ID: 1133230148

View in Genome Browser
Species Human (GRCh38)
Location 16:4362531-4362553
Sequence TAGGGTACACAGGAGGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 268}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133230141_1133230148 3 Left 1133230141 16:4362505-4362527 CCCTGCATGAGGCCTGTGCTCAG 0: 1
1: 0
2: 2
3: 37
4: 260
Right 1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG 0: 1
1: 0
2: 1
3: 16
4: 268
1133230142_1133230148 2 Left 1133230142 16:4362506-4362528 CCTGCATGAGGCCTGTGCTCAGC 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG 0: 1
1: 0
2: 1
3: 16
4: 268
1133230138_1133230148 28 Left 1133230138 16:4362480-4362502 CCAGTGAGTCTGGGTGAGGGGGG 0: 1
1: 0
2: 2
3: 35
4: 328
Right 1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG 0: 1
1: 0
2: 1
3: 16
4: 268
1133230145_1133230148 -9 Left 1133230145 16:4362517-4362539 CCTGTGCTCAGCAGTAGGGTACA 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG 0: 1
1: 0
2: 1
3: 16
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133230148 Original CRISPR TAGGGTACACAGGAGGATGA CGG Intronic
902280277 1:15369346-15369368 TAGGGTAGAGAAGAGGAGGATGG - Intronic
902743232 1:18455036-18455058 GAGGGTACACAGGAGGGAGGTGG - Intergenic
903877183 1:26483169-26483191 GGGACTACACAGGAGGATGATGG - Intergenic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905543062 1:38775467-38775489 TAGGGTAAAGAAGAGGAGGAAGG - Intergenic
905551853 1:38847926-38847948 CTGGCTACACAGGAGGCTGAAGG + Intronic
906140218 1:43530005-43530027 GAGGGTGAACATGAGGATGAAGG + Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907481653 1:54749054-54749076 TAGGGAACACAAGAGGAGGAAGG - Intergenic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
909561866 1:77016277-77016299 GAGGAGATACAGGAGGATGAGGG - Intronic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
911139171 1:94479767-94479789 TAGGGTATATAGGGGAATGAGGG + Intronic
912450941 1:109767370-109767392 CAGGGTGAACAGGATGATGATGG - Intronic
913496651 1:119433766-119433788 AATGGTGCAGAGGAGGATGAGGG + Intergenic
914335323 1:146709749-146709771 TAGAGTATACAGGAGGGTGTTGG - Intergenic
915554389 1:156653263-156653285 GACGGCACACAGGCGGATGAAGG - Intronic
915662993 1:157419054-157419076 TAGGGTGCACAGAAAGCTGAGGG + Intergenic
915838084 1:159193938-159193960 CAGGTTACCCGGGAGGATGATGG + Exonic
917633431 1:176912709-176912731 TAAGGAACACAGGGGGATGGTGG + Intronic
918100160 1:181365883-181365905 TAGGGTAGAGAGGAGGATTAGGG + Intergenic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
920311906 1:205053510-205053532 TAGGTCACACAGCAAGATGATGG + Intronic
920565623 1:206970446-206970468 AAGGGGACACAAGAGGAGGAAGG - Exonic
920972210 1:210752645-210752667 TAGGGAACAGAGGATGAGGAGGG + Intronic
921304854 1:213785855-213785877 TATGGCACACAGTGGGATGATGG - Intergenic
922564472 1:226592786-226592808 TAGTGGACACAGGAAGATGCAGG - Intronic
923897303 1:238285803-238285825 GAGGGTAGAAAGGAGGATAAAGG - Intergenic
1062803310 10:395963-395985 CAGGGTCCACATGGGGATGAGGG - Intronic
1062993094 10:1838397-1838419 TATGGTACACAGTAGGATATGGG + Intergenic
1063299021 10:4835209-4835231 AAAGGTACACAGGAGGTAGAGGG - Intronic
1063546434 10:6986437-6986459 TAGTGTAGACAGCTGGATGAAGG - Intergenic
1064479174 10:15722026-15722048 TCAGGTACTCAGGAGGCTGAGGG + Intergenic
1065046616 10:21752049-21752071 TCGGGTATCCAGGAGGATGAGGG + Intergenic
1066311694 10:34203529-34203551 TAAAGTATACAGGAGGATGTGGG - Intronic
1066792445 10:39080803-39080825 TAGGGGTTGCAGGAGGATGAAGG + Intergenic
1067516478 10:46950510-46950532 AAGGGGACACAGGAGCATCAGGG + Intronic
1067645774 10:48101283-48101305 AAGGGGACACAGGAGCATCAGGG - Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1072719748 10:97773086-97773108 TAGGGAACACAGTGGGAAGAGGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1077717085 11:4592433-4592455 TAGGGTACACAAAAGTATGCAGG + Intergenic
1081826749 11:46061676-46061698 TAGGTTGGACAGGAGGATGGAGG - Intronic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1084702440 11:70796187-70796209 TAGGGCACACAGGGTGATGCTGG + Intronic
1086624008 11:88923511-88923533 TAGAGTAGACAGTAGAATGATGG + Intronic
1087086440 11:94223526-94223548 TAGGGTACACCAGAGGCTGCAGG - Intergenic
1087359781 11:97143652-97143674 TAGGTGATACAGGAAGATGAGGG + Intergenic
1089473002 11:118735924-118735946 TGGGCTACTCAGGAGGCTGAGGG - Intergenic
1090079294 11:123600850-123600872 TAGGAAGCACAGCAGGATGAGGG + Intronic
1091408577 12:224282-224304 TTGGGGACACAGGAGCTTGAGGG - Intronic
1092747609 12:11688569-11688591 CAGGTTACACAGCAGGATGCAGG - Intronic
1094447368 12:30546245-30546267 TTGTGTACATAGGAGGATTATGG + Intergenic
1095811183 12:46373973-46373995 TAGGGAACACAGGAGTGTGATGG - Intergenic
1096601217 12:52731064-52731086 TAGGGAACACAGGGAGAGGATGG + Intergenic
1098185360 12:67890681-67890703 GAGTGGACACAGGAGGATGGTGG + Intergenic
1099293588 12:80802753-80802775 CCGGCTACACAGGAGGAGGAGGG - Intronic
1099492988 12:83308734-83308756 TCAGTTACACAGGAGGCTGAGGG - Intergenic
1099851219 12:88099750-88099772 GAGGGAAAACAGGAGGCTGAGGG + Intronic
1102084114 12:110122336-110122358 TAGGGTTGACATGAGGATTAAGG - Intergenic
1102187770 12:110963192-110963214 TCCGGCACACAGGAGGAAGAGGG - Intergenic
1102484002 12:113243941-113243963 TAGGGGACAGAGGAGAATGTAGG - Intronic
1104076501 12:125394424-125394446 AATGATACACATGAGGATGATGG + Intronic
1107924248 13:45243193-45243215 TAAAGTACACAGAAGGATGGAGG - Intronic
1108442297 13:50467153-50467175 TGTGGTTCACAGGATGATGAGGG - Intronic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1108621834 13:52192483-52192505 TACTGTACTCGGGAGGATGAGGG + Intergenic
1109508422 13:63336971-63336993 TTGTGTACCTAGGAGGATGATGG + Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110884847 13:80619819-80619841 AAGGACACACAGGTGGATGAAGG - Intergenic
1111093830 13:83483291-83483313 ATTGGTACACAGGAGGCTGAAGG + Intergenic
1112232263 13:97601117-97601139 TAGGGGAGCAAGGAGGATGAGGG + Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118162312 14:63302348-63302370 TTGTGTACCCAGGAGGATTATGG - Intergenic
1119334241 14:73819166-73819188 TAGGTTACACTGGAGTAGGATGG - Intergenic
1119464758 14:74847925-74847947 TAAGGTAGACAGGGGGATGTGGG - Intronic
1122447243 14:101778943-101778965 TAAGCTACTCAGGAGGCTGAGGG + Intronic
1122481279 14:102049078-102049100 TGGGGCAAACAGGAGGATGCTGG - Intronic
1122849027 14:104516705-104516727 CAGGGTAGGCAGGAGGCTGAGGG + Intronic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1123540800 15:21288183-21288205 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
1124452384 15:29807485-29807507 TCAGGTAGACAGGAGGAGGAAGG + Intronic
1124810673 15:32935034-32935056 TCAGGTACTCAGGAGGCTGAGGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1126740871 15:51774997-51775019 TAGGGAACACAGGACGAGGGAGG - Intronic
1127148335 15:56048666-56048688 TAGGGTCAGCAGGAGAATGAAGG + Intergenic
1128038415 15:64547593-64547615 CAGGTTACTCAGGAGGATGATGG + Intronic
1128662000 15:69508327-69508349 TAGAGGACACAGTAGGGTGATGG + Intergenic
1128755787 15:70182771-70182793 CAGGGTACACAGGTAGATCAAGG - Intergenic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132385635 15:101398088-101398110 GGGGGTACACAGGTGGGTGACGG - Intronic
1202949113 15_KI270727v1_random:15325-15347 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
1133230148 16:4362531-4362553 TAGGGTACACAGGAGGATGACGG + Intronic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1135472351 16:22742661-22742683 TAGATTCCACAGGCGGATGAAGG + Intergenic
1135773898 16:25239138-25239160 TCGGGTACAGAAAAGGATGAGGG + Exonic
1135901572 16:26464826-26464848 TTGGGTACTTAGGAGGATTATGG - Intergenic
1136345980 16:29676328-29676350 TAGGGTACCCAGAAGGAAAAGGG + Intronic
1138345929 16:56320211-56320233 TTGGGCACACGGGAGGAGGATGG - Intronic
1138957339 16:61987053-61987075 TATGCTACACAGGAGGAAGATGG + Intronic
1139451915 16:67034700-67034722 TGGGGTACACTGGAGGTGGAAGG + Intronic
1139998300 16:71001479-71001501 TAGAGTATACAGGAGGGTGTTGG + Intronic
1144059521 17:11570171-11570193 TGGTGAACACAGGAGGAGGAAGG + Intergenic
1144579236 17:16448764-16448786 TTGAGGACACAGGAGGAGGAGGG + Intronic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1151549411 17:74813447-74813469 AAGGGGAGACAGGAGAATGAGGG - Intronic
1152304649 17:79513513-79513535 GGGGGTCCACAGGAGGATGGGGG - Intronic
1154115710 18:11611523-11611545 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154120154 18:11645742-11645764 TAAAGTATACAGGAGGATGTGGG + Intergenic
1154282723 18:13020468-13020490 AAGTGTCCACAGAAGGATGAGGG - Intronic
1154496907 18:14968098-14968120 TAGGAGAAACAGGAAGATGATGG - Intergenic
1158604893 18:58887102-58887124 GAGGGAACACAGGCAGATGATGG + Intronic
1158807909 18:60997547-60997569 TAAAGTGCAGAGGAGGATGAAGG + Intergenic
1161221409 19:3119836-3119858 TAGGGCACAGAGGAGGATGCAGG - Intronic
1162672783 19:12271849-12271871 TAGAGTATACAGGAGAATGTGGG + Exonic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1163704681 19:18805251-18805273 TTGGGGACAAAGGAGGATGCTGG + Intergenic
1166656826 19:44618376-44618398 CAGGGGACACAGGAGTGTGACGG + Intronic
1166736615 19:45089649-45089671 TGGGCTACTCAGGAGGCTGAGGG - Intronic
1167751404 19:51382524-51382546 TAGGGCAGACAGGATCATGAAGG + Exonic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
926195512 2:10761417-10761439 GAGGGTAACCAGGAGGATGGCGG - Intronic
927253583 2:21019987-21020009 GAGGGAAGACAGGAGGATAAGGG - Intronic
927413871 2:22856339-22856361 TAGGCCACACAGGAGGAGGAAGG + Intergenic
927501762 2:23588049-23588071 GAGGTTACAGAGAAGGATGAGGG - Intronic
928943632 2:36752660-36752682 TAGGAGACACTGGAGGAGGAGGG - Intronic
929242237 2:39665554-39665576 AAGGGGAGAGAGGAGGATGAGGG + Intronic
931234588 2:60402553-60402575 GATGGGACACAGGGGGATGAAGG + Intergenic
931513750 2:63028515-63028537 TCAGGTACTCAGGAGGCTGAGGG - Intronic
934963466 2:98698588-98698610 TAAGGTACAGAGGATAATGAAGG - Intronic
937295666 2:120808389-120808411 GAGAGGTCACAGGAGGATGATGG - Intronic
938038091 2:128053243-128053265 TTGTGTACCCAGGAGGATTATGG + Intergenic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
938895117 2:135742061-135742083 TGAGGTATACAAGAGGATGAAGG - Intronic
939209656 2:139157708-139157730 TAAAGTATACAGGAGGATGTGGG + Intergenic
939340864 2:140894826-140894848 TAAGCTACTCAGGAGGCTGAAGG + Intronic
941398272 2:164998054-164998076 TTGGTTACTCAGGAGGGTGAGGG - Intergenic
942469567 2:176245570-176245592 TAGGATGCAAAGGAGGATGCTGG + Intergenic
942816700 2:180060867-180060889 TAGGGGTTGCAGGAGGATGAAGG - Intergenic
943137420 2:183932218-183932240 TAGGGTAGAAAGGAGGATTGAGG + Intergenic
943708323 2:191060065-191060087 TAGGGTGCAGAGGAGGAGGATGG + Intronic
944734359 2:202548335-202548357 TAAGCTACATAGGAGGCTGAGGG + Intronic
946877134 2:224140429-224140451 TAGGGCAGAAAGGAGGATGTGGG - Intergenic
947386213 2:229593257-229593279 TAGGCTACAAGGGAGGAGGAAGG - Intronic
948554394 2:238797434-238797456 TGGGGTCCACAGGAGGAGGACGG + Intergenic
948994555 2:241571890-241571912 AAGGCCCCACAGGAGGATGACGG + Intronic
949075931 2:242057877-242057899 TGGAGGACACAGGAGCATGAGGG + Intergenic
1170206993 20:13809211-13809233 AAGGGTGCACTTGAGGATGATGG + Intronic
1170662665 20:18358243-18358265 GAGGATGAACAGGAGGATGAAGG + Intergenic
1172591296 20:36119901-36119923 GAGGGTACAGAGGAGGAGGGCGG - Intronic
1172591359 20:36120354-36120376 TAGAGCACACAGGAGGAAAAGGG + Intronic
1173152561 20:40580366-40580388 TATAGTATACAGGAGGATGCGGG + Intergenic
1175020756 20:55846361-55846383 TATGGCACACATGAGGATGGTGG + Intergenic
1175103724 20:56598909-56598931 TAGGGTTCGCAGCAGGATTAAGG + Intergenic
1177301326 21:19249278-19249300 TTGGGTACTCAGGAGGAAAAGGG - Intergenic
1182224699 22:28787604-28787626 TTGGGTACTCAAGAAGATGAAGG - Exonic
1182471183 22:30549247-30549269 TAAGCTACTCAGGAGGCTGAAGG + Intergenic
1183107784 22:35627368-35627390 TGGGGTACCCAGGACGAGGACGG + Intronic
1185276073 22:49950641-49950663 AAGGGTACACTGGCTGATGAGGG + Intergenic
1185281719 22:49972542-49972564 TACGGGACACAGGAGGCTGGGGG - Intergenic
950878807 3:16304691-16304713 TAGAGATCACAGGAGGGTGAAGG + Exonic
953252886 3:41262396-41262418 CAGCGTGCAAAGGAGGATGATGG + Intronic
953259041 3:41320192-41320214 TAGATTTCTCAGGAGGATGAAGG + Intronic
953488496 3:43326308-43326330 TAGGGTACAGAGGAAGGTGGTGG - Intronic
954238869 3:49277680-49277702 TGGGTTCCACAGGAGGTTGAGGG + Exonic
954774525 3:53004750-53004772 TATGTTACACAGGTGAATGAAGG - Intronic
954793458 3:53149258-53149280 TAGAGCACACAGGAGGATCCAGG + Intergenic
955175644 3:56611288-56611310 TAGTGTACCTAGGAGGATTATGG + Intronic
955737702 3:62057322-62057344 CAGTGTAAACTGGAGGATGAAGG - Intronic
958476208 3:94586321-94586343 AAGGGTACACTGGAGGAGAATGG - Intergenic
959046954 3:101485030-101485052 TTGGGTACCTAGGAGGATTATGG - Intronic
961191648 3:124967581-124967603 TAAGGTATACAGGATGGTGAGGG + Exonic
961360064 3:126361361-126361383 TAGGGGGCCCAGCAGGATGACGG + Intergenic
966860240 3:184227657-184227679 TAGGGCACCCTGCAGGATGAGGG - Intronic
970350257 4:15195200-15195222 TTGGGTAAACGGGAGGGTGAGGG - Intergenic
970606205 4:17684363-17684385 TAGGGAACTCAGCAGGAAGAAGG + Intronic
970614916 4:17760028-17760050 TAGGGGACACAGCATGATGCAGG - Intronic
971061479 4:22976842-22976864 TAGAATATACAGGAGGAGGAAGG + Intergenic
971253481 4:24992774-24992796 GAGGGGACACAAGAGGGTGAGGG - Intergenic
972171406 4:36350103-36350125 TTGAGTACACAGGAGGAGGGTGG - Intergenic
972718572 4:41673736-41673758 TGGGGTAGATAGGAGGATGAGGG + Intronic
975542322 4:75526810-75526832 TAAGGAACACAGGAAGAAGATGG - Intronic
976297302 4:83485086-83485108 CAGGCTACACAAGAGGACGAGGG + Exonic
976443653 4:85105589-85105611 GATAGTACACAGGTGGATGATGG - Intergenic
976968436 4:91075070-91075092 TAAGGTACACAGGGAGGTGAGGG - Intronic
978489406 4:109296082-109296104 TGTTGTAGACAGGAGGATGATGG - Intronic
978835616 4:113146012-113146034 TAGGCCACAAAGGAGGAGGAAGG + Intronic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
980541886 4:134206744-134206766 TGGGGGACAGAGGAGGATCAGGG - Intergenic
980977268 4:139623348-139623370 TAGGTAACAAGGGAGGATGAGGG + Intergenic
982390629 4:154859485-154859507 GAGGTTGCACAGGAGGTTGAAGG + Intergenic
984739786 4:183149961-183149983 TAGGGTACCCAGGAGGCTTCTGG + Intronic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
986217439 5:5732667-5732689 CAGGGTACACTGGAGGGTGGAGG - Intergenic
986659082 5:10042878-10042900 TAAAGTACATAGGTGGATGAAGG - Intergenic
988484936 5:31660835-31660857 TAAGCTACTCAGGAGGCTGAGGG - Intronic
990118371 5:52417718-52417740 TAGAGGACACAGGTGGATGGGGG - Intergenic
990740243 5:58905120-58905142 AATGGTACACAGGAGGGAGAAGG - Intergenic
992373051 5:76164887-76164909 TAAAGTATACAGGAGGATGTGGG - Intronic
994311923 5:98282953-98282975 TAGGAAACACAGAAGGAAGAAGG - Intergenic
994729155 5:103471541-103471563 AAGGCTACACAGGAGGGTGTTGG - Intergenic
995485740 5:112638303-112638325 AGGGGTACACAGAAGGATGGAGG + Intergenic
997033634 5:130160758-130160780 GAGGGTTCAGTGGAGGATGAGGG + Intronic
997265353 5:132491675-132491697 TAGGGAACAGAGGAGGAGAAGGG + Intergenic
998538032 5:142952456-142952478 TACGGTACATAGGATGTTGAGGG - Intronic
1000379988 5:160620471-160620493 CAGGGTGCAGAGGAGGCTGAAGG + Exonic
1001276514 5:170355264-170355286 TGGGGTAAACAGGAGGTTAATGG + Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1002049313 5:176560980-176561002 TAGGGCACACTGGGGGAGGAGGG + Intronic
1002904912 6:1440376-1440398 AAGGGGACACTGGCGGATGATGG + Intergenic
1007085458 6:39141208-39141230 TAGGGGACATGGGAGGAAGAGGG + Intergenic
1007703258 6:43776463-43776485 TGGGGTGCACTGGAGCATGAAGG - Intronic
1009422402 6:63478454-63478476 TAGGGCCCACAGGAGTATTAGGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1011917158 6:92521416-92521438 TAGGATACACAGCAAGAAGAAGG + Intergenic
1014843422 6:126246226-126246248 TATGGTAAACAGGAGGCTTATGG + Intergenic
1016993998 6:149948113-149948135 TGGGGTGTGCAGGAGGATGATGG - Intronic
1018310552 6:162503817-162503839 GTGGGTAAACAGGAGGGTGATGG + Intronic
1018935186 6:168269444-168269466 TAGGGGGGACAGGAGGATTATGG + Intergenic
1023982928 7:45080168-45080190 GAGGGGACACAGGGTGATGAAGG + Intergenic
1023999780 7:45182756-45182778 TAGGGTATCCTGGATGATGAAGG + Intronic
1024610465 7:51059750-51059772 TAGTGCAAACAGCAGGATGAGGG - Intronic
1025908292 7:65806901-65806923 ATGGGAACACAGGGGGATGAGGG - Intergenic
1026509341 7:71015562-71015584 AAAGGAAGACAGGAGGATGAAGG + Intergenic
1026848739 7:73712010-73712032 GAGGGTCCAGAGGAGGATGCGGG - Intronic
1027239374 7:76317515-76317537 AAGGGCGCACAGGAGGCTGATGG + Intergenic
1027350463 7:77306406-77306428 TTGTGTACCCAGGAGGATTATGG + Intronic
1027536625 7:79411267-79411289 TAGGGTACAAAGAAGAATTAAGG + Intronic
1028633585 7:92962515-92962537 AAGGATACATAGGAGGTTGATGG + Intergenic
1028858505 7:95619798-95619820 GAGGCTACTCAGGAGGTTGAGGG - Intergenic
1029027723 7:97435202-97435224 AAAGGTACACAGGAAAATGAAGG - Intergenic
1029552929 7:101247571-101247593 CAGGGGACACAGGAAGATGAAGG + Intronic
1031169842 7:118279183-118279205 TAGGGTAAAAAGGAGGCTGGTGG + Intergenic
1032021710 7:128410140-128410162 GAGGGTACATCGGGGGATGAGGG + Exonic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1032421909 7:131788007-131788029 TTGAGTACAAAGGAGCATGAGGG - Intergenic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1035028380 7:155842026-155842048 TCTGTAACACAGGAGGATGAGGG - Intergenic
1035822198 8:2605500-2605522 CAGGATACACAGGCTGATGATGG + Intergenic
1038069969 8:24002947-24002969 TAGGGCACAAAGCAGGTTGAAGG + Intergenic
1039194771 8:35018848-35018870 TGGGGTCCACTGGGGGATGAAGG - Intergenic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1041685737 8:60642910-60642932 TAAGGTACAAAGGATGATGGTGG - Intergenic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1043978867 8:86615097-86615119 TAAAGTATACAGGAGGATGTGGG + Intronic
1046083641 8:109403938-109403960 TTGGGTACACAGTAGGATGAGGG + Intronic
1047767666 8:128002636-128002658 GAGAGGACACAGGAGGATGGAGG - Intergenic
1048527809 8:135219952-135219974 CAGGATACACAGAAGGATGCAGG + Intergenic
1049494932 8:142925450-142925472 TCGGGTTCACATGAAGATGAGGG + Intergenic
1049533881 8:143169159-143169181 TGGGGAGCACAGGAGCATGAGGG + Intergenic
1049533931 8:143169361-143169383 GAGGGTAAGCAGTAGGATGATGG - Intergenic
1049554467 8:143275171-143275193 TAGGGGATGCAGGAGGAGGAGGG - Intronic
1050175476 9:2865575-2865597 TGGGGTACATAGGGAGATGAGGG - Intergenic
1051000739 9:12279139-12279161 TAGGGTAAAGAGGAGGAGTAAGG - Intergenic
1051596206 9:18826524-18826546 TAGGGCACAAAGGAGGTAGAGGG - Intronic
1051872266 9:21752067-21752089 TAGAGAACACTGGAGGATGGGGG + Intergenic
1055357373 9:75451286-75451308 GAGGGAACACAGGATGATGTGGG - Intergenic
1055644000 9:78345915-78345937 TAGGGGACACAGGAAGAAGTGGG + Intergenic
1056719584 9:89060403-89060425 GATGGTACACAGGATGATCAGGG + Intronic
1057776550 9:98015354-98015376 TACTGTACAGAGGAGGAAGAAGG + Exonic
1058205240 9:102097420-102097442 AGGGGTGTACAGGAGGATGATGG + Intergenic
1058410386 9:104724982-104725004 TTGGGTACCTAGGAGGATTATGG - Intergenic
1060323395 9:122587922-122587944 TTGGCTACAAAGGAGCATGAGGG + Intergenic
1060370872 9:123069767-123069789 CAGGCTACTCAGGAGGCTGATGG + Intronic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1186695369 X:12025130-12025152 TAGGTTACACAGAAGAAAGAAGG - Intergenic
1188930669 X:36106841-36106863 TAGAGTACACAGGACGTTTAAGG + Intronic
1189229516 X:39441346-39441368 TAGGGTGCCCAAGAGGATGATGG + Intergenic
1191067631 X:56367208-56367230 TTGTGTACCTAGGAGGATGATGG + Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1191830849 X:65414543-65414565 TATGGCACACAGGAGCATTAGGG + Intronic
1191903583 X:66064403-66064425 TTGTGTACATAGGAGGATTATGG + Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1194080700 X:89461052-89461074 TGGGGTATACTTGAGGATGAGGG + Intergenic
1194806304 X:98332443-98332465 TAGGGGGCAGAGGAGGAGGAGGG + Intergenic
1200433372 Y:3117255-3117277 TGGGGTATACTTGAGGATGAGGG + Intergenic
1201855964 Y:18542513-18542535 TAAACTACACAGGAGGATGTGGG + Intergenic
1201877357 Y:18777872-18777894 TAAACTACACAGGAGGATGTGGG - Intronic
1202297023 Y:23369795-23369817 TAGAGTAGACAGTAGGATAAGGG + Intergenic
1202369245 Y:24186093-24186115 CAGGGTACACAGGGGTCTGAGGG + Intergenic
1202501540 Y:25484024-25484046 CAGGGTACACAGGGGTCTGAGGG - Intergenic
1202573784 Y:26300802-26300824 TAGAGTAGACAGTAGGATAAGGG - Intergenic