ID: 1133236231

View in Genome Browser
Species Human (GRCh38)
Location 16:4388626-4388648
Sequence CGTGCTCTGCAGGAGGCAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 192}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133236221_1133236231 16 Left 1133236221 16:4388587-4388609 CCATGCCAGCCGGCTATCCCTGC 0: 1
1: 0
2: 1
3: 11
4: 119
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236227_1133236231 -2 Left 1133236227 16:4388605-4388627 CCTGCTGTTCTCATGGGCCTGCG 0: 1
1: 0
2: 0
3: 13
4: 200
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236216_1133236231 29 Left 1133236216 16:4388574-4388596 CCCAGGTGCCCATCCATGCCAGC 0: 1
1: 0
2: 1
3: 41
4: 375
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236219_1133236231 21 Left 1133236219 16:4388582-4388604 CCCATCCATGCCAGCCGGCTATC 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236222_1133236231 11 Left 1133236222 16:4388592-4388614 CCAGCCGGCTATCCCTGCTGTTC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236226_1133236231 -1 Left 1133236226 16:4388604-4388626 CCCTGCTGTTCTCATGGGCCTGC 0: 1
1: 0
2: 1
3: 49
4: 860
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236220_1133236231 20 Left 1133236220 16:4388583-4388605 CCATCCATGCCAGCCGGCTATCC 0: 1
1: 0
2: 0
3: 15
4: 255
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236217_1133236231 28 Left 1133236217 16:4388575-4388597 CCAGGTGCCCATCCATGCCAGCC 0: 1
1: 0
2: 3
3: 31
4: 331
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192
1133236223_1133236231 7 Left 1133236223 16:4388596-4388618 CCGGCTATCCCTGCTGTTCTCAT 0: 1
1: 0
2: 1
3: 23
4: 272
Right 1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG 0: 1
1: 0
2: 2
3: 12
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133236231 Original CRISPR CGTGCTCTGCAGGAGGCAAG AGG Exonic
900659523 1:3775671-3775693 GGCGCTCTGCTGGAGTCAAGAGG - Intronic
901092587 1:6651932-6651954 GGTGCTCTGCAGGTGGCGGGGGG - Intronic
902955981 1:19924273-19924295 CCTCCTGTGCGGGAGGCAAGAGG - Intergenic
903864488 1:26388434-26388456 AGTGCTCTGCAGCTGGCAGGTGG - Intergenic
905206325 1:36344646-36344668 CGGGCTGTGAAGGAGGCAGGTGG - Intronic
905279723 1:36841427-36841449 CTTGCTCTGGAGGAGGCCTGTGG - Intronic
908848382 1:68348311-68348333 CGTGCTCTGTAGCTAGCAAGAGG + Intergenic
909242958 1:73238368-73238390 CGTGCTCTTCTTGAGGTAAGGGG - Intergenic
910471075 1:87553399-87553421 GGAGCTCTGGAGGAGGCATGGGG - Intergenic
912522596 1:110256024-110256046 CAAGCTCTGCAGGAGGCTGGGGG + Intronic
914417219 1:147495139-147495161 GGTGCTTTGCAGGAACCAAGTGG - Intergenic
920039861 1:203088574-203088596 GGTGCTCTGCAGAAGGCTTGGGG + Intergenic
920213589 1:204346377-204346399 CGTGTTCTGGAAGAGGCAGGTGG - Intronic
920458331 1:206117452-206117474 CCTCCTCTGCAGGAGCCAACTGG - Intronic
922060881 1:222090244-222090266 CGTGGTCTGCTGGAGTCATGAGG - Intergenic
922776677 1:228217342-228217364 CCTGCTCTGCTGGAGGCAGCCGG - Intronic
923751972 1:236754681-236754703 CCTGCTCTGGAGGAGGCTGGGGG - Intronic
1063458312 10:6200712-6200734 CTTGCTCTGCAGCAGGCAAAAGG - Intronic
1064262159 10:13794574-13794596 GGGGCTCTGCAGGAAACAAGTGG + Intronic
1066545474 10:36495442-36495464 CGTGCTCCACAGTGGGCAAGAGG + Intergenic
1066659821 10:37728288-37728310 CCTGCACTGCTGGAGGCAGGAGG + Intergenic
1067780936 10:49206808-49206830 CGTGCTGGGCAGCGGGCAAGAGG + Intergenic
1068980487 10:63057761-63057783 CGTGCTCTGCAGGGAGCACCTGG - Intergenic
1070018569 10:72560299-72560321 TGTGGTCTACAGGAGGCATGAGG + Intronic
1070701364 10:78603969-78603991 TGTGCTCTTCAGGAGCCAGGTGG + Intergenic
1072643076 10:97228581-97228603 CTTCCTCTGAAGGAGCCAAGTGG - Intronic
1074196874 10:111196608-111196630 CATGTTCTGCAGAAGGCAAATGG + Intergenic
1076076660 10:127538789-127538811 CGCGCTCTGCCAGAAGCAAGTGG - Intergenic
1076154019 10:128188945-128188967 AGAGCTCTGCAGAAGGCAGGTGG + Intergenic
1076404090 10:130201018-130201040 CCTGTTCTGCAGGAGGGGAGAGG + Intergenic
1076462795 10:130657791-130657813 CGTTCACTGCAGGAGCCACGGGG - Intergenic
1077529441 11:3088271-3088293 GGGGCTCTGCAGGAGGCCTGGGG + Exonic
1077689849 11:4332240-4332262 CGTGGGTAGCAGGAGGCAAGTGG + Intergenic
1079244026 11:18740229-18740251 AATGCTCGGCAGGAGGAAAGTGG + Intronic
1079399933 11:20098653-20098675 CTTGCTCTGCAGGTGGCAAGTGG + Intronic
1084284432 11:68121961-68121983 CGAGGTCTGAAGGAGGGAAGAGG + Intergenic
1085783786 11:79433973-79433995 CATGCTCAGCAGGAGACATGAGG - Intronic
1091829066 12:3536379-3536401 TGTGCCATGCAGGAGGCAAAAGG - Intronic
1098089424 12:66885309-66885331 CCTGCTCTGCAGGTGCCAAGGGG - Intergenic
1099797849 12:87421442-87421464 AGTGCTCTGCAGCTAGCAAGAGG - Intergenic
1104970304 12:132527936-132527958 AGAGCTCTGCAGGAAGGAAGAGG - Exonic
1104988729 12:132612226-132612248 CGTGTAGGGCAGGAGGCAAGGGG + Intergenic
1105547457 13:21361281-21361303 AGGGCTGTGCAGGAGGAAAGAGG + Intergenic
1111450612 13:88410075-88410097 CGTGCTCTCCAGGAGACTAAGGG - Intergenic
1114552109 14:23538704-23538726 CTTCCTCTGAAGGAGGCAAGAGG + Intronic
1116973633 14:51093955-51093977 GGTGCATTGCAGGAGGCATGGGG - Intronic
1117494952 14:56293841-56293863 ACTGCCCTGCAGGAGGAAAGGGG + Intronic
1117721595 14:58634070-58634092 AGTGCTCTGCAGGAGGAAGCAGG + Intronic
1118843485 14:69528976-69528998 CATGCTGTGCAGGAGGAAAGGGG + Exonic
1119046848 14:71326050-71326072 CCTGCTCTGTGGGAGGAAAGAGG - Intronic
1119395346 14:74322229-74322251 CTTGAGCTCCAGGAGGCAAGAGG - Intronic
1120617137 14:86721108-86721130 GGTGCTCTGGAGGATGCCAGGGG - Intergenic
1121262220 14:92574724-92574746 CCTGCTCTGCTGGAGGAGAGGGG + Intronic
1121311350 14:92936876-92936898 TGTGCTTTGCAGGGGGCAGGGGG - Intergenic
1122006857 14:98712505-98712527 CGTGCATTACAGGATGCAAGAGG + Intronic
1122794401 14:104198767-104198789 AGGGCTCTGCAGCAGGCAGGAGG - Intergenic
1123012601 14:105356588-105356610 CCTGCTCCACAGGAAGCAAGCGG - Intronic
1124082672 15:26516292-26516314 AGTGCTCTGCAAGGGGCCAGGGG - Intergenic
1124505085 15:30265367-30265389 CCTGCTCTGGTGGAGGCAACAGG - Intergenic
1124626443 15:31310208-31310230 TGTGCTCTCCAGAAGGCAGGGGG - Intergenic
1124738467 15:32273268-32273290 CCTGCTCTGGTGGAGGCAACAGG + Intergenic
1125657172 15:41367490-41367512 TGTGCTCTGCTGGGGGCCAGTGG - Intronic
1125675982 15:41502838-41502860 CGAGTTCTTCAGGAGGCACGAGG + Exonic
1127739944 15:61893298-61893320 CATGCCCTGCAGGAGGCAGTGGG + Intronic
1128536252 15:68492922-68492944 CCTGCAGGGCAGGAGGCAAGAGG - Intergenic
1128695883 15:69762511-69762533 TGTGATCTGCAGGAGGCAAGAGG + Intergenic
1133236231 16:4388626-4388648 CGTGCTCTGCAGGAGGCAAGAGG + Exonic
1135052506 16:19204254-19204276 TGTGCCCTGCAGGGGGCATGTGG - Intronic
1135569131 16:23534975-23534997 CAAGCTCTCCAAGAGGCAAGGGG - Exonic
1136104644 16:28021155-28021177 CGGGCTATGCAGGAAGCATGAGG + Intronic
1137556423 16:49473207-49473229 CGGCCTCTGCAGGAGACCAGGGG + Intergenic
1138532601 16:57642974-57642996 AGTGCTTTGCAGGATGCCAGCGG + Intronic
1139683443 16:68583016-68583038 GGTGCTCTGCATGAGGCCAGAGG + Intergenic
1140410585 16:74738377-74738399 CCATCACTGCAGGAGGCAAGGGG - Intronic
1141879752 16:86849987-86850009 CGTGCTCTGCAGGGGGCCTCAGG + Intergenic
1142227932 16:88886459-88886481 CGTGGTCTGGAGAAGGCGAGAGG + Intronic
1143064405 17:4233771-4233793 CGTACTCTGCTGGAGGAAACAGG - Intronic
1143622253 17:8087444-8087466 GCTGCTCTTCAGGAGGCAAGAGG + Exonic
1143927921 17:10389450-10389472 AGTGACCTGAAGGAGGCAAGAGG - Intergenic
1144858262 17:18282955-18282977 TGTTCTCTGCAGGAGGCCTGCGG - Intronic
1145327966 17:21847753-21847775 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145328115 17:21848723-21848745 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1145348652 17:22058135-22058157 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1145694772 17:26779137-26779159 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1146259371 17:31411668-31411690 CAAGCACGGCAGGAGGCAAGAGG - Intronic
1147045512 17:37748869-37748891 CCTGTTCTGCAGGAGGTCAGGGG + Intergenic
1151512411 17:74569387-74569409 CCGGCTCTGCAGGCTGCAAGGGG - Intergenic
1152154299 17:78622751-78622773 CGGGGTCTGCAGGAAGCGAGGGG + Intergenic
1152209165 17:78993989-78994011 CGTGCGCAGTAGCAGGCAAGGGG + Intronic
1203192596 17_KI270729v1_random:203974-203996 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1203201961 17_KI270730v1_random:3409-3431 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1153451301 18:5232588-5232610 CCTGCTCTGGTGGAGGTAAGAGG + Intergenic
1153794839 18:8611955-8611977 CCCGCTCTGCAGCAGGCCAGGGG - Intronic
1154410807 18:14141183-14141205 CTCGCCCTGCAGGAGGCCAGAGG - Intergenic
1157684036 18:49628724-49628746 GGTGCTCTCTAGGAAGCAAGCGG + Intergenic
1158881390 18:61782797-61782819 CAGGCTTTGCAGGAGGCAACAGG - Intergenic
1161158661 19:2749163-2749185 CGTGCTTTGATGGAGCCAAGAGG - Intergenic
1161723979 19:5918027-5918049 TGTGTTCTGCAGAAGGCAGGAGG - Intronic
1162406167 19:10475190-10475212 CGTAATCTGAAGGAGGCCAGGGG + Intergenic
1164574452 19:29397603-29397625 CCAGCTCTGCAGGAAGCATGAGG - Intergenic
1165447998 19:35867269-35867291 AGTGCTTTGCAGGTAGCAAGAGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926152579 2:10433053-10433075 CGTGAACTGCAGGAGGCAGGTGG - Intergenic
927569377 2:24144858-24144880 AGTACTCTGCAGGGGGCTAGGGG + Intronic
928369604 2:30731563-30731585 CGAGCTCTGCACGGGGCGAGTGG + Intronic
928716846 2:34071211-34071233 GGTGCACAGCAGGAGGTAAGTGG - Intergenic
928871534 2:35986825-35986847 CCTGCTCTGTAGGAAGCAAAGGG + Intergenic
931445673 2:62325166-62325188 CTGGGTATGCAGGAGGCAAGAGG + Intergenic
931714810 2:65020788-65020810 CATGCTCTCCAGGAAGCAACAGG + Intronic
933596346 2:84287328-84287350 AGTACTCTGAAGGAGCCAAGGGG - Intergenic
934553720 2:95276864-95276886 CGGGCTCTGCAGGAGCCGGGGGG - Intronic
934773595 2:96923457-96923479 AGTGCCCTGCATGAGGCAGGCGG + Intronic
935161619 2:100534453-100534475 AGGGGTCTGAAGGAGGCAAGTGG - Intergenic
936278935 2:111121781-111121803 CTTGCTCTGCAGGAGTCCTGCGG + Intronic
942509760 2:176685370-176685392 CGTGCTCTGCAGGCTGTCAGGGG + Intergenic
944641900 2:201735661-201735683 GGTGCTGTGCAAAAGGCAAGAGG + Intronic
945084351 2:206116446-206116468 CGTGCTCTGCAGCCTGCACGTGG - Intronic
948585212 2:239015009-239015031 TGTGTTCTTCAGGAGGCAGGAGG + Intergenic
948860376 2:240750013-240750035 CTTGCTCTGCAGCAGGCTGGGGG + Intronic
1168750923 20:280454-280476 CTTGCTCTGCAGGTGGCACATGG + Intronic
1170548163 20:17452682-17452704 CATGCAGTGCCGGAGGCAAGGGG - Intronic
1171411668 20:24952028-24952050 AGTGCTCCCCAGGAGGCAGGAGG - Intronic
1171518239 20:25756575-25756597 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1171558620 20:26099629-26099651 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1171865283 20:30484579-30484601 CATGAGCTGCATGAGGCAAGAGG + Intergenic
1174367890 20:50067453-50067475 TGTTCTCTGCAGGAAGCTAGAGG + Intergenic
1174422068 20:50405646-50405668 CATGTTCTGCAGGAAGCCAGGGG + Intergenic
1176017880 20:62945974-62945996 CGTGGTGGGCAGGAGGGAAGTGG + Exonic
1176022268 20:62967873-62967895 CGGGCGCTGCAGGAGGCTTGCGG - Exonic
1176075990 20:63248417-63248439 CCTGCATTGCAGGAGGCACGAGG + Intronic
1176652396 21:9562986-9563008 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1176862251 21:14017236-14017258 CTTGCCCTGCAGGAGGCCAGAGG + Intergenic
1178458262 21:32776289-32776311 CCACCCCTGCAGGAGGCAAGTGG + Intergenic
1182111303 22:27725693-27725715 GGTGATCTGCAGGAGGACAGTGG - Intergenic
1183318413 22:37149362-37149384 CGTGCTCATCAGGAGGCTTGTGG - Intronic
1185367685 22:50444445-50444467 CGTGCCCTGCTGGAGGACAGAGG + Intronic
949980780 3:9500660-9500682 GGTGCCCTGCAGGATGCCAGGGG - Exonic
950307638 3:11928675-11928697 CGTGCTCACCAGAAGGCAGGTGG - Intergenic
950636609 3:14319894-14319916 GACCCTCTGCAGGAGGCAAGCGG - Intergenic
951043575 3:18014094-18014116 CCTGCACAGCAGGAGGTAAGTGG + Intronic
955349508 3:58183475-58183497 AGTGCTCCACAGGAGGCACGTGG - Intergenic
958101208 3:89013397-89013419 CTCTCTCTGCAGGAGACAAGAGG - Intergenic
961173453 3:124815495-124815517 CTGACTCAGCAGGAGGCAAGCGG + Intronic
962492946 3:135911294-135911316 AGTGCTTGGCTGGAGGCAAGAGG + Intergenic
967824355 3:193866870-193866892 CATGCTCTGCAGCATCCAAGGGG - Intergenic
968771548 4:2510755-2510777 CGTGCTCAGCAAGAGGGAAAGGG + Intronic
968927722 4:3558684-3558706 CGAGCGCTGAAGGAGGCCAGTGG + Intergenic
970583159 4:17491818-17491840 TGGGGTCTGCAGGAGACAAGTGG + Intronic
984780958 4:183525436-183525458 CGTGGTCTAGGGGAGGCAAGGGG - Intergenic
985692092 5:1319193-1319215 CAGGCTCTGCAGGGGGCAGGCGG + Intronic
989484060 5:41967775-41967797 TGTGCTCTGGAAGAGGCAGGTGG + Intergenic
989759789 5:44999797-44999819 AGTGCTCTGCAGCTAGCAAGAGG - Intergenic
990256371 5:53974998-53975020 GGTGCTGTGAAGGAGGCATGAGG + Intronic
994136990 5:96299550-96299572 TGTGCTGTGGAGGAGGAAAGAGG - Intergenic
995188658 5:109297955-109297977 CAAGGTCTGCTGGAGGCAAGAGG + Intergenic
997376433 5:133400897-133400919 CGTGCTCAGCAGGAAGACAGGGG - Exonic
1000297038 5:159921157-159921179 AGAGCTCTGGAGGAGACAAGAGG - Intronic
1000926596 5:167202024-167202046 TGGGCTCTGCATGAGACAAGGGG - Intergenic
1002444165 5:179279036-179279058 GGTGCTCTGCAGAAGGAAACAGG - Intronic
1003404222 6:5815405-5815427 AGGGCTGTGCAGGAGGAAAGAGG - Intergenic
1004881506 6:20013054-20013076 AGTGGGCAGCAGGAGGCAAGTGG + Intergenic
1007498873 6:42280410-42280432 CGTGCTCTGAGGGAGGGCAGGGG + Intronic
1017886029 6:158600020-158600042 TGTGGCCTGCAGGAGGCACGCGG - Intronic
1018713821 6:166516405-166516427 CAGGCTCTGCAGGAAGCCAGGGG + Intronic
1019131519 6:169880563-169880585 AGTGCTCTGCAGGAGCCAGGTGG + Intergenic
1020022468 7:4877478-4877500 CTCGCTCTGCAGGAGGCAGTCGG - Intronic
1022125503 7:27352452-27352474 CGTGCTGTGCAGGTGTGAAGGGG + Intergenic
1022506343 7:30910511-30910533 CGTTCCATGCAGCAGGCAAGAGG + Intergenic
1022858423 7:34339951-34339973 TGTTCTCTGCAGGAAGCAGGAGG + Intergenic
1023043653 7:36193759-36193781 CGTGGTCAGCAGGTGGCCAGCGG + Intronic
1023227591 7:37987205-37987227 GGTGCCCAGCAGGAGGGAAGTGG - Intronic
1023793380 7:43771288-43771310 CGTGCACTTCAGTAGGCTAGAGG - Intronic
1025248765 7:57337798-57337820 CATGTTCTGCAGGAAGCCAGGGG - Intergenic
1025279063 7:57613913-57613935 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1025305668 7:57851587-57851609 CATGCTGGGCAGGAGGAAAGAGG - Intergenic
1030751045 7:113233231-113233253 CGTGCTCTGCAAAATGCGAGAGG - Intergenic
1033212669 7:139471728-139471750 CTTGCCCTGGAGGAGCCAAGAGG - Intronic
1033259363 7:139829295-139829317 CGTGCTCTGCAGGTAGAAAAGGG - Exonic
1034518346 7:151599751-151599773 GCTGCACAGCAGGAGGCAAGGGG - Intronic
1035515593 8:229700-229722 CGTGCTCTGCTGGCGGCCGGGGG + Intergenic
1036971654 8:13362079-13362101 CAGGCTCTGAAGGAGGAAAGTGG + Intronic
1037510313 8:19575979-19576001 CCTGCTCTGCAGAAAGGAAGGGG - Intronic
1037948774 8:23005486-23005508 GGTTCTCTGCAGGCGGCTAGAGG - Intronic
1038637411 8:29299067-29299089 CGTAATATTCAGGAGGCAAGAGG + Intergenic
1042827608 8:72994234-72994256 CCTGCTCTACAGGATGCAAGAGG + Intergenic
1043770812 8:84197677-84197699 CGAGCTCTCAGGGAGGCAAGAGG + Intronic
1043868544 8:85402982-85403004 AGTGCTCTGCATGAGCCAAGAGG + Intronic
1043968899 8:86508716-86508738 GGTGCTGTGCAGGAGGCGGGCGG - Exonic
1048556091 8:135477922-135477944 GGTGCTCAGCAGGAGGTGAGTGG + Intronic
1048620554 8:136128369-136128391 CCTTCTCTGGAGGAGGCCAGTGG - Intergenic
1049818668 8:144621000-144621022 CCTGCTTTGCAGGAGGCACATGG + Intergenic
1052113100 9:24614222-24614244 AATTCTCTGAAGGAGGCAAGAGG + Intergenic
1053477197 9:38391074-38391096 CGTGCTGTGGGGGAGGCAGGAGG + Intergenic
1053802578 9:41773763-41773785 CGAGCGCTGAAGGAGGCCAGTGG + Intergenic
1054142660 9:61541307-61541329 CGAGCGCTGAAGGAGGCCAGTGG - Intergenic
1054462411 9:65472457-65472479 CGAGCGCTGAAGGAGGCCAGTGG - Intergenic
1054647485 9:67602608-67602630 CGAGCTCTGAGGGAGGCCAGTGG - Intergenic
1057726311 9:97571048-97571070 TGTGCTCCACTGGAGGCAAGAGG + Intronic
1061220486 9:129247674-129247696 CTTGCCCTGGAGGAGGCATGGGG + Intergenic
1061675539 9:132213580-132213602 CGTGTTCTGCAGGATGAAGGAGG - Intronic
1061910089 9:133717722-133717744 CGTGAGCTGCAGGGGGCCAGAGG - Intronic
1061950365 9:133932726-133932748 CGGGCCCTGGAGGAGGCAGGCGG - Intronic
1062423220 9:136494026-136494048 GGAGCTCTGCAGCAGGCAGGGGG - Intergenic
1203630124 Un_KI270750v1:66527-66549 CATGCTGGGCAGGAGGAAAGAGG + Intergenic
1189634004 X:42985663-42985685 TGAGCTCTGCAGGAGGTAATGGG + Intergenic
1196962032 X:121014111-121014133 AGGGCTCTACAGTAGGCAAGTGG + Intergenic
1200124638 X:153807501-153807523 GGGGCTCTGCAGGAGGCAACTGG - Intronic