ID: 1133234473

View in Genome Browser
Species Human (GRCh38)
Location 16:4381537-4381559
Sequence GCTGGTTGTCGGACACATCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133234473_1133234477 5 Left 1133234473 16:4381537-4381559 CCTGGATGTGTCCGACAACCAGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1133234477 16:4381565-4381587 CGAGTGCCACCTGTGATCCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1133234473_1133234485 30 Left 1133234473 16:4381537-4381559 CCTGGATGTGTCCGACAACCAGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1133234485 16:4381590-4381612 TCCGGGGCCTGACGCGCCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 92
1133234473_1133234479 12 Left 1133234473 16:4381537-4381559 CCTGGATGTGTCCGACAACCAGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1133234479 16:4381572-4381594 CACCTGTGATCCGAGGCCTCCGG 0: 1
1: 0
2: 1
3: 153
4: 5914
1133234473_1133234480 13 Left 1133234473 16:4381537-4381559 CCTGGATGTGTCCGACAACCAGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1133234480 16:4381573-4381595 ACCTGTGATCCGAGGCCTCCGGG 0: 1
1: 0
2: 3
3: 20
4: 413
1133234473_1133234482 14 Left 1133234473 16:4381537-4381559 CCTGGATGTGTCCGACAACCAGC 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1133234482 16:4381574-4381596 CCTGTGATCCGAGGCCTCCGGGG 0: 1
1: 0
2: 0
3: 18
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133234473 Original CRISPR GCTGGTTGTCGGACACATCC AGG (reversed) Exonic
902437358 1:16407122-16407144 GCTGTTTGTCAGAGACTTCCAGG - Intronic
905286000 1:36880781-36880803 GCTGGATGTGGGGCACCTCCAGG + Exonic
907357528 1:53888770-53888792 GGTGGCTGTTGGCCACATCCAGG - Intronic
908600505 1:65733953-65733975 GCTGGTTGTCTAACAGAACCTGG - Intergenic
917811438 1:178662204-178662226 TCTGCTTGTAGGAAACATCCAGG - Intergenic
922862267 1:228829689-228829711 GCTGGTTGTTGGAAATAGCCTGG - Intergenic
1063495019 10:6499033-6499055 GCAGGTTGTTGGAGACATGCTGG + Intronic
1069902173 10:71712720-71712742 GCCGGTTGTCATTCACATCCAGG - Exonic
1069910865 10:71758357-71758379 ACTGGATGTCTGACACATACAGG + Intronic
1072741372 10:97911990-97912012 GCTGGTTGTGGGAGACACCACGG + Intronic
1075758528 10:124836803-124836825 GCTGGTTTCAGGAGACATCCAGG + Intergenic
1077192735 11:1262255-1262277 GCAGGCTGGAGGACACATCCGGG + Intergenic
1077399250 11:2345537-2345559 GCTGGTTGTTGAAAACAACCTGG - Intergenic
1077919509 11:6632157-6632179 GCTGGTTCTCAGCCACAGCCAGG + Exonic
1079467628 11:20746794-20746816 GCTGTGTATCGTACACATCCTGG - Intronic
1084257393 11:67952456-67952478 GCTGTTGGTCAGACACACCCTGG + Intergenic
1090715623 11:129427938-129427960 GGTGGGTGCCGGAGACATCCTGG - Intronic
1099635554 12:85206685-85206707 CCTGATTGTCGGAGACCTCCAGG - Intronic
1106477004 13:30107663-30107685 GCTCATGGTCTGACACATCCAGG - Intergenic
1106781975 13:33068171-33068193 GCTGGTTGTAGGACATTTCCTGG + Intergenic
1113765397 13:112877798-112877820 GCCTGTGGTCAGACACATCCGGG - Intronic
1125725282 15:41865290-41865312 GCTGATTATCTGCCACATCCAGG + Intronic
1129666172 15:77580676-77580698 GCTAGTTGTACCACACATCCTGG + Intergenic
1131067841 15:89445189-89445211 GCTGGCTTTCGGACACTCCCAGG + Intergenic
1131669656 15:94606402-94606424 GCTGGTTGTGAGATACTTCCAGG + Intergenic
1132425204 15:101710166-101710188 CCAGGTTGTTGAACACATCCAGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133234473 16:4381537-4381559 GCTGGTTGTCGGACACATCCAGG - Exonic
1140379244 16:74471268-74471290 TCTGGTTATCTGCCACATCCTGG + Exonic
1141178921 16:81739195-81739217 GCTGGTGGTCGACCACAGCCTGG + Intronic
1142155166 16:88529686-88529708 GCAGGTGGTCTGGCACATCCAGG + Intronic
1143171452 17:4932895-4932917 GCTGATTGTGGGATAGATCCAGG - Exonic
1145252845 17:21305777-21305799 CCTGGCTGGGGGACACATCCTGG - Intronic
1145323730 17:21782139-21782161 CCTGGCTGGGGGACACATCCTGG + Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1158429204 18:57368936-57368958 GCTGGTTGTCTGTCACATTCGGG + Intronic
1160566037 18:79787317-79787339 GCCGCGTGTCGCACACATCCCGG + Intergenic
1162926618 19:13933412-13933434 GCTGGTTGTGGGAGAGATCCAGG + Exonic
1165923804 19:39314817-39314839 GGTTGTTGTAGGACAGATCCAGG + Exonic
1168114934 19:54217197-54217219 GCTGGGCGTAGGTCACATCCTGG + Exonic
1168120625 19:54250890-54250912 GCTGGGCGTAGGTCACATCCTGG + Exonic
1168124202 19:54274787-54274809 GCTGGGCGTAGGTCACATCCTGG + Exonic
1168177784 19:54636752-54636774 GCTGGGCGTAGGTCACATCCTGG - Exonic
1168182194 19:54669506-54669528 GCTGGGCATAGGACACATCCTGG - Exonic
930075131 2:47400396-47400418 GCTGATTGTCAGGAACATCCAGG + Intergenic
948062589 2:235052588-235052610 CCTGGTGGTCAGACTCATCCAGG + Exonic
948078325 2:235184497-235184519 GCTGGTTGTAGGATAAAACCTGG - Intergenic
1169332661 20:4729064-4729086 GCTGGTTGTCTGCCAGAGCCTGG - Intergenic
1175388500 20:58612099-58612121 GCTGGATTTCGGACCCATGCTGG + Intergenic
1175969301 20:62675790-62675812 GCTGGCTGTGGGAGGCATCCAGG - Intronic
1183931302 22:41237619-41237641 GCTGGTTGTCGGAGAGGTACAGG + Exonic
953507697 3:43502412-43502434 GCTGGTTGTCAGAAAGAGCCTGG + Intronic
954683737 3:52359523-52359545 GCTGGTTGTGAGACACTTCAAGG - Intronic
960878066 3:122316197-122316219 GCTGGTTGTCAGTAACAGCCAGG - Intergenic
968059387 3:195715704-195715726 CCTGAGTGTCGGATACATCCTGG + Intergenic
971693408 4:29867087-29867109 TCTGGTTGTTTGACAGATCCTGG + Intergenic
974308337 4:60171966-60171988 TCTGGTTGTTGGAAAGATCCTGG - Intergenic
975617922 4:76265828-76265850 CCGGGTTGATGGACACATCCAGG + Intronic
977262477 4:94814475-94814497 GTGGGTTGTGGAACACATCCTGG + Intronic
983416696 4:167465583-167465605 GAGGGTTGTGGGACACACCCTGG - Intergenic
985384929 4:189435168-189435190 GCTGGTTGTTGGAAAGAGCCTGG - Intergenic
985869365 5:2542160-2542182 GCTGGAAGGGGGACACATCCAGG - Intergenic
988913555 5:35870136-35870158 GCTGCTTGTTGGTCACAGCCTGG - Intronic
990068375 5:51747407-51747429 GCTGGTTGTGGGAAAGAGCCTGG - Intergenic
998394315 5:141808677-141808699 ACTGGTTCTCTGACACACCCCGG + Intergenic
1029074595 7:97925892-97925914 GCTGTTGGTCAGACACACCCTGG + Intergenic
1032679115 7:134163453-134163475 TCTGATTGTGGGACAGATCCAGG - Exonic
1049659383 8:143812910-143812932 GCCGGTTTTCCGACACGTCCAGG + Exonic
1051699677 9:19808574-19808596 TCTGGTAGGCAGACACATCCAGG + Intergenic
1186952555 X:14643271-14643293 GCTGGAAGTCTGACACATCATGG - Intronic
1187366603 X:18670647-18670669 CCTGGTTGTCAGACACTCCCAGG - Intronic
1188565927 X:31526626-31526648 GTTGGGTGTTGGACAAATCCAGG - Intronic
1196324649 X:114388894-114388916 TCTGATTGTGGGACACATTCTGG + Intergenic
1199235387 X:145487046-145487068 GCTGGTTGTTAAAAACATCCTGG - Intergenic