ID: 1133234069

View in Genome Browser
Species Human (GRCh38)
Location 16:4379568-4379590
Sequence CAGGGCAGACAGAAGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 811
Summary {0: 1, 1: 0, 2: 3, 3: 77, 4: 730}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133234069_1133234074 -7 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234074 16:4379584-4379606 TGCCCTGACGTGGCTGCTGGGGG 0: 1
1: 0
2: 2
3: 19
4: 247
1133234069_1133234075 -6 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234075 16:4379585-4379607 GCCCTGACGTGGCTGCTGGGGGG 0: 1
1: 0
2: 0
3: 25
4: 395
1133234069_1133234072 -9 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234072 16:4379582-4379604 TCTGCCCTGACGTGGCTGCTGGG 0: 1
1: 0
2: 0
3: 25
4: 194
1133234069_1133234071 -10 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234071 16:4379581-4379603 GTCTGCCCTGACGTGGCTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 143
1133234069_1133234073 -8 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234073 16:4379583-4379605 CTGCCCTGACGTGGCTGCTGGGG 0: 1
1: 0
2: 4
3: 33
4: 277
1133234069_1133234078 4 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234078 16:4379595-4379617 GGCTGCTGGGGGGCTACCTGAGG 0: 1
1: 1
2: 6
3: 34
4: 319
1133234069_1133234079 10 Left 1133234069 16:4379568-4379590 CCTGCTTTCTTCTGTCTGCCCTG 0: 1
1: 0
2: 3
3: 77
4: 730
Right 1133234079 16:4379601-4379623 TGGGGGGCTACCTGAGGTGACGG 0: 1
1: 0
2: 1
3: 18
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133234069 Original CRISPR CAGGGCAGACAGAAGAAAGC AGG (reversed) Intronic
900764194 1:4493072-4493094 CAGCGCAGCTAGAATAAAGCAGG + Intergenic
900812465 1:4817387-4817409 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
901213449 1:7539751-7539773 GAGGGCAGACATAGGAAGGCAGG + Intronic
901577560 1:10212503-10212525 AAGGCCACAAAGAAGAAAGCAGG - Intronic
901986434 1:13078923-13078945 CAGGGCAGCGAGAAGAGAGTGGG - Intergenic
901995378 1:13147844-13147866 CAGGGCAGCGAGAAGAGAGTGGG + Intergenic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
902797657 1:18809902-18809924 AAGGGAAGAAAGAAGAAGGCAGG + Intergenic
903186445 1:21631976-21631998 CAGGCCAGACAGAGCAGAGCCGG - Intronic
903553663 1:24177489-24177511 CACGGGAGAAAGAAGGAAGCTGG + Intronic
903782429 1:25829669-25829691 CAGGGCTGGCAGAACAAAGCAGG - Exonic
903857139 1:26344100-26344122 CAGCGCAGGCAGGAGAAAGCTGG - Exonic
903993625 1:27290740-27290762 CAAGGGAGACAGATTAAAGCAGG - Intronic
904802874 1:33108023-33108045 TTGGGCAAAAAGAAGAAAGCTGG + Intronic
905417774 1:37816105-37816127 CTGGGCAGGCAGAACCAAGCAGG - Intronic
905510218 1:38513420-38513442 CATGGAAGAAAGAAGAAAGGTGG - Intergenic
905906271 1:41620546-41620568 CAGTGCAGAGAGAGAAAAGCAGG - Intronic
906895177 1:49763315-49763337 CTGAGCAGAGAGAACAAAGCTGG - Intronic
906990029 1:50727775-50727797 CAGTGCAGCTAGAATAAAGCAGG + Intronic
907245844 1:53108616-53108638 CCAGGCAGAAAGAAGAAAGTTGG - Intronic
907625745 1:56027706-56027728 CACGGGAGAAAGATGAAAGCTGG - Intergenic
907821884 1:57978115-57978137 CTGGGCAGGAAGAACAAAGCTGG + Intronic
908346375 1:63237722-63237744 CAGTGCAGCCAGAATAAAGCAGG + Intergenic
908555872 1:65255636-65255658 CACTGCAGACAGAGAAAAGCCGG - Intronic
908837841 1:68245826-68245848 CAGAGCAGTCAGTAGAATGCTGG - Intergenic
908842768 1:68295633-68295655 CGGGGCAGTCAGAGGAGAGCGGG - Intergenic
908968829 1:69800183-69800205 CTGAGCAGAAAGAACAAAGCTGG - Intronic
908981210 1:69961531-69961553 CTGGGCAGAAAGAACAAAGCTGG + Intronic
909244753 1:73266766-73266788 CTGAGCAAACAGAACAAAGCTGG + Intergenic
909742295 1:79045433-79045455 CGGGGCAGTCAGAGGAAAGCTGG - Intergenic
909759942 1:79273672-79273694 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
909800821 1:79805717-79805739 CAAGGAAGAAAGGAGAAAGCAGG - Intergenic
910208288 1:84769561-84769583 CAGGGCAAGCAGAGTAAAGCTGG - Intergenic
910455095 1:87389394-87389416 CAGGGAAGACAGAAAGAAGTGGG + Intergenic
911089776 1:94009320-94009342 CAGGGCAGACTGGAGGAAGTGGG - Intronic
911692409 1:100849286-100849308 AAGGGCAGACAGAATTAAGGAGG + Intergenic
912150939 1:106857914-106857936 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
912743149 1:112221099-112221121 CTGAGCAAAAAGAAGAAAGCTGG + Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
913040003 1:115012682-115012704 CAGGACACACTGAAGCAAGCAGG - Intergenic
913049404 1:115103814-115103836 CAGGGCAGAGAGAATACTGCAGG + Intergenic
913098912 1:115545313-115545335 CCGTGGAGACAGCAGAAAGCAGG + Intergenic
913227307 1:116711478-116711500 CAAAGCAGGCAGAAAAAAGCAGG + Intergenic
913227308 1:116711492-116711514 AAAAGCAGGCAGAAGAAAGCAGG + Intergenic
913227309 1:116711506-116711528 GAAAGCAGGCAGAAGAAAGCAGG + Intergenic
913242714 1:116843471-116843493 CAGCGCAGCTAGAATAAAGCAGG + Intergenic
913656099 1:120961609-120961631 CATGACAAACAGAAGGAAGCAGG - Intergenic
914520657 1:148412841-148412863 CATGACAAACAGAAGGAAGCAGG - Intergenic
914985554 1:152454020-152454042 CTAGGCAGAAAGAAGAAACCTGG - Intergenic
915123106 1:153644930-153644952 CAGGGCAAAGAGGAGAAATCTGG - Intronic
915307241 1:154987634-154987656 GGGGACAGAAAGAAGAAAGCAGG + Intronic
915396574 1:155589772-155589794 CAGGGCAGCTAGAATAAAGCAGG - Intergenic
915412374 1:155711976-155711998 CAGGGCAGCTAGAATAAAGCAGG - Intronic
915731260 1:158056076-158056098 CAGGGCAGAAGGGAGGAAGCAGG - Intronic
915749967 1:158197610-158197632 CTGAGCAGACAGAACAAAGTTGG - Intergenic
915785044 1:158601352-158601374 CAGGGCAAAAAGAACAAAGCTGG + Intergenic
916757327 1:167785287-167785309 CCAGGCAGACAGAGGACAGCTGG + Intronic
916986184 1:170193477-170193499 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
917418830 1:174840505-174840527 TAGGGTATAAAGAAGAAAGCGGG + Intronic
919363724 1:196629823-196629845 GAGGGGAGAAAGAAGAAAGGAGG + Intergenic
920011188 1:202868911-202868933 CAGGGAAAACAAAAAAAAGCTGG - Intergenic
920181153 1:204132260-204132282 TGGGGAAGACAGAAGGAAGCTGG + Intronic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920687786 1:208122714-208122736 CAAGGCAGGGGGAAGAAAGCAGG + Intronic
920804587 1:209220515-209220537 CAGTCCAGAAAGAAGAAAACTGG - Intergenic
921031407 1:211338024-211338046 GAGTGCAGATAGAAGAGAGCAGG + Intronic
922223482 1:223626430-223626452 CAGGGCAGCCAGAGGGCAGCTGG + Intronic
922226503 1:223650274-223650296 CTGGGCAGAAAGAATAAGGCAGG - Intronic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922388153 1:225109156-225109178 CTGGGCAAAAAGAACAAAGCTGG - Intronic
922718974 1:227890705-227890727 CAGGGCAGAAAGAAGAGGGTGGG + Intergenic
922806649 1:228393801-228393823 TGGGGCATACAGAAGAAGGCAGG - Exonic
922998634 1:229987241-229987263 CAGGGCAGAAAGAAAGGAGCTGG + Intergenic
924097678 1:240570941-240570963 CAGTGCATACAGGAGAAAACTGG + Intronic
924828736 1:247570321-247570343 AAATGCAAACAGAAGAAAGCGGG - Intronic
1062798776 10:363957-363979 CAAGGCAGGGAGAAGAAAACTGG + Intronic
1063006595 10:1977458-1977480 CAGGGCATACAGTATAAAGACGG - Intergenic
1063014050 10:2057225-2057247 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1063422427 10:5923944-5923966 CCAGGCAGACAGAAGGATGCAGG - Intronic
1063451762 10:6154787-6154809 CAGATCAGACAGAAGGCAGCTGG - Intronic
1063464548 10:6234271-6234293 CAGGGCTCACAGCAGAAGGCAGG - Exonic
1064363654 10:14688061-14688083 CAGCACAGCTAGAAGAAAGCAGG + Intronic
1064835884 10:19529523-19529545 CAGAGAAGACAGAAAAAAACAGG + Intronic
1065134366 10:22653536-22653558 GGAGGCAGACAGAAGAAAGGAGG + Intronic
1066130062 10:32384510-32384532 CTGAACAGAAAGAAGAAAGCTGG + Intergenic
1067077091 10:43194107-43194129 CAGGGCAGCCTGCAGAATGCAGG - Intergenic
1067549615 10:47225334-47225356 CGGGGATGACAGAAGAATGCAGG + Intergenic
1067676438 10:48383334-48383356 GATGGCAGACAGAAGAAGACAGG + Intronic
1067766782 10:49092934-49092956 CGAGGCAGTCAGAAGAGAGCTGG + Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1068416963 10:56735304-56735326 AAGGAAAGACAGAAGAAGGCAGG - Intergenic
1068543388 10:58320945-58320967 CATGGGAGAAAGATGAAAGCCGG - Intergenic
1068755044 10:60643281-60643303 CAGCACAGCCAGAATAAAGCAGG + Intronic
1068771962 10:60831685-60831707 CAAGGCAAAAAGAACAAAGCTGG + Intergenic
1069108334 10:64411017-64411039 CATGGGAGAAAGATGAAAGCTGG + Intergenic
1069614639 10:69799271-69799293 CAGGGCTCCCAGAAGAAAGGGGG - Intergenic
1069911965 10:71765372-71765394 CAGGGCAGGCAGAGTAGAGCTGG + Intronic
1069914068 10:71776393-71776415 CAGGCCAGAGAACAGAAAGCAGG - Intronic
1069914229 10:71777550-71777572 AAGGGCAAGGAGAAGAAAGCAGG - Intronic
1069925004 10:71843285-71843307 CAGGCCAGACAGAAGAGAGGGGG + Intronic
1070060245 10:72975546-72975568 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1070662419 10:78316787-78316809 CAGGGCAGGCAGAGGGAACCAGG + Intergenic
1070728243 10:78807109-78807131 CAAGGCAGAGGAAAGAAAGCTGG + Intergenic
1070737529 10:78874176-78874198 CAGCGCAGCCAGAATAAAGCAGG + Intergenic
1071249374 10:83801384-83801406 CAGAGCAGCCAGAATAAAGTAGG - Intergenic
1071336895 10:84607679-84607701 GAGGGCAGACACAACAAACCCGG + Intergenic
1072392797 10:95005671-95005693 CTAGGCAAACAGAAGAAATCTGG - Intergenic
1072735487 10:97876223-97876245 CAGCCCAGACAGACGAAGGCAGG - Intronic
1072785360 10:98275765-98275787 CTGGGCAGGCAGAAGAGACCCGG + Intergenic
1074721312 10:116267619-116267641 CAGGGCAGACAGTAGGTAACAGG + Intronic
1074872884 10:117590933-117590955 CATGGGAGAAAGATGAAAGCAGG + Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075443952 10:122500985-122501007 CAGGGCACACAGAGGTCAGCGGG - Intronic
1075726554 10:124613542-124613564 CAGGGCAGAGGGCAGAAGGCAGG - Exonic
1076174165 10:128353940-128353962 GTGGGCAGACATAAGAAAACTGG + Intergenic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076363711 10:129908773-129908795 CAGGCCAGACAGTGGAAAGGAGG - Intronic
1077202051 11:1313812-1313834 CTGAGCAGAAAGAACAAAGCTGG - Intergenic
1077443758 11:2580774-2580796 AAGGTCAGGCTGAAGAAAGCAGG - Intronic
1077782678 11:5348668-5348690 CAGGGCGGCTAGAAGAAAGCAGG - Intronic
1078192522 11:9103737-9103759 CAGTGACCACAGAAGAAAGCGGG - Intronic
1078421659 11:11217611-11217633 CATGGGAGAAAGATGAAAGCCGG + Intergenic
1078932863 11:15926316-15926338 CAAAGCAGACAGAAGAAGGTGGG + Intergenic
1079578235 11:22029637-22029659 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
1079654521 11:22972063-22972085 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080515566 11:33016258-33016280 CTGGGTAGAAAGAAAAAAGCTGG - Intronic
1080522714 11:33081671-33081693 CAGGGCAGGATGAAGAAAGGGGG - Intronic
1080616441 11:33948765-33948787 CAGGGCATACAGCACTAAGCAGG + Intergenic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1080825909 11:35849222-35849244 CAGGGCATACACAAGAAAGTAGG - Intergenic
1081588961 11:44407657-44407679 CAGGGCAGAGAGAAAGGAGCTGG - Intergenic
1081798114 11:45836045-45836067 CATTGCACACAAAAGAAAGCAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1082745298 11:56954652-56954674 CAGGCAAGACAGAAGAGTGCAGG + Intergenic
1083529975 11:63411249-63411271 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1083732330 11:64659365-64659387 CAGGGCAAAAAGAAAACAGCAGG - Intronic
1083914883 11:65735396-65735418 CAAGGGAGAAAGATGAAAGCCGG - Intergenic
1084177691 11:67431963-67431985 CAGAGGAGACACTAGAAAGCAGG - Intronic
1085171626 11:74454466-74454488 CTGGGGAGACAGCAGGAAGCAGG - Intergenic
1085200271 11:74697646-74697668 GAGAACAGACAGAAGAAAACAGG - Intronic
1085405782 11:76261036-76261058 CAGGCCGGACAGCAGAAATCTGG + Intergenic
1085409900 11:76284688-76284710 CAGGGCAGGGTGAAGACAGCAGG + Intergenic
1085869998 11:80338338-80338360 TAGGGAAGAAAGAAGAAAGGTGG - Intergenic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086726484 11:90191308-90191330 CAAAGCAGATGGAAGAAAGCAGG - Intronic
1086740820 11:90366715-90366737 CAGTATAGACAGAAGAAAACGGG + Intergenic
1087376594 11:97350427-97350449 CTAAGCAGAAAGAAGAAAGCTGG - Intergenic
1087731992 11:101789323-101789345 CAGTGCCGATAGAATAAAGCAGG - Intronic
1087814112 11:102639390-102639412 CAAGGAAGACAGAAGAGAGCTGG + Intergenic
1087887721 11:103499124-103499146 CAGAGGAGACAAAAGAAAACAGG + Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088707361 11:112475885-112475907 GAGGGTAGACAGAAGAAGGTGGG - Intergenic
1088814110 11:113409983-113410005 CAGGGCCGTCAGAAGGCAGCAGG + Exonic
1089406556 11:118202532-118202554 CAGGGCAGAGATAAGAATGGGGG + Intronic
1089531445 11:119132467-119132489 TGGGGCAGGCAGAAGAAAGGAGG - Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089659103 11:119974373-119974395 CAGGGCTCAGAGAAGACAGCAGG - Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090162278 11:124508383-124508405 AATGGAAAACAGAAGAAAGCAGG - Intergenic
1090350163 11:126102902-126102924 CTGGGCAAAGAGAAGAAAGGAGG + Intergenic
1090380311 11:126322173-126322195 CATTGGAGACAGAAGAAAACAGG + Intronic
1091047332 11:132336466-132336488 CAGGGCAGAATGGAGAAAGCGGG - Intronic
1091123316 11:133075014-133075036 GAGGGCAGAGAGCAGAAAGAAGG + Intronic
1091809737 12:3386545-3386567 ACGGGCAGACAGAAGAATGAAGG - Intronic
1092111230 12:5966144-5966166 CAGGGCAGTCAGGAGACAGCAGG - Intronic
1092171250 12:6375239-6375261 CAGGCCAGAAAGAGGAGAGCAGG - Intronic
1092244740 12:6857426-6857448 CAGGGAAGACAGATGAAACCGGG - Intronic
1092477911 12:8834837-8834859 GAGGGCAGAGGCAAGAAAGCAGG - Intronic
1094042853 12:26135450-26135472 CAGTACAGACAAAAGAGAGCTGG + Intronic
1094142319 12:27193960-27193982 CAGGGCAGGCATCAGATAGCTGG + Intergenic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096444150 12:51673556-51673578 CTGGGCACCCAGAAGAAAGTTGG + Intronic
1096735438 12:53649661-53649683 CAGTGCAGCTAGAACAAAGCAGG - Intronic
1097803982 12:63945136-63945158 CAAGACAGACAGCAGAAATCTGG + Intronic
1098213167 12:68187424-68187446 CAGGGTAGACAGCAGAGAGTTGG + Intergenic
1098499213 12:71171036-71171058 CAGGAAAGACAGAAAAATGCTGG - Intronic
1098555024 12:71808670-71808692 CCTGGCAGACAGTAGTAAGCAGG - Intergenic
1098883532 12:75940842-75940864 CTGGGCAGGCAGACGAATGCAGG - Intergenic
1099626355 12:85079760-85079782 AAGGGCAAAAAGAAAAAAGCAGG - Intronic
1099997708 12:89796863-89796885 AAGGGCAAACTGAAGAAAGATGG - Intergenic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101748549 12:107563433-107563455 CAGAGGAGACAGAACAAACCAGG + Intronic
1102061248 12:109933226-109933248 CAGGGCAGACATCCAAAAGCAGG + Intronic
1102617267 12:114165515-114165537 AAGGGCTGAAAGATGAAAGCTGG + Intergenic
1102671737 12:114625170-114625192 CATGTCAGAGAGAAGAAACCAGG - Intergenic
1103164029 12:118754817-118754839 GAGGGTAGAGAGCAGAAAGCTGG - Intergenic
1103273395 12:119691558-119691580 CAGGGCAGACAAAGTAAAGCGGG + Intronic
1103395931 12:120607221-120607243 CATGGGAGAAAGATGAAAGCCGG - Intergenic
1103410158 12:120705742-120705764 CTGGGGAGGCAGCAGAAAGCAGG + Intergenic
1103967157 12:124647072-124647094 GAGGGCAGACAGGAGGAAGTAGG + Intergenic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104694300 12:130851976-130851998 CAGGGAGGAGAGAAGAAAGTGGG - Intergenic
1105981606 13:25521913-25521935 CAGAGCAAAAAGAACAAAGCTGG - Intronic
1106355162 13:28975308-28975330 CAGGCCAGGCAGAAGCAAGTCGG - Intronic
1106500048 13:30319399-30319421 GAGAGCCGACAGAAGAAATCTGG + Intergenic
1106762939 13:32884923-32884945 CATGGCAGAGAGAAGAAAGCTGG + Intergenic
1107181791 13:37469847-37469869 CAAGGCAGGCAGAAGAAGGAGGG + Intergenic
1107963623 13:45579879-45579901 CAGGGCACTCTGAAGAAAGCAGG + Intronic
1108199144 13:48025530-48025552 CAGGGCAGCTAGAACAAAGCAGG + Intergenic
1109298896 13:60569624-60569646 CTGAGCATAAAGAAGAAAGCTGG + Intronic
1109713126 13:66184633-66184655 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1110010891 13:70332028-70332050 CAGGGGAGAAAGATGGAAGCCGG - Intergenic
1110199277 13:72829720-72829742 CTGGGCAAGAAGAAGAAAGCTGG - Intronic
1110528921 13:76573877-76573899 CAGGGCAGAAAGAAGACACTTGG + Intergenic
1111362538 13:87193733-87193755 CAGGGCAGTCAGCTGAAACCAGG - Intergenic
1111671409 13:91334814-91334836 CAGAGCAAAAAGAACAAAGCTGG - Intergenic
1111939621 13:94595885-94595907 CAGGCCAGAGAGAGAAAAGCTGG + Intronic
1112130672 13:96520296-96520318 CTGGGCAGGAAGAACAAAGCTGG - Intronic
1112190660 13:97174287-97174309 GAAGACAGACAGAAGAAATCAGG - Intergenic
1113090372 13:106611822-106611844 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1113096233 13:106666884-106666906 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1113181439 13:107632426-107632448 AAGGGAAGACAGAAGAGAGTAGG - Intronic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113431496 13:110255397-110255419 CAGGGCAGCCGCAAGAAGGCGGG + Intronic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1114367701 14:22047710-22047732 GAGGAAAGACAGAAGAAAGGAGG - Intergenic
1114494754 14:23124954-23124976 CAGGGAGGGCTGAAGAAAGCTGG - Intergenic
1116053998 14:39840163-39840185 GAGGGTAGACAGGACAAAGCGGG - Intergenic
1116290486 14:43030460-43030482 CATGGGAGACAGATGTAAGCTGG - Intergenic
1116504589 14:45663300-45663322 AATGGAAGACAGAAAAAAGCAGG - Intergenic
1116543221 14:46126795-46126817 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
1117001831 14:51377979-51378001 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1118383660 14:65238010-65238032 TAGGGCAGACAGAAGCCAGGAGG - Intergenic
1118383935 14:65239683-65239705 CAGGGCAGACAGAGGCCAGGAGG + Intergenic
1118725827 14:68628477-68628499 CAGAGCCGAGAGAACAAAGCAGG - Intronic
1120535659 14:85691910-85691932 CAGGGTAGGCAGAACATAGCAGG + Intergenic
1120548456 14:85839994-85840016 CATGGAAACCAGAAGAAAGCTGG + Intergenic
1120760939 14:88284614-88284636 CACGGGAGAAAGATGAAAGCTGG + Intronic
1120971733 14:90213593-90213615 CAGGGCAGCCACAAGGCAGCCGG - Intergenic
1121092329 14:91191257-91191279 CAGGGCAGAAAGTAGAATGGTGG + Intronic
1121413300 14:93762454-93762476 CAGGGCACAGAGAAGATAGCTGG - Intronic
1121740740 14:96250680-96250702 CAGGGCTTCCAGAAGAGAGCAGG - Intronic
1122538607 14:102483745-102483767 CAGAGCAGACAGAAAACAGGAGG - Intronic
1124208529 15:27743500-27743522 CTGGGCAGACGGAGGAGAGCAGG - Intergenic
1125332210 15:38593480-38593502 GAGGGAAGGCAGAAGAAAACGGG - Intergenic
1126036502 15:44551061-44551083 CAGGGAAAACAGAATAAAGTGGG - Intronic
1126313897 15:47347493-47347515 CAGTGCAGGCACTAGAAAGCTGG + Intronic
1126423198 15:48497748-48497770 CAGGGTAGATGGAAGAAAGAGGG - Intronic
1126745025 15:51817625-51817647 CAGGGCAGTCGGAGGAGAGCCGG - Intergenic
1127139492 15:55960336-55960358 CAGGGCAGCTAGAATAAAGCAGG + Intronic
1127189885 15:56518353-56518375 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
1127482665 15:59391673-59391695 CAGGGCAGCCAGAAGGTAGGGGG + Intronic
1127800305 15:62471958-62471980 CAGGGGAGAAGGAAGAAAGGAGG - Intronic
1128755607 15:70181621-70181643 GAGGCCAGAAAGAAGAGAGCAGG - Intergenic
1128828552 15:70744635-70744657 CAGGGGTGACAGAAGAAAATGGG + Intronic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129186018 15:73907044-73907066 CAGGCCAGACAGCAGACAACTGG + Intergenic
1129586199 15:76868834-76868856 CTGGGCAAAAAGAATAAAGCTGG + Intronic
1129745846 15:78020229-78020251 CAGGTCAGCCAAAGGAAAGCTGG + Intronic
1129921824 15:79325826-79325848 CACGGGAGAAAGATGAAAGCCGG + Intronic
1130642554 15:85692147-85692169 CAGGGAAGATAGAAGAAATTGGG - Intronic
1130869881 15:87962146-87962168 CAGGGAAGGGAGAAAAAAGCTGG - Intronic
1132679404 16:1133565-1133587 GAGGACAGACAGAGGGAAGCTGG - Intergenic
1132755576 16:1482909-1482931 TGGTGCAGACAGGAGAAAGCGGG - Intergenic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133485594 16:6215381-6215403 CAGGAGAGACAGAAGAAAACAGG + Intronic
1134543216 16:15086696-15086718 CAGGGCAAACAGAAGTGATCAGG - Intronic
1134906685 16:17985883-17985905 CAGGGCAGACTGAAAAAATGGGG + Intergenic
1135597995 16:23757703-23757725 TAGGGCCAAGAGAAGAAAGCTGG + Exonic
1135955711 16:26954852-26954874 AGGGACAGACAGAAGACAGCTGG - Intergenic
1135977837 16:27122558-27122580 CAGCACAGCCAGAACAAAGCGGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136367265 16:29814537-29814559 GAGGACAGACAGGAGAGAGCAGG - Exonic
1136513820 16:30756052-30756074 GAAGGCAGACAGAAGGAAGATGG + Intronic
1137344548 16:47643789-47643811 GAGGGCAGACAGCTGAGAGCAGG + Intronic
1137376960 16:47960141-47960163 GAAGGCAGAAAGGAGAAAGCAGG + Intergenic
1137484464 16:48880228-48880250 CTGGGCTCACAGAAGAAGGCGGG + Intergenic
1137764165 16:50964898-50964920 CAAAACAGAGAGAAGAAAGCAGG - Intergenic
1138033887 16:53583058-53583080 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1138226408 16:55299279-55299301 CAGGGAAGACAGGAGCCAGCAGG - Intergenic
1138255850 16:55559422-55559444 CAGGGCAGACAGGAAAAACTTGG - Intronic
1138344341 16:56311133-56311155 CAGGGTAGATAGAAGCCAGCCGG - Intronic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138789856 16:59890672-59890694 CAGCGCAGCTAGAATAAAGCAGG + Intergenic
1139032488 16:62901894-62901916 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1139116731 16:63963371-63963393 CAGTGCAGCCAGAATAAAGCAGG + Intergenic
1139240746 16:65389445-65389467 CAGGACAGAAAGAGGAAAGAAGG - Intergenic
1140224566 16:73067193-73067215 CTGGGAAGAAAAAAGAAAGCGGG + Intergenic
1140710385 16:77672107-77672129 CAGGGTAGAAAGATGAAGGCTGG - Intergenic
1141312328 16:82926507-82926529 CAGAGCAGAGGGAAGAAAGTGGG - Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1144946022 17:18969856-18969878 CAGGGAGGAAAGAAGAGAGCTGG + Exonic
1145224299 17:21115101-21115123 CACAGCAGAAAGATGAAAGCTGG + Intergenic
1145829653 17:27905718-27905740 GTGGGCAGACAGATGAATGCTGG - Intergenic
1146180263 17:30693726-30693748 CAAGGAAGAGAGAAGACAGCGGG - Intergenic
1146497803 17:33338345-33338367 CAGGGGAGACAGTAGAATTCTGG + Intronic
1146581890 17:34045754-34045776 AAGGGCAGGAAGAAGAAAACTGG + Intronic
1146888709 17:36490525-36490547 CTGAGCAAACAGAACAAAGCTGG - Intronic
1147606214 17:41775234-41775256 CACAACAGACAGAAGAAGGCTGG + Intronic
1147871187 17:43588766-43588788 GAGGACAGTCAGAAGAGAGCAGG - Intergenic
1147964426 17:44186625-44186647 CAGGGCCGGAAGAACAAAGCTGG + Intergenic
1148028424 17:44604176-44604198 TGGGCCAGACAGAAGAAACCAGG + Intergenic
1148133148 17:45274324-45274346 CAGGGCAGGCAGTGGAAAGCAGG + Intronic
1148552152 17:48556911-48556933 CAGGGCAGAGAGAAACAAACAGG - Intronic
1148995822 17:51708711-51708733 CAGTGCAGGTAGAATAAAGCAGG + Intronic
1149257169 17:54839578-54839600 CAAGGCAGGCAAAACAAAGCTGG + Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1151185088 17:72358057-72358079 CAGGGCATAGAGGAGAAAACAGG - Intergenic
1151236907 17:72727349-72727371 CAGAACAGAAAGAAGCAAGCTGG + Intronic
1151797782 17:76357964-76357986 CAGCCCAGACAGACTAAAGCAGG + Intronic
1151870315 17:76832343-76832365 CACGGGAGAAAGAAGAAGGCCGG + Intergenic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152640824 17:81448504-81448526 CAGGGAAGACGGCAGGAAGCGGG - Intronic
1153310162 18:3669627-3669649 CGGGGCAGTCAGAGGAGAGCCGG + Intronic
1154507041 18:15051926-15051948 GAGGGCAGATACAAGAGAGCAGG - Intergenic
1154982808 18:21517807-21517829 CAGCGAGGGCAGAAGAAAGCAGG - Intronic
1157021456 18:43787850-43787872 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1157180806 18:45496444-45496466 CAGGGTAGCTAGAACAAAGCAGG + Intronic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157388136 18:47277503-47277525 TAGAGCAGACAGAAGAAACAAGG - Intergenic
1157408563 18:47444634-47444656 CACGGCACACAGAATAAAACAGG - Intergenic
1157410400 18:47458440-47458462 AAGGGGAGACAGAAGAGAGAGGG + Intergenic
1157654925 18:49375822-49375844 CAGGACAAATAGAATAAAGCAGG + Intronic
1158499702 18:57989374-57989396 CATGGCAGACGGCAGAGAGCAGG - Intergenic
1158946087 18:62448090-62448112 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1159151601 18:64530163-64530185 CAGTGCAGGTAGAATAAAGCAGG - Intergenic
1159438287 18:68446065-68446087 CAGGGGAGAAAGATGAAGGCTGG - Intergenic
1159855027 18:73576244-73576266 CAGAGCAAACAGAACAAGGCTGG - Intergenic
1159908695 18:74122898-74122920 TGGGGCAGACAGAGGAAAGGAGG - Intronic
1160092778 18:75842606-75842628 CACGGGAGAAAGAAGAAGGCCGG - Intergenic
1160306763 18:77747403-77747425 CAGTGGGGACAGCAGAAAGCAGG - Intergenic
1160381875 18:78464347-78464369 CTGAGCAGACAGAACAAAGCTGG - Intergenic
1160495453 18:79371738-79371760 CAGGGGACACAGAAGACAGCAGG - Intronic
1160667711 19:340852-340874 GAGGGCAAACAGAAGACAGAGGG + Intronic
1161281085 19:3446147-3446169 CAGGGCAGACGGTAGAAACCAGG + Intronic
1161416552 19:4150296-4150318 CAGGGCAGACGGTATAAACCAGG - Intergenic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1162144008 19:8602197-8602219 CAGTACAGACAGAAAAAAGGTGG - Intronic
1162978337 19:14221814-14221836 CAAGGAAGAGAGAAGACAGCGGG + Intergenic
1163068357 19:14816465-14816487 CATGGGAGAAAGACGAAAGCTGG - Intronic
1163617079 19:18335710-18335732 CTGGGCAGTCAGAGGAGAGCTGG + Intergenic
1164880167 19:31726268-31726290 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1165020887 19:32923022-32923044 CAGGGCAGGCGGATGGAAGCTGG + Intronic
1165956545 19:39504933-39504955 CAGTGTAGACAGAAGCGAGCAGG + Intronic
1166324837 19:42042756-42042778 CTGGGTGGGCAGAAGAAAGCAGG + Intronic
1166351636 19:42201627-42201649 CAGAGCAGAAAGGAGAATGCAGG + Intronic
1166363975 19:42269396-42269418 CAGGGCTGACACAGGAAAGGGGG + Intronic
1167111901 19:47467498-47467520 CAGGTCAGACACAGGGAAGCTGG - Intronic
1167200157 19:48059563-48059585 CAAAGCAGACAGAAGAAGGTGGG + Intronic
1167321393 19:48799201-48799223 CAGGGCAGGAAGGAGACAGCTGG - Intronic
1167519267 19:49943247-49943269 CTGGGCAAAAAGAACAAAGCTGG + Intronic
1167684375 19:50946915-50946937 CAGGGCACAGAGAAGAAATGGGG + Intronic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
925288183 2:2729475-2729497 CAGGGCAGAGAGGAGACAGGAGG + Intergenic
925506973 2:4577346-4577368 CAAAGCAGAAAGAAGAAAACAGG - Intergenic
925656222 2:6152406-6152428 AAGTGCAGAGAGAAGAAAGACGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925798315 2:7570510-7570532 CAGGGCAGGCAGCAGCAAGAAGG + Intergenic
925806772 2:7658620-7658642 CAGGCCAGTCGGAAGAAAGCTGG - Intergenic
926177061 2:10603164-10603186 AAGGTCAAACAGAAGACAGCAGG + Intronic
927045687 2:19275955-19275977 CAGGGCAGAGAGCAGAAAGAAGG - Intergenic
927342138 2:21994526-21994548 CAGAGCAGACTTAACAAAGCTGG - Intergenic
927350026 2:22100190-22100212 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
927374755 2:22400931-22400953 CAGAGCAGAGAGAAGTAGGCAGG + Intergenic
927514759 2:23665709-23665731 GAGGGCAGACAGAAGAGAGAGGG + Intronic
927640314 2:24841615-24841637 CACTGCAGGCAGAAGACAGCTGG + Exonic
928076128 2:28266285-28266307 CAAGTCAGAAAGAAGAAAGGTGG - Intronic
928709966 2:33993060-33993082 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
928845728 2:35669524-35669546 CAGAGCGGACAGAATAAAGCAGG - Intergenic
928878502 2:36069674-36069696 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
929382288 2:41367287-41367309 AATGGAAAACAGAAGAAAGCAGG + Intergenic
929570913 2:43022318-43022340 CAGGGCAGTCAGAATGAAGGCGG + Intergenic
930304335 2:49659381-49659403 CAGGGCAGCTAGAATTAAGCAGG + Intergenic
931557556 2:63521375-63521397 AATGGAAAACAGAAGAAAGCAGG + Intronic
931910122 2:66889917-66889939 CTGGGCAGAGAGGAGAAAGAAGG - Intergenic
932097322 2:68863032-68863054 CAGCGCACACAGTGGAAAGCAGG + Intergenic
932904996 2:75739504-75739526 CATGGGAGAAAGATGAAAGCCGG - Intergenic
932956998 2:76363857-76363879 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
933076380 2:77932764-77932786 CAAAGCAAAAAGAAGAAAGCTGG + Intergenic
933687931 2:85158011-85158033 CATGGCGGACAGAGGAAAGCAGG + Intronic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935523345 2:104136964-104136986 CAGGAAAGAGAGAAGACAGCAGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936037729 2:109126264-109126286 AAGTGGAGAGAGAAGAAAGCTGG + Intergenic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936146104 2:109981523-109981545 CACGGCAGTCAGGGGAAAGCAGG - Intergenic
936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG + Intergenic
936232925 2:110720059-110720081 CTGGGCTGAAAGAAGCAAGCTGG - Intergenic
936463151 2:112726159-112726181 CAGGGCAGACACAGGCAGGCAGG + Intronic
937299813 2:120832330-120832352 GATGGCAGAGAGAAGAAAGGAGG + Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938602120 2:132853136-132853158 CAGGGCAGAGAAAGAAAAGCAGG + Intronic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939810684 2:146828213-146828235 CATGGCAAACAGAAAAGAGCAGG + Intergenic
939889686 2:147721793-147721815 CAATGCAGAAAAAAGAAAGCAGG + Intergenic
940396813 2:153199123-153199145 CAGGGCCGACCCAAGAAACCTGG - Intergenic
940646443 2:156397514-156397536 CATGGGAGAAAGATGAAAGCCGG + Intergenic
941672008 2:168304248-168304270 CAGAGCAGCTAGAATAAAGCAGG + Intergenic
941822979 2:169861084-169861106 CAGAGCAGCTAGAAAAAAGCAGG - Intronic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
942345996 2:175004330-175004352 GAGAGCAGACAGAATAAAGTTGG - Intronic
942572956 2:177331769-177331791 CAGGGAAAACATAAGAAAACTGG - Intronic
943006101 2:182389799-182389821 CAGTGCAGACAGAATAAGGCAGG + Intronic
943950310 2:194126054-194126076 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
944338331 2:198564997-198565019 CAGTGCAGTGAGAACAAAGCAGG + Intronic
945321085 2:208424469-208424491 CAGGGCAGACCCATGAAGGCAGG - Intronic
945690292 2:213025748-213025770 AAGGGCAGTCAGAACAAAGAGGG - Intronic
945743381 2:213690650-213690672 CAGTGCAGGTAGAACAAAGCAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946261336 2:218493779-218493801 CAGGCAACCCAGAAGAAAGCAGG - Intronic
946302543 2:218832643-218832665 AGGGGCAGAGAGAGGAAAGCCGG - Intergenic
947038561 2:225888192-225888214 CAGTGCAGCTAGAACAAAGCTGG + Intergenic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947927659 2:233935776-233935798 TGGGGCAGGCAGAAGGAAGCTGG + Intronic
948348528 2:237319519-237319541 CAGTGCAGCCAGAAAAAAGCAGG + Intergenic
1169016795 20:2298892-2298914 CCGGGCAGACAGGAGGCAGCTGG - Intronic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169774707 20:9239967-9239989 CAGCGCAGCTAGAATAAAGCAGG - Intronic
1170413750 20:16118343-16118365 CAAGGCAGAAAGAACAAAGCTGG + Intergenic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1171081706 20:22193163-22193185 AATGGAAAACAGAAGAAAGCAGG + Intergenic
1171420402 20:25013873-25013895 CTGGGCACACAGGAGAGAGCTGG + Intronic
1172842660 20:37911445-37911467 CAGAGCAGCCAGAACACAGCGGG + Intronic
1172974507 20:38895952-38895974 GAGGGAAGAAAGAAGAAAGGAGG - Intronic
1173082115 20:39878067-39878089 CAGGGCAGACAGGAGTAGCCAGG + Intergenic
1174755627 20:53155567-53155589 CAGGGCAAGCAGAAGATACCCGG + Intronic
1175161436 20:57010863-57010885 CTGGGCAGAGAGAAGAAACATGG - Intergenic
1175178443 20:57128014-57128036 CTGGGCAGACAGAAGGGAGCAGG - Intergenic
1175889337 20:62309485-62309507 CAGGGAAGATGGAAGAAGGCTGG + Intronic
1175931360 20:62495382-62495404 CAGGGCAGACAGATGGATGCGGG + Intergenic
1175961910 20:62641790-62641812 CAGGACAGACGGCAGGAAGCCGG + Exonic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1176790832 21:13317171-13317193 GAGGGCAGATACAAGAGAGCAGG + Intergenic
1176968228 21:15235825-15235847 CAGGCAAGAGAGAAGACAGCAGG - Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177512554 21:22108768-22108790 GAGGGCAGACAGAAGACCACTGG + Intergenic
1177849007 21:26324463-26324485 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
1177990959 21:28036197-28036219 GAGGGCAGATACAAGAGAGCAGG - Intergenic
1178106348 21:29323479-29323501 CAGGGGAGAAAGATGAAAGCTGG + Intronic
1178159422 21:29894488-29894510 CAGTGCAGCTAGAATAAAGCAGG - Intronic
1178781984 21:35612371-35612393 CATGGCAGAAAGATGAAGGCAGG + Intronic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1179812003 21:43877829-43877851 CAGTGGAGACAGAAGATAGAGGG - Intronic
1180825092 22:18856232-18856254 CTGGGCAGCCACAAGAGAGCTGG + Intronic
1181187637 22:21118315-21118337 CTGGGCAGCCACAAGAGAGCTGG - Intergenic
1181211561 22:21292178-21292200 CTGGGCAGCCACAAGAGAGCTGG + Intergenic
1181397946 22:22634708-22634730 CTGGGCAGCCACAAGAGAGCTGG - Intergenic
1181651460 22:24261350-24261372 CTGGGCAGCCACAAGAGAGCTGG + Intergenic
1181705916 22:24649389-24649411 CTGGGCAGCCACAAGAGAGCTGG - Intergenic
1182027867 22:27134584-27134606 CAAGTCAGACATCAGAAAGCTGG - Intergenic
1182366257 22:29781378-29781400 AAGGGAAGAGAGTAGAAAGCTGG - Intergenic
1182535043 22:30994760-30994782 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1183714745 22:39527089-39527111 CAGGGCCGACAGGACAAAGCAGG - Intergenic
1183807594 22:40224702-40224724 AAGGAGAGAAAGAAGAAAGCTGG - Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184938372 22:47741426-47741448 CTGGGCAGAAGGAGGAAAGCAGG - Intergenic
1185082272 22:48716187-48716209 CTAGGCAGAAAGAACAAAGCTGG - Intronic
1185118593 22:48952270-48952292 CTGGGCAGGCAGCAGAAGGCTGG - Intergenic
1185381832 22:50512410-50512432 AAGAGCAGACATAAGAAAGCAGG - Intronic
1203215389 22_KI270731v1_random:3254-3276 CTGGGCAGCCACAAGAGAGCTGG - Intergenic
1203275238 22_KI270734v1_random:82138-82160 CTGGGCAGCCACAAGAGAGCTGG + Intergenic
950485414 3:13270490-13270512 CAGGCCCCAGAGAAGAAAGCTGG - Intergenic
950617175 3:14169883-14169905 CAGGCCAGACAGAAGGAATCAGG + Intronic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950724566 3:14907945-14907967 CAGGGAACACAGAAAAAACCTGG - Intronic
951509298 3:23484141-23484163 AAAGGCAGGGAGAAGAAAGCGGG - Intronic
951764209 3:26179192-26179214 CATGACAGACAGATGAAAGCAGG + Intergenic
952039854 3:29249000-29249022 AAGGGCAGGAAGAAGAGAGCAGG - Intergenic
952635164 3:35520187-35520209 AAGGGCAAACAGAAGATATCTGG + Intergenic
952828908 3:37546738-37546760 CAGTCCAGACAGAGGCAAGCAGG - Intronic
953052389 3:39357208-39357230 CTGAGCAAACAGAACAAAGCTGG + Intergenic
953102438 3:39842755-39842777 GAGGGCAGACAGAAGCAGGGGGG - Intronic
953201663 3:40783318-40783340 AAGGGCAGACAGTAGAAGGGAGG + Intergenic
953315777 3:41925248-41925270 GAGGGCAGGCAGAAGCAAGGTGG + Intronic
953474168 3:43192029-43192051 GAATGCAGACAGAAGAAAGTTGG - Intergenic
953701143 3:45196731-45196753 TAGTGGAGACAGAAGAAAGGAGG + Intergenic
954306165 3:49726587-49726609 CAGGGCTGACTGCACAAAGCTGG - Exonic
954688874 3:52385306-52385328 CAGGGCAGAGACAGGAAAACAGG - Intronic
954977898 3:54714034-54714056 AGGGACAGACAGCAGAAAGCTGG + Intronic
955378577 3:58418455-58418477 CAGCGCACCCTGAAGAAAGCAGG - Intronic
955507219 3:59644474-59644496 CAGGGCTGACAGCATACAGCAGG + Intergenic
955889771 3:63637440-63637462 CAGGAGAGAGAGAAGAAAGCAGG - Intergenic
957021210 3:75129318-75129340 CAGGGCAGACAGCCAAAAGGGGG + Intergenic
957646129 3:82930935-82930957 CATGGAAGACAGAAGAAAGTGGG + Intergenic
958632302 3:96699952-96699974 CAGGGCACTCAGAGGAGAGCTGG + Intergenic
958877549 3:99633265-99633287 CAGGGCAGCTAGAACAAAGCAGG + Intergenic
959097769 3:101974185-101974207 CAGGGCATACAGTATTAAGCAGG - Intergenic
959298199 3:104565100-104565122 CAGTCCAGCCAGAATAAAGCAGG - Intergenic
959471370 3:106755457-106755479 CTGGGCAAAAAGAAGAAAACTGG + Intergenic
960192825 3:114727426-114727448 AAAGGCAGTCAGAAGCAAGCAGG + Intronic
960753565 3:120983133-120983155 CAGGCCAGAAAGAAGCAGGCAGG - Intronic
960758551 3:121047670-121047692 AATGGCAGTCAGAAAAAAGCAGG - Intronic
961124486 3:124404057-124404079 CAGGGAAGGGAGAAGAAAGGAGG + Intronic
961746373 3:129065998-129066020 CAGGGGAGAAAGATGAAAGCCGG - Intergenic
962777432 3:138675626-138675648 CAGGGAAGCCAGAAGAAAGTGGG + Intronic
962947131 3:140182456-140182478 CAGGACAGACTGAAGAAGGCTGG - Intronic
963018547 3:140849393-140849415 AAGTGCAGACCCAAGAAAGCAGG + Intergenic
963057710 3:141200967-141200989 CAAGCCAGAGAGAAGAAGGCAGG + Intergenic
963403549 3:144834254-144834276 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
963638386 3:147827881-147827903 AAGGCAAGAAAGAAGAAAGCAGG + Intergenic
963654369 3:148026123-148026145 CAGGGCAGAGATGAGATAGCAGG + Intergenic
963897117 3:150698822-150698844 CAGTACAAACAGAAGAAAGTTGG - Exonic
964175529 3:153823120-153823142 CAGCACAGCCAGAATAAAGCAGG - Intergenic
964196792 3:154074658-154074680 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
964386661 3:156154878-156154900 AGGGGCAGAAAGAAGATAGCTGG - Intronic
964501211 3:157350069-157350091 CTGGGCAAAAAGAACAAAGCTGG + Intronic
964786374 3:160400305-160400327 AAGGGCGGGCAGACGAAAGCGGG + Intronic
965102691 3:164321332-164321354 CATCCCAGACAGTAGAAAGCTGG - Intergenic
965160299 3:165124432-165124454 CAGGGAAGAGGGAAGAAAGAGGG + Intergenic
965602377 3:170467984-170468006 GAGAGCACACAGAAGAAAGCAGG - Intronic
965671255 3:171150162-171150184 CAGGGCAGCAATAACAAAGCAGG + Intronic
966040813 3:175485621-175485643 CAGGGGAGAAAGATGAAGGCTGG + Intronic
966108882 3:176372647-176372669 TAGAGCAGAAAGAACAAAGCTGG + Intergenic
966148638 3:176841371-176841393 CAGGGGAGAAAGATGAAGGCTGG - Intergenic
967959393 3:194908395-194908417 CATGAGAGACAGAAGCAAGCAGG - Intergenic
968283793 3:197496414-197496436 CAGGACAGACAGCAGACAGCAGG - Intergenic
968646786 4:1745041-1745063 CAGGACAGACAGACGGGAGCAGG - Exonic
968651658 4:1762547-1762569 CAGGGCAGAGGGCAGAAGGCAGG + Intergenic
968753601 4:2403064-2403086 CAGGGCACACAGAACAATACAGG + Intronic
968785919 4:2622375-2622397 CAGGACAGGCATAAGGAAGCAGG - Intronic
968927402 4:3556825-3556847 CAGGACAGGTGGAAGAAAGCTGG - Intergenic
969065665 4:4478584-4478606 CAGGGTGGACAAAAGAAAGATGG + Intronic
969559092 4:7934607-7934629 CAGAGGAGAGAGAGGAAAGCAGG + Intronic
970148308 4:13060551-13060573 TTGAGCAGAAAGAAGAAAGCTGG - Intergenic
970656903 4:18241360-18241382 GAGGGGAGAGAGAAGAAAGCTGG - Intergenic
970676936 4:18461926-18461948 CAGAGCAGAGAGAAGAAAAATGG + Intergenic
971013027 4:22459988-22460010 CAGAGCAGAAAGTAGAAAGAGGG - Intronic
971543693 4:27856777-27856799 CTGGGCATAAAGAACAAAGCTGG - Intergenic
971593071 4:28493924-28493946 CTAAGCAAACAGAAGAAAGCTGG + Intergenic
971867002 4:32185313-32185335 CAGGGCAAACAGAACTATGCAGG - Intergenic
972116999 4:35648951-35648973 CAGTGCAGCCAGAATAAAGCAGG + Intergenic
972698167 4:41468255-41468277 CAGGGCAGAAGGAAGAAAGGAGG - Intronic
973532907 4:51850954-51850976 GAGGGCAGAGGGAAGAAAGTAGG + Intronic
974978927 4:68928080-68928102 CAGGGAAGACAGAACAAACCTGG + Intergenic
975060284 4:69988632-69988654 CATGGGAGAAAGATGAAAGCTGG + Intergenic
975098390 4:70484063-70484085 CATGGGAGACAGATGAAGGCTGG - Intergenic
975429609 4:74273285-74273307 CTGGACAGCCAGAAGAAAGGGGG + Intronic
975741898 4:77437319-77437341 CAGGGCAGCCAGAACAAAGCAGG + Intergenic
976262138 4:83155770-83155792 CAGAGCAGACAAAAGTAATCAGG - Intergenic
976848147 4:89513565-89513587 AGGGGGAGACAGAAGAAAGATGG - Intergenic
976960538 4:90966413-90966435 CAGGGAGGCCAGAAGAAAGTGGG + Intronic
977519124 4:98058378-98058400 AATGGAAAACAGAAGAAAGCAGG + Intronic
978489954 4:109302211-109302233 CTGGGAGGAGAGAAGAAAGCGGG - Exonic
978699354 4:111624181-111624203 CAGAGCAAAAAGAACAAAGCTGG - Intergenic
979774562 4:124573038-124573060 CATGGGAGAAAGATGAAAGCCGG + Intergenic
979853200 4:125599268-125599290 CAGGGCTGACAGAAAAATGTTGG + Intergenic
979860095 4:125682874-125682896 CAGGGCAGTCGGAGGAGAGCCGG - Intergenic
980135223 4:128852283-128852305 GAGGCCAGAAAGAAGAAACCTGG + Intronic
980382233 4:132037394-132037416 TAGGGAAGACAGAGGAAAACCGG + Intergenic
980475145 4:133304652-133304674 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
980725300 4:136751118-136751140 CAGGGCAGAATGAAGCAAGATGG + Intergenic
980887496 4:138779291-138779313 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
982138949 4:152299215-152299237 CAGAGCACACTGAAGAATGCTGG + Intergenic
982530940 4:156542790-156542812 CATGGGAGAAAGAGGAAAGCCGG + Intergenic
982530943 4:156542846-156542868 CAGCGCAGGTAGAATAAAGCAGG - Intergenic
982868603 4:160548864-160548886 CAGAGCAGTAATAAGAAAGCTGG - Intergenic
983415171 4:167443275-167443297 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
983808427 4:172024852-172024874 CAGGGAGGAAGGAAGAAAGCAGG - Intronic
984260797 4:177442141-177442163 CAGGGCGGACGGAAGAGCGCCGG - Intronic
984288833 4:177767001-177767023 CAGCGCAGCAAGAACAAAGCAGG - Intronic
984559704 4:181253919-181253941 AAGGGCAGGCAGCAGTAAGCTGG - Intergenic
985067320 4:186135189-186135211 CAGTGCAGACATAAGACAGCGGG + Intronic
985913855 5:2903131-2903153 CAGGGCAGAAAGCAGATGGCAGG - Intergenic
985922802 5:2992805-2992827 CAAGTCAGACAGAAGAGACCAGG + Intergenic
986024690 5:3839641-3839663 GAGGCAAGACAGAAGACAGCAGG - Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986468589 5:8051345-8051367 CAGGGCAGAATGCAGAAGGCGGG - Intergenic
986654951 5:10001858-10001880 AATGGAAAACAGAAGAAAGCAGG + Intergenic
987129213 5:14845256-14845278 CAGGACAGATGGAAGAAAGACGG - Intronic
987189426 5:15459214-15459236 CTGAGCAAACAGAACAAAGCAGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988679290 5:33469075-33469097 CAGTGCAGCTAGAACAAAGCGGG + Intronic
989107826 5:37880077-37880099 CAGTCAAGAAAGAAGAAAGCTGG + Intergenic
989758186 5:44981686-44981708 GAGGGTAGACAGAGGAGAGCTGG + Intergenic
991017194 5:61944980-61945002 CAGGTAACACAGAGGAAAGCTGG + Intergenic
992132445 5:73706824-73706846 AAGGGAGGAGAGAAGAAAGCGGG - Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
992992259 5:82296181-82296203 CATAGCAGACAGCAGCAAGCAGG + Intronic
993255334 5:85583679-85583701 CAGAGCAAAAAGAACAAAGCTGG - Intergenic
993634119 5:90324052-90324074 AAGGGGAAACAGAAAAAAGCAGG - Intergenic
993636542 5:90351513-90351535 CAGGGCAGTTAGAATAAAGCAGG + Intergenic
993746454 5:91603500-91603522 CATGGGAGAAAGATGAAAGCTGG + Intergenic
994269468 5:97760011-97760033 CATGGCAGAAAGATGAAGGCAGG + Intergenic
994358839 5:98826948-98826970 CGGAGCAGCCAGAATAAAGCAGG - Intergenic
994368831 5:98946612-98946634 CTGGGAAAACAGAAAAAAGCTGG - Intergenic
994426152 5:99589973-99589995 CAGGCCAGACAGAGAAGAGCTGG - Intergenic
995003436 5:107162487-107162509 CCAAGCAGAAAGAAGAAAGCTGG + Intergenic
995008074 5:107225730-107225752 CAAGGCAAAAAGAACAAAGCTGG - Intergenic
995428817 5:112051693-112051715 AATGGAAAACAGAAGAAAGCAGG + Intergenic
995682525 5:114736034-114736056 CTAGGCAAACAGAACAAAGCTGG - Intergenic
995720869 5:115131342-115131364 CATGGCAGACATAAGAAACATGG + Intronic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
996454815 5:123668753-123668775 CCAGGCAAAAAGAAGAAAGCTGG + Intergenic
996761944 5:126995010-126995032 CAGTGCAGCAAGAATAAAGCAGG - Intronic
996909168 5:128635706-128635728 CAGTGCGGCTAGAAGAAAGCAGG - Intronic
997372363 5:133370155-133370177 CAGGGCAGACAGAAAATATTAGG - Intronic
997724101 5:136105887-136105909 CAGTGAAGACAGAGGTAAGCAGG - Intergenic
997817951 5:137036039-137036061 CAGGGGAGGCAGGAGAGAGCTGG + Intronic
998158955 5:139802288-139802310 CTGGGCAGACAGAAGGGAGGAGG + Intronic
999493446 5:152073786-152073808 CAAGGCAGACAAAAGAGAACGGG + Intergenic
999545640 5:152625647-152625669 CAGCACAGCCAGAACAAAGCAGG + Intergenic
999893831 5:156007278-156007300 CTGGGCCATCAGAAGAAAGCAGG - Intronic
1000222885 5:159231071-159231093 CATGGCAGACAGTAGAAGTCTGG + Intergenic
1001232932 5:170005259-170005281 CAGGGCAGACAGAAAAATCTGGG + Intronic
1001291370 5:170464897-170464919 TAGGGCAGAGACTAGAAAGCAGG - Intronic
1001483480 5:172104073-172104095 CATGGCACACAGTAGGAAGCTGG + Intronic
1003006063 6:2382613-2382635 CAGGAAAGATAGAAGAAATCAGG - Intergenic
1003042130 6:2698157-2698179 CAGGCCAGATAGAAGAATGGAGG + Intronic
1003269327 6:4593367-4593389 GAGGGCAGCCAGAAGAGAACAGG - Intergenic
1003469116 6:6412143-6412165 CAGGGCAGCCAGAGGCTAGCAGG + Intergenic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1003963853 6:11234551-11234573 CAGGACAGAAACAGGAAAGCAGG - Intronic
1004377698 6:15104981-15105003 CAGCGCAGCTAGAACAAAGCAGG - Intergenic
1004844105 6:19619957-19619979 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
1004859977 6:19793906-19793928 GAGGGAGGACAGAAGAAGGCAGG + Intergenic
1005756370 6:28928032-28928054 CTTGGCTGACAGAAGAATGCGGG + Intergenic
1005885168 6:30092058-30092080 CAGGGCAGGCAGGACAGAGCTGG - Intergenic
1006630851 6:35428543-35428565 CAGGAAAGACAGGAGAGAGCTGG - Intergenic
1007913798 6:45541707-45541729 CAGGGCAGAAAAAAGGAAGGGGG - Intronic
1008061436 6:47001324-47001346 CAGGGCTGACAGAACAATGTAGG - Intronic
1009263894 6:61530114-61530136 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1009280057 6:61737719-61737741 GAATGCAGACAGAATAAAGCCGG - Intronic
1009587364 6:65624638-65624660 CAGAGCAGCTAGAATAAAGCAGG + Intronic
1009709208 6:67296108-67296130 CTGGGCAATCAGAACAAAGCTGG - Intergenic
1009711676 6:67330222-67330244 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1009752314 6:67888582-67888604 CAAGCCAGACAGAAGAAAGAGGG + Intergenic
1009997755 6:70915844-70915866 CTGGGCAAAAAGAACAAAGCTGG - Intronic
1010617654 6:78031970-78031992 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1011105573 6:83776494-83776516 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1012571261 6:100732385-100732407 AAAGGCAGACAGAGGAAAGGGGG + Intronic
1012589841 6:100967835-100967857 CATGGAAAACAGAAAAAAGCGGG + Intergenic
1014402041 6:121001924-121001946 CTGAGCAAACAGAACAAAGCTGG + Intergenic
1014717960 6:124887750-124887772 CAGGGCAGTCAGAGGAGAGCTGG + Intergenic
1015022077 6:128488275-128488297 CAGCGCAGCTAGAATAAAGCAGG - Intronic
1015238932 6:131002344-131002366 GAGGGGAGAGAGAAGAAAGAAGG + Intronic
1015285643 6:131483725-131483747 CTGAGCAGAAAGAACAAAGCTGG - Intergenic
1016405799 6:143728535-143728557 CTGAGCAAAAAGAAGAAAGCTGG + Intronic
1016410597 6:143779118-143779140 CAAGGGAGGCAGAAGAAAACTGG + Intronic
1016444996 6:144122367-144122389 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
1016751402 6:147634312-147634334 CAGAGCAGAAGGAAGAAAGGAGG + Intronic
1017645443 6:156535680-156535702 GAGGGAAGACAGAAGAGAGAAGG + Intergenic
1017769595 6:157634875-157634897 CAGGCCAGACACAAGGCAGCTGG - Intronic
1017845334 6:158253383-158253405 CAGGGCAGAGACAGGAGAGCAGG - Intronic
1017862970 6:158416148-158416170 CAGCGCAGCTAGAATAAAGCAGG - Intronic
1017970725 6:159310432-159310454 CAGTGTAGCCAGAATAAAGCAGG + Intergenic
1018534715 6:164807834-164807856 CATGGGAGAAAGATGAAAGCTGG + Intergenic
1018534718 6:164807893-164807915 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1018857682 6:167687126-167687148 CAGGGCAGCCAGCAGGCAGCAGG - Intergenic
1019462005 7:1164837-1164859 CAAGGCAGGCAGAAGAAAGTAGG - Intergenic
1019468110 7:1201634-1201656 CGGGGCAGTCAGAGGAGAGCTGG + Intergenic
1020101309 7:5395561-5395583 CAGGTCAGAGAGAAGCATGCAGG + Intronic
1020329446 7:7002802-7002824 CAGAGCAGCTAGAACAAAGCAGG - Intergenic
1020350902 7:7217253-7217275 TAGGCCAGAAAGAAGAAAGAAGG + Intronic
1020636387 7:10700564-10700586 CTGGGCAAAAAGAACAAAGCTGG + Intergenic
1021403367 7:20236171-20236193 CAGGGCAGCCTTAAGAAAGCAGG + Intergenic
1021971660 7:25971028-25971050 CAGGGAAGACAGTAGTAAACAGG + Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022319980 7:29279027-29279049 CATTGCAGAGAGAAGGAAGCAGG - Intronic
1022422459 7:30236869-30236891 CAGAGCAAAAAGAAGAAACCTGG - Intergenic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023107795 7:36779720-36779742 TAGGGCAGACAGAAGAAATGTGG + Intergenic
1023886139 7:44358157-44358179 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1024624828 7:51197836-51197858 AATGGAAAACAGAAGAAAGCAGG - Intronic
1025248504 7:57336024-57336046 AAGGGCAAACAGAAGACATCTGG - Intergenic
1025809459 7:64866179-64866201 AAGAGCAGAAAGAAGAAAACAGG + Intergenic
1026507886 7:71002128-71002150 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1027505970 7:79017250-79017272 CAGGGGCCACAGAATAAAGCTGG + Intronic
1027678955 7:81195025-81195047 CATGGGAGAAAGATGAAAGCCGG - Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1029991122 7:104963419-104963441 AAGAGGAGACAGAGGAAAGCAGG - Intergenic
1030360199 7:108587636-108587658 CAGTGCAGCTAGAATAAAGCAGG - Intergenic
1030564325 7:111133971-111133993 TTGGGGAGACAGTAGAAAGCTGG - Intronic
1032164295 7:129533480-129533502 CAGGGCAGCTAGAACAAAGCAGG + Intergenic
1032515787 7:132505096-132505118 CAGGGCCGAGAGTAGAAAGGAGG - Intronic
1032686117 7:134235437-134235459 CAGGGCAGACAGCATAGAGGTGG - Intronic
1032939268 7:136769580-136769602 CAGAGGAGACAGAAAAAAGTTGG + Intergenic
1034194940 7:149239437-149239459 CTGGGCATACGGAAGACAGCAGG + Intergenic
1034298259 7:149993090-149993112 CAGTGCAGGCAGAACAAAGCAGG - Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034541245 7:151759584-151759606 CCTCCCAGACAGAAGAAAGCTGG - Intronic
1034807759 7:154103693-154103715 CAGTGCAGGCAGAACAAAGCAGG + Intronic
1034933497 7:155182821-155182843 CAGCGCAGCCGGAACAAAGCAGG + Intergenic
1035008033 7:155684373-155684395 CTGGGTAGATGGAAGAAAGCAGG - Intronic
1035206189 7:157295381-157295403 CAGGGCTCCCAGAAGAAAGCAGG - Intergenic
1035222301 7:157413289-157413311 CAGGAAAGAAAGAATAAAGCAGG + Intronic
1035358467 7:158294630-158294652 CAGGCCAGGCAGGAGCAAGCGGG + Intronic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035669826 8:1408853-1408875 CAGGGCACAGAGAAGAAAGCTGG + Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1037410650 8:18592418-18592440 AAGAGCAGAAAGAAGAAAGAGGG + Intronic
1037632836 8:20673693-20673715 CATGGGAGAAAGATGAAAGCTGG + Intergenic
1038083400 8:24165585-24165607 CAGTGCAGGCAGGAGAAGGCAGG - Intergenic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038378480 8:27068461-27068483 CTGAGCAGAAAGAAAAAAGCAGG + Intergenic
1038547436 8:28436253-28436275 CTGAGCAGACAGGAGACAGCAGG - Intronic
1038722259 8:30047422-30047444 CAGGGCAGGAAGAAGAGAGAAGG + Intergenic
1039810892 8:41047473-41047495 CATGGCAGGTAGAAGAAATCTGG + Intergenic
1039977737 8:42381604-42381626 CAGGGCAGACAGGGGAGAGGAGG - Intergenic
1040666160 8:49635955-49635977 GAAGGCAGACAGAAGAGAGGGGG + Intergenic
1041210784 8:55549022-55549044 CAGTGCAGCTAGAACAAAGCAGG + Intergenic
1041210788 8:55549080-55549102 CATGGGAGAAAGATGAAAGCCGG - Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041426363 8:57725202-57725224 CAGGGCAGCCAGGAGAACGGAGG + Intergenic
1041962549 8:63635545-63635567 CAGGGCAGAGAGCTAAAAGCAGG + Intergenic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1043116448 8:76260081-76260103 CAGAGCAAAAAGAACAAAGCTGG + Intergenic
1043836455 8:85052737-85052759 CAGGGCAAGAAGAACAAAGCTGG + Intergenic
1044027466 8:87191342-87191364 CAGTGCAGCTAGAACAAAGCTGG - Intronic
1044287561 8:90426837-90426859 CTGAGCAGAAAGAACAAAGCTGG - Intergenic
1044632529 8:94293175-94293197 TAGGGCAGACAGCAGGGAGCAGG + Intergenic
1045291160 8:100834009-100834031 CAGCACAGCCAGAACAAAGCAGG - Intergenic
1045393712 8:101739610-101739632 CAGGGGAGAAAGATGGAAGCCGG - Intronic
1045570786 8:103367235-103367257 CTGGGCAAAAAGAACAAAGCTGG - Intergenic
1046221483 8:111222303-111222325 CAGGGCCTCCAGAAAAAAGCAGG + Intergenic
1046467530 8:114625845-114625867 CAGAGCAAAAAGAAGAAATCTGG + Intergenic
1046514560 8:115241522-115241544 CAGGTCAGACAGAGGAAATAAGG + Intergenic
1048263331 8:132964262-132964284 TAGGGGAGAGGGAAGAAAGCAGG - Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048634823 8:136284509-136284531 CAGTGCAGCCAGGATAAAGCAGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049184428 8:141242004-141242026 CAGGTCAGACAGAAAAGAGCAGG + Intronic
1049354949 8:142182914-142182936 CAGGCCAGAATGAAGTAAGCTGG + Intergenic
1049570523 8:143368320-143368342 GCGGGCAGAGAGAAGAAAGCAGG + Intergenic
1049664453 8:143836793-143836815 CAGGGCAGGCAGCAGGATGCAGG + Intronic
1049726971 8:144151449-144151471 CAGGGCAGTCGGAGGAGAGCTGG + Intronic
1050243426 9:3661466-3661488 CAGCCCAGAGAGAGGAAAGCAGG - Intergenic
1050455678 9:5832421-5832443 AAGGGCAGACAGTGGAAAGCAGG + Intronic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1051175137 9:14353026-14353048 GAGGGCACACAGAGGCAAGCTGG + Intronic
1051487073 9:17620562-17620584 AAGGGCAGACAGAAGAGGGTTGG + Intronic
1051840669 9:21393781-21393803 CAGGGAAGAAACAAGAAAGCGGG + Intergenic
1052097118 9:24396605-24396627 CAGGGCAGCAGGAATAAAGCAGG + Intergenic
1052255560 9:26452361-26452383 CAGAGCAAAAAGAAAAAAGCTGG - Intergenic
1052425580 9:28300618-28300640 AAAGGTAGAAAGAAGAAAGCAGG - Intronic
1052794560 9:32911415-32911437 AAGGTCAGACAGAGGAAAACTGG - Intergenic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1054462666 9:65473986-65474008 CAGGACAGGTGGAAGAAAGCTGG + Intergenic
1056445591 9:86663376-86663398 AAGGTCAGACAGAAGAAAGTGGG + Intergenic
1057206056 9:93173315-93173337 CAGAGCAGAAAGAAGGAACCGGG - Intergenic
1058096180 9:100862765-100862787 CATGGAAGAAAGATGAAAGCTGG - Intergenic
1058381305 9:104379830-104379852 CAGTGCAGCTAGAATAAAGCAGG + Intergenic
1058395989 9:104555049-104555071 CTGAGCAGAAAGAACAAAGCTGG + Intergenic
1058560966 9:106228852-106228874 CAGGGGAGCCAGCAGAAAGGAGG - Intergenic
1058820637 9:108726133-108726155 CAGTTCACCCAGAAGAAAGCAGG + Intergenic
1058905915 9:109482683-109482705 CAGGGCAGACAGTGGATAGTGGG - Intronic
1058940812 9:109811146-109811168 AAGAGCAGACAGTAGAAATCAGG + Intronic
1059132457 9:111767627-111767649 CTGAGCAAAAAGAAGAAAGCTGG - Intronic
1059365656 9:113784700-113784722 CAGGGCCCAAAGAAGCAAGCAGG + Intergenic
1059396838 9:114039851-114039873 CACTGCAGGCAGGAGAAAGCAGG - Intronic
1059788784 9:117617044-117617066 AAGGGAAGACAAGAGAAAGCAGG - Intergenic
1060077813 9:120609241-120609263 AACCTCAGACAGAAGAAAGCAGG - Intronic
1060180405 9:121529789-121529811 CAGGAGAGTGAGAAGAAAGCTGG + Intergenic
1060704456 9:125785349-125785371 CAGTGCAGCTAGAACAAAGCAGG + Intronic
1061341331 9:129984434-129984456 CAGCCCAGACAGAAGTAAACTGG + Intronic
1061467275 9:130791542-130791564 CAGTGCAGCTAGAACAAAGCAGG + Intronic
1061732596 9:132627827-132627849 CAGGGCAGATTGGAGAAGGCAGG - Intronic
1062187718 9:135227571-135227593 CAGGGCAGACATAAGACAAGAGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185708453 X:2282595-2282617 GAGGGGAGAGAGAAGAAAGAGGG + Intronic
1186417269 X:9394614-9394636 CTGGCCATACAGAGGAAAGCAGG + Intergenic
1186501015 X:10050582-10050604 CAGCCCAGCCAGAAGCAAGCTGG - Intronic
1186870581 X:13767196-13767218 GAAGGCAGAGAGAAGAAAGAAGG + Exonic
1187305620 X:18092967-18092989 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187488363 X:19725817-19725839 CAGGGCACAGAAAAGAAACCTGG + Intronic
1187801624 X:23069884-23069906 CAGGGCAGCTTGAACAAAGCAGG - Intergenic
1188054150 X:25522304-25522326 CAGGGAAGAAAGACGAATGCCGG - Intergenic
1188072216 X:25730493-25730515 CAGGGCAGGGAAAAGAAAACAGG + Intergenic
1188127760 X:26391292-26391314 CAGCGCAGCTAGAATAAAGCAGG - Intergenic
1188385557 X:29553335-29553357 TAGGGAAGACAAAAGAAAACTGG - Intronic
1188387185 X:29575526-29575548 CAGTGCAGCTAGAACAAAGCAGG - Intronic
1189674360 X:43445453-43445475 CAGGGCAGAAAAAATAAAGAAGG + Intergenic
1189678410 X:43487577-43487599 GAGGGGAGAGAGAACAAAGCTGG + Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190155314 X:47986757-47986779 CAGGGCAGCTAGAATAAAGCGGG + Intronic
1190286679 X:48966170-48966192 GAGGGCAGCAAGAAGACAGCAGG + Exonic
1190296405 X:49030214-49030236 CAGGGGACACTGAAGAGAGCAGG + Exonic
1190621393 X:52290011-52290033 CTGGGCAAAAAGAAAAAAGCTGG - Intergenic
1190874680 X:54451234-54451256 CAGGGCAGACAGAAGAGTCAGGG - Intronic
1190965351 X:55295022-55295044 CAAGGCAAAAAGAACAAAGCTGG - Intergenic
1191001968 X:55669771-55669793 CAGGGCAAGAAGAACAAAGCTGG - Intergenic
1191017132 X:55820741-55820763 CAGAGCAGGAAGAAGAGAGCAGG + Intergenic
1191096742 X:56681053-56681075 CACGGGAGAAAGATGAAAGCTGG + Intergenic
1192212488 X:69136817-69136839 TAGGGCACCCAGAAGGAAGCAGG + Intergenic
1193458255 X:81757131-81757153 AATGGAAGACAGAAAAAAGCAGG + Intergenic
1193461745 X:81798327-81798349 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1193781113 X:85702290-85702312 CAAAGCAGAAAGAACAAAGCTGG + Intergenic
1194263780 X:91731633-91731655 CATGGAAAACAGAAAAAAGCAGG - Intergenic
1194911428 X:99649715-99649737 CAGTGCAGCTAGAACAAAGCAGG - Intergenic
1194930558 X:99882059-99882081 CAGGGAAAACAGAACCAAGCTGG + Intergenic
1194934577 X:99932660-99932682 AAGGCAAGACAGAAGAAAGAAGG - Intergenic
1195134669 X:101892851-101892873 GAAGGCAGACAGAAGAAAATGGG + Intronic
1195346632 X:103956463-103956485 AATGGAAGACAGAAAAAAGCAGG + Intronic
1195360810 X:104082378-104082400 AATGGAAGACAGAAAAAAGCAGG - Intergenic
1195367300 X:104138763-104138785 TAGGGCAGTCAGAAAAAACCTGG - Intronic
1195575411 X:106444150-106444172 AAGGATAGACTGAAGAAAGCTGG + Intergenic
1195850461 X:109276993-109277015 CATGGCAGATAGATGAAGGCTGG - Intergenic
1196531234 X:116789019-116789041 AAGTGCCCACAGAAGAAAGCAGG - Intergenic
1197346988 X:125336191-125336213 CATGGGAGAAAGAAGAAGGCTGG - Intergenic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1198545010 X:137682300-137682322 CCCAGCAGACAGAAGAAAGGAGG - Intergenic
1198557032 X:137806297-137806319 CTGAGCAAACAGAACAAAGCTGG - Intergenic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic
1199365813 X:146981269-146981291 AAGGGAAAACAGAAAAAAGCAGG - Intergenic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1200507700 Y:4035278-4035300 CAGGGCAGCAAAAACAAAGCAGG - Intergenic
1201918147 Y:19204769-19204791 CATGGCAGGCAGGAGAAAGAAGG + Intergenic
1201933815 Y:19384587-19384609 AACGGAAAACAGAAGAAAGCGGG - Intergenic
1202040594 Y:20679161-20679183 CTGAGCAAACAGAACAAAGCTGG + Intergenic