAAACTGTGATGGGATTAGG - Intronic
1183474472 22:38028319-38028341 TTCAAGACTGATAAGGGATTGGG + Intronic
950095936 3:10330455-10330477 CTCAAGAGTCTGATGGGACTTGG + Intronic
955086528 3:55708037-55708059 ATCAAGACTGACCTGGGAATGGG + Intronic
955235199 3:57132937-57132959 CACAAAACTGAGTTGGGTTTGGG + Intronic
955479657 3:59376714-59376736 CTCAAGAATGAGAATGGAGTTGG + Intergenic
957221883 3:77392689-77392711 CTCAAGCCTGAGGCAGGATTAGG - Intronic
957562582 3:81842263-81842285 CTCATGAATGAGATTAGATTAGG - Intergenic
957876958 3:86159504-86159526 CTTCAGAATGAGATGGTATTTGG - Intergenic
960243754 3:115376639-115376661 CTAAAGGCTGAGAAGGGATAAGG - Intergenic
963002216 3:140692686-140692708 ATCAAGAATGAGAAGGGCTTTGG - Intronic
965642307 3:170842696-170842718 CTCAAGACTGCCATGTGATACGG - Intronic
966198868 3:177340734-177340756 CTCATAACTGAGATGGCATTTGG + Intergenic
968281816 3:197483010-197483032 CTCAAGAGGGAGATGTCATTCGG - Intergenic
971403246 4:26295708-26295730 CTCAAGGCTGATTTGGGACTTGG + Intronic
971563747 4:28114050-28114072 CTCAAGGCTGAGATGGGAGAAGG - Intergenic
972802396 4:42490595-42490617 CTCAAGAACTAGAGGGGATTAGG - Intronic
975565980 4:75754618-75754640 CTCATGACTGAGATGAACTTAGG - Intronic
978103841 4:104876940-104876962 CTCAAGAGTGAGATCTGATGTGG - Intergenic
978119323 4:105059582-105059604 CTCAAGAGTGGGGTGGGAATGGG + Intergenic
978595591 4:110373978-110374000 CTCAGGACTGGGATGGGAATTGG + Intronic
979479517 4:121200059-121200081 GTCAATATTGAGATGGCATTTGG + Intronic
981996114 4:150977324-150977346 CTCATGACTGAGCTGGGACCTGG - Intronic
983061290 4:163164588-163164610 TTCAAAACTGATATGGTATTGGG + Intronic
984278935 4:177643859-177643881 CTGAGCACTGAGATGGGTTTTGG - Intergenic
988054857 5:26081298-26081320 CACAAGACTGACTTTGGATTGGG + Intergenic
992859031 5:80893046-80893068 CCCAAGATTGGGTTGGGATTGGG + Intergenic
996536227 5:124580925-124580947 CTGAAGACTGAGGGGAGATTTGG - Intergenic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998379855 5:141716352-141716374 CTCAGTCCTGAGATGGGAATGGG + Intergenic
1004796064 6:19086463-19086485 CACAAGAATGAGGTGGGGTTAGG - Intergenic
1005143322 6:22659181-22659203 CTCAGTGCTGAGATGGGAGTAGG + Intergenic
1006523155 6:34583727-34583749 CCCATGACTGAGGTGGGAATAGG + Intergenic
1007989705 6:46242415-46242437 ATCCAGAGTGAGATGGGACTCGG - Intronic
1008680521 6:53867052-53867074 GTCAGGACTGAGATGGCATAGGG + Intronic
1009329151 6:62393981-62394003 ACCAAGAGTGAGATGGCATTAGG + Intergenic
1012853793 6:104477107-104477129 CCCAAGACTAGGAGGGGATTTGG - Intergenic
1013706506 6:112841045-112841067 CTCATGACTGTGATATGATTTGG + Intergenic
1014921732 6:127221482-127221504 CTGAAGACTAAGATAGTATTTGG - Intergenic
1016442083 6:144094945-144094967 CGCTGGAGTGAGATGGGATTTGG - Exonic
1018209257 6:161464322-161464344 CTCAAGCCAGGGATTGGATTGGG + Intronic
1019047230 6:169158578-169158600 CTGAAGGCTGACATGGGGTTTGG - Intergenic
1020574741 7:9912773-9912795 CTCGGGACTCACATGGGATTGGG - Intergenic
1024007881 7:45240994-45241016 CTCATGACTGAAATGGCACTCGG + Intergenic
1025844293 7:65182125-65182147 ATGAAGTCTGAGAGGGGATTAGG + Intergenic
1025894622 7:65688458-65688480 ATGAAGTCTGAGAGGGGATTAGG + Intergenic
1027988505 7:85326871-85326893 ATCAAGACAATGATGGGATTGGG - Intergenic
1030330291 7:108263164-108263186 CTAGAGACTGAGATGAAATTGGG - Intronic
1030880478 7:114872078-114872100 CTCAAGAGTGAGAGAGAATTGGG - Intergenic
1031911881 7:127525999-127526021 CTCCAGAAAGAGATGGGAGTGGG + Intergenic
1032270151 7:130397849-130397871 CTCATGACTGAACTGTGATTAGG - Exonic
1035158579 7:156934503-156934525 TTCAAAAGGGAGATGGGATTCGG + Intergenic
1035729258 8:1842908-1842930 TTCCAGACTTAGCTGGGATTAGG - Intronic
1037561142 8:20075381-20075403 CTCAAGACTGGGTTGGGTCTAGG + Intergenic
1038026834 8:23598372-23598394 CTCAGGAGGGGGATGGGATTTGG + Intergenic
1038118463 8:24584479-24584501 CTCAAGACTAAGATAAGATATGG - Intergenic
1038696684 8:29812591-29812613 CTCAACACTGAGAAGTGGTTGGG - Intergenic
1040938034 8:52801434-52801456 CACAAGGGTGAGATGGGATGGGG + Intergenic
1043098669 8:76010531-76010553 CTTAAGGCTGAGATAGAATTTGG + Intergenic
1049608185 8:143539411-143539433 CTCAGAAGTGAGATGGGATCTGG - Intronic
1058731837 9:107857840-107857862 CTCTAGAATGAGATTGGATCTGG - Intergenic
1059518442 9:114917281-114917303 TACAGGACTGAGATGGGAGTTGG + Intronic
1059538064 9:115102169-115102191 CTTTGGACTCAGATGGGATTTGG - Intronic
1061138662 9:128751321-128751343 CTGGAGACTGAGCTGGGATCTGG - Intronic
1061344429 9:130010933-130010955 CTCAAGATAGACATGGGATTAGG + Intronic
1062721683 9:138047507-138047529 CTCATGATTGAGATGGGACCAGG + Intronic
1186165066 X:6819151-6819173 TTAAAGACTGGGGTGGGATTTGG + Intergenic
1186711154 X:12198458-12198480 CACAAGACTCACCTGGGATTTGG - Intronic
1187149703 X:16670132-16670154 CTGGAGACTGAGGTGGGAATTGG + Intronic
1187324379 X:18273191-18273213 CTCAAAACTGAGGTGGGGATGGG - Intronic
1190746668 X:53327493-53327515 CTTAAAACTGAGACGGCATTTGG + Intergenic
1193414868 X:81209738-81209760 CTCGAGAGTGAGATGAGAGTTGG + Intronic
1194294765 X:92114219-92114241 CTCAAGCCTGATCTGGGACTGGG - Intronic
1194613096 X:96067635-96067657 TTAAAGACTGAGAAGGGGTTAGG - Intergenic
1196433239 X:115650431-115650453 CTCAGAACTTAGACGGGATTTGG + Exonic
1197089804 X:122523236-122523258 CACAAGACTGACATGGAACTTGG + Intergenic
1198043193 X:132874785-132874807 ACCAAGACTGAGCTGGGATTTGG - Intronic
1198448641 X:136743891-136743913 CTCAGGACTGAGATGGATCTGGG - Intronic
1200734587 Y:6780975-6780997 CTCAAGACAGGGAGGGGACTTGG + Intergenic