ID: 1133236610

View in Genome Browser
Species Human (GRCh38)
Location 16:4390195-4390217
Sequence GACCCAGGAGAGCCCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 14, 3: 61, 4: 376}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133236600_1133236610 22 Left 1133236600 16:4390150-4390172 CCATGGGGGAGCCGCACGGTGTT 0: 1
1: 0
2: 1
3: 2
4: 44
Right 1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG 0: 1
1: 0
2: 14
3: 61
4: 376
1133236605_1133236610 11 Left 1133236605 16:4390161-4390183 CCGCACGGTGTTAGGGGAGGAAG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG 0: 1
1: 0
2: 14
3: 61
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133236610 Original CRISPR GACCCAGGAGAGCCCCAGCC TGG Intronic
900150419 1:1176579-1176601 GGCCCAGGAGGCTCCCAGCCGGG - Intronic
900309754 1:2028019-2028041 GACCGAGCAGGACCCCAGCCAGG - Intronic
900347404 1:2216286-2216308 GACACTGGTGAGGCCCAGCCTGG - Intergenic
900361548 1:2291519-2291541 GTCCCAGGAGAACCCCAGCAAGG + Intronic
900495310 1:2973436-2973458 GAGAAAGGGGAGCCCCAGCCTGG + Intergenic
900509268 1:3050835-3050857 GCCCCTGGAGAGCTCCATCCTGG + Intergenic
900637927 1:3674911-3674933 AACCCAGAAGAGCCCCCGCCTGG - Intronic
900981812 1:6050044-6050066 ACCCCAGGAAAGGCCCAGCCTGG + Intronic
901226001 1:7613392-7613414 CACACAGGAGAGGCCCAGCCTGG + Intronic
901241261 1:7695080-7695102 CACCCAGGAGAGCTAAAGCCAGG + Intronic
901523957 1:9807703-9807725 GAGGCAGGAGAGCCACAACCGGG - Intronic
901769337 1:11522573-11522595 GACCCAGCCAAGACCCAGCCAGG + Intronic
901769456 1:11522914-11522936 GACCCAGCAAGGACCCAGCCAGG + Intronic
901858696 1:12060388-12060410 GACCCAGGGGAGCCACTGCAGGG + Intergenic
902470589 1:16645580-16645602 GACCCACCACAGCCCCATCCGGG - Intergenic
903690135 1:25167513-25167535 GAGCCAGCAGAGCCCGGGCCAGG - Intergenic
903905466 1:26682822-26682844 GACCCAGGAGATTCACAGACTGG + Intergenic
904208233 1:28868924-28868946 GACCCAGCAGGTGCCCAGCCTGG - Intergenic
904259526 1:29280364-29280386 GACCCTGGATAGGTCCAGCCTGG + Intronic
904673092 1:32180432-32180454 AGCCCAGGAGCGGCCCAGCCAGG + Exonic
906376079 1:45297751-45297773 GAGCCAGGAGAGCAGCAGACAGG - Intronic
908229802 1:62092510-62092532 GAGGCAGGAGAACTCCAGCCTGG - Intronic
909480429 1:76124177-76124199 GTGCCAGGTGAGCCCCAGCTGGG + Intronic
911390273 1:97232924-97232946 GACCCAGGAAAACCTCAGGCTGG - Intronic
912467381 1:109883356-109883378 CACCCAGGAGAGCCAAAGCTGGG + Intergenic
912682939 1:111740302-111740324 GAGCCGGGCGAGCGCCAGCCAGG + Intronic
915512242 1:156392694-156392716 GGGCCAGGAGTGCCCCAGCTGGG + Intergenic
917932907 1:179836833-179836855 CACCCAGTAGAGCCCCCACCGGG + Intergenic
918163041 1:181919151-181919173 GACCCAGCAGATTTCCAGCCAGG - Intergenic
919343003 1:196337606-196337628 GTTCCTGGAGAACCCCAGCCAGG + Intronic
921213818 1:212920963-212920985 GACCCAGGTAAGCCCCATGCTGG + Intergenic
921641432 1:217559642-217559664 ATCCCAAGAGAGCCCAAGCCTGG + Intronic
922200224 1:223394528-223394550 GGACCAGGAGAGCCCGCGCCAGG + Exonic
922621037 1:226988358-226988380 AACCCAGGCCAGCCCCAGCCAGG + Intergenic
922702324 1:227769142-227769164 GCCCCAGGGGAGACACAGCCTGG - Intronic
922768876 1:228171304-228171326 CTCACAGGAGAGCCCCGGCCTGG - Intronic
1063456388 10:6185558-6185580 GACCCAGATGAGCCCCTGGCTGG - Intronic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1067052346 10:43029146-43029168 GACCCAGCAGGGCCTCCGCCCGG + Intergenic
1067095519 10:43296944-43296966 GGCCCAGGAGAAGACCAGCCTGG + Intergenic
1067695990 10:48536025-48536047 GACCCAGGCCAGCCTCTGCCGGG - Intronic
1069158271 10:65054855-65054877 GTCCCAGGAGAGGCCCAGGGTGG + Intergenic
1069283824 10:66688918-66688940 GAGCCAAGATTGCCCCAGCCTGG + Intronic
1069594843 10:69663898-69663920 CCCCCAGGAGAGCCCGAGACCGG - Intergenic
1069664332 10:70144993-70145015 ACCCCAGGAGAGCACCATCCTGG + Intronic
1069749153 10:70734599-70734621 GACCCAGGAGCTGACCAGCCAGG - Intronic
1070780489 10:79134870-79134892 GAGCCAAGATAGCACCAGCCTGG - Intronic
1072523307 10:96249460-96249482 GACCCAGCAGAGCACCAGCATGG - Intronic
1072791112 10:98318560-98318582 TACCCAGGCGAGCACCATCCCGG + Intergenic
1073190889 10:101650003-101650025 GACTCTGGGGAGCCTCAGCCTGG - Intronic
1074580239 10:114712013-114712035 CACCCTGGAGACCCCCAGGCAGG - Intergenic
1075080548 10:119380763-119380785 GACCCAGGAGAAGGCCAGGCAGG - Intronic
1075594531 10:123718774-123718796 AACCCAGGAGAGCCCCTGCATGG - Intronic
1075690051 10:124388613-124388635 GATCAAGGTGGGCCCCAGCCAGG + Intergenic
1075716853 10:124560747-124560769 GACCCCGGAGAGCCCTAGAGGGG - Intronic
1075885641 10:125896697-125896719 GTTCCCGGGGAGCCCCAGCCCGG - Intronic
1075967833 10:126628146-126628168 AACACAGGAGTGACCCAGCCTGG - Intronic
1075991177 10:126840137-126840159 CACTCAGGAAAACCCCAGCCAGG + Intergenic
1076780895 10:132723804-132723826 ACCCCAGGAGAGCGGCAGCCCGG - Intronic
1076821938 10:132943679-132943701 CACCCAGGAGAGGCCCACCTGGG + Intergenic
1076898392 10:133325291-133325313 GACCCAGGAGAGACCCCGTGGGG - Intronic
1077048923 11:558092-558114 CCCCCAGGCCAGCCCCAGCCTGG + Intronic
1077093824 11:791046-791068 GACTCAGGAGAGACCAAGCTGGG + Exonic
1077216771 11:1398310-1398332 GGCCCAGGCCAGCCCCAACCAGG - Intronic
1077333043 11:1991704-1991726 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1077444142 11:2582470-2582492 GGCCCAGGAATGCCCCAGCTGGG - Intronic
1077499633 11:2903302-2903324 GACCCAGGAGAGATCCAAGCAGG - Exonic
1078085509 11:8231108-8231130 TCCCAAGGGGAGCCCCAGCCAGG - Intronic
1078545955 11:12247129-12247151 GACACAGGAGAGCACTGGCCTGG - Intronic
1079128565 11:17735060-17735082 CAGCCAGGAGAACCCCCGCCTGG + Exonic
1079195358 11:18322198-18322220 CATCCAGGAGAGCCGCAGACTGG + Intronic
1079742662 11:24082993-24083015 GAGGCAGGAGAGCCCTAACCTGG + Intergenic
1080596334 11:33777131-33777153 GACCCAGGAGAGCCCTTTCCTGG + Intergenic
1080746825 11:35115740-35115762 GACCCAGGAGTGCCCCGCACTGG + Intergenic
1083410455 11:62488948-62488970 GACACAGGAGCGGCCCAGCGCGG + Intronic
1083629469 11:64088257-64088279 CACCCAGGGGAGCCGTAGCCAGG + Intronic
1083705424 11:64510928-64510950 GACCCTGGAGAGGCACCGCCTGG + Intergenic
1083726121 11:64629343-64629365 AACGGAGGAGAGCCCCAGCATGG - Intronic
1083791621 11:64989629-64989651 GGCCCAGGAGCCCCTCAGCCTGG + Exonic
1083844208 11:65321555-65321577 GTCCCAGGTGGGGCCCAGCCAGG + Exonic
1084033110 11:66492556-66492578 GACCCAGTAGGGCCCAGGCCTGG + Intronic
1084526376 11:69700914-69700936 GACCCAGGACAGGCGCAGGCGGG + Intronic
1085514405 11:77103937-77103959 GGCCCAGAAGAGCCACAGCTGGG - Intronic
1086331236 11:85756269-85756291 GGCACAGCAGAGCCCCATCCAGG + Intronic
1086584072 11:88431936-88431958 GACAAAGGAGAGCCACAGCATGG - Intergenic
1087891993 11:103545868-103545890 CTCCCAGGATAGCTCCAGCCTGG - Intergenic
1089355039 11:117843992-117844014 GAACCAGGAAAGCCCAAGGCTGG + Intronic
1089771177 11:120804303-120804325 GATCCAGCAAAGCTCCAGCCTGG + Intronic
1202816026 11_KI270721v1_random:46882-46904 GGCCGAGGAGGGCCCCCGCCCGG + Intergenic
1092283571 12:7115490-7115512 GCCCCAGGTGAGGACCAGCCAGG - Intergenic
1093182525 12:15983314-15983336 GACACAGCAGAGGCACAGCCAGG - Intronic
1093465000 12:19439954-19439976 GAGCCCCGAGAGCGCCAGCCAGG + Exonic
1096231319 12:49898342-49898364 GTCCCCAGGGAGCCCCAGCCGGG - Intronic
1099613850 12:84911504-84911526 GACGCTGGAGAGCGCGAGCCTGG + Intronic
1101744921 12:107532223-107532245 GCCCCAGGACAGACCCAACCAGG + Intronic
1102028244 12:109725611-109725633 GACCCAGGTGAGACCAGGCCAGG + Intronic
1102228632 12:111247275-111247297 GCCCCGGGAGAGCCTCAGCCGGG - Intronic
1103270010 12:119665485-119665507 GACCCAAGAGAGACACAGCTGGG + Intergenic
1103324386 12:120110791-120110813 TGCCCAGGAGAGCCTCACCCTGG - Intronic
1103619860 12:122180641-122180663 TACACAGAAGAGGCCCAGCCAGG - Intronic
1103847842 12:123912201-123912223 CACCCAGGACAGACCCACCCAGG - Intronic
1104084420 12:125461150-125461172 TACCCAGGAGAGCCAGAGCTGGG + Intronic
1104568318 12:129903984-129904006 GAGCCCCGCGAGCCCCAGCCGGG - Intergenic
1105514640 13:21078203-21078225 GACCCCGGGGAGCCTCCGCCAGG + Intergenic
1106128430 13:26920281-26920303 GACCCAGGAGAGCTCCGTCAGGG + Intergenic
1107535211 13:41322632-41322654 GACACAGGACAGACACAGCCAGG - Intronic
1108466945 13:50726203-50726225 GACTCATGAGATCCCCAGCCAGG + Intronic
1109442821 13:62397630-62397652 GGCCCAGGCCAGCCACAGCCTGG - Intergenic
1111862636 13:93727776-93727798 GACCAAGGAGGGCCTCAGACAGG - Intronic
1112046374 13:95602109-95602131 GACCCTGGACAGCTGCAGCCTGG + Intronic
1112503574 13:99959823-99959845 GGGCCCGCAGAGCCCCAGCCCGG + Intergenic
1113601609 13:111573362-111573384 GCCGCAGATGAGCCCCAGCCGGG + Intergenic
1114498865 14:23153514-23153536 GACACTGGTTAGCCCCAGCCTGG + Intronic
1115530530 14:34322844-34322866 GAGCCACGTGAGGCCCAGCCTGG + Intronic
1118086797 14:62426838-62426860 GATCCAGGGGAGCACCAGCTGGG + Intergenic
1119569840 14:75660833-75660855 CCCCCAGGACAGCTCCAGCCCGG + Exonic
1120839288 14:89069433-89069455 GAGCCATGATAGCACCAGCCTGG + Intergenic
1120905704 14:89619210-89619232 GACCCAGCAGGGCTCCAGGCCGG - Intergenic
1121404397 14:93710444-93710466 TACCCAGGAGAGCCCAAACATGG + Intergenic
1121691036 14:95877116-95877138 CACGCAGCAGAGCCGCAGCCCGG - Intergenic
1121842464 14:97145707-97145729 GAAACACCAGAGCCCCAGCCTGG + Intergenic
1122115003 14:99523191-99523213 GCCCCAGCCCAGCCCCAGCCTGG - Intronic
1122207608 14:100155911-100155933 GCCCCATCAGAGACCCAGCCAGG - Intronic
1122657741 14:103273568-103273590 GGCGGAGGAGACCCCCAGCCTGG + Intergenic
1122738546 14:103857502-103857524 GGCCTTGGAGAGCCACAGCCCGG - Intergenic
1122740112 14:103867357-103867379 GGCCCCGGGGAGCTCCAGCCAGG - Intergenic
1122830604 14:104393792-104393814 GACCCTGGAGAGACCTGGCCAGG + Intergenic
1122967961 14:105140047-105140069 GCCTCAGGACAGCCCCTGCCAGG + Intergenic
1123000177 14:105289479-105289501 GACTCAGGAGAGACCCATCCTGG + Intronic
1123037178 14:105476213-105476235 GACCCTGGAGAGCCCCAGGCTGG - Intronic
1123495080 15:20816436-20816458 GCCCCAGGAGACCCCCAGCTTGG + Intergenic
1123551572 15:21385529-21385551 GCCCCAGGAGACCCCCAGCTTGG + Intergenic
1125519772 15:40341163-40341185 GCCCCAGCAGGACCCCAGCCTGG + Intergenic
1127959095 15:63877880-63877902 GCCCCAAGAGAACCCCTGCCTGG - Intergenic
1127961992 15:63896779-63896801 GACCCAGGTGTTCCCCAGCTGGG - Intergenic
1128088024 15:64899075-64899097 AAGCCAGCAGAGCCCCAGCTGGG + Intronic
1128635506 15:69299639-69299661 GAGCCAGGAGATGCCCAGCTGGG - Intronic
1128668119 15:69553489-69553511 CACCTGGGAGAGCCCCAGACAGG + Intergenic
1128770222 15:70276550-70276572 GCCCCTGGGGTGCCCCAGCCAGG + Intergenic
1128838793 15:70832744-70832766 GACCCAGGAGTGCGCCATCGTGG - Exonic
1130305886 15:82711820-82711842 GACCCAGGAAAGCCTCAGAGAGG + Intergenic
1132236625 15:100227038-100227060 GAGCCAGGAGAGGCCCAGGTGGG - Intronic
1202959914 15_KI270727v1_random:112771-112793 GCCCCAGGAGACCCCCAGCTTGG + Intergenic
1132548250 16:543524-543546 GACCCAGGGGAGGGCCAGGCAGG - Intronic
1132565271 16:619615-619637 GAGCCAGGAGAGCCCCTCCGGGG + Intronic
1132702992 16:1229875-1229897 GCCCCTGGTGAGTCCCAGCCGGG - Exonic
1132705331 16:1240993-1241015 GCCCCTGGTGAGTCCCAGCCGGG + Exonic
1132708462 16:1256356-1256378 GCCCCTGGTGAGTCCCAGCCGGG + Exonic
1132744763 16:1432036-1432058 GACCCACAGCAGCCCCAGCCCGG + Intergenic
1132874638 16:2130914-2130936 GACCCAGGTGACCCCCAGCCAGG + Intronic
1132955670 16:2592086-2592108 CGCCCAGGAGAGCCCCAGCAAGG - Intronic
1133133201 16:3690921-3690943 GCCCCAGGCGAAACCCAGCCTGG - Exonic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1133344738 16:5062337-5062359 GCCCCAGGAGAGCCCACGCTGGG + Intronic
1134553580 16:15149747-15149769 GACCCAGGTGACCCCCAGCCAGG + Intergenic
1135969509 16:27062161-27062183 GACCCAGCAAAGCCCCACCGTGG - Intergenic
1136381522 16:29898245-29898267 GACCCTGGACAGCGCCAGCAAGG + Intronic
1137678545 16:50317386-50317408 TTGCCAGGAGAGCCCCCGCCGGG - Exonic
1137792593 16:51187409-51187431 GCCCCAGGAGAACCCCTCCCAGG - Intergenic
1138282298 16:55781212-55781234 GAGACAGGAGAGCCCCAGTTGGG - Intergenic
1139308352 16:66007063-66007085 AACCCTGGAGATCCCCAGCAGGG - Intergenic
1141068935 16:80935901-80935923 GGCCCACGAAAGCACCAGCCAGG + Intergenic
1141804699 16:86334938-86334960 GACCCAGGAGAGCCAGAGTCCGG - Intergenic
1142029013 16:87829240-87829262 GTCCCAGGAGACCTGCAGCCAGG + Intergenic
1142393187 16:89816177-89816199 GGCCCAGGAGGGCCCGAGGCAGG + Intronic
1142827745 17:2524774-2524796 GACTCAGGAGAGCTCTAGGCTGG - Intergenic
1142903394 17:3027006-3027028 GAGCAGCGAGAGCCCCAGCCTGG + Exonic
1143025150 17:3937280-3937302 GACCCTGGAAAGCCCCAGCCAGG + Intronic
1143283597 17:5772840-5772862 CAGCCAGGAGAGCCCTAGCTGGG - Intronic
1143633773 17:8152877-8152899 AACCCAGGAGAGGCCCAGGCAGG - Intronic
1144161817 17:12567653-12567675 AACATAAGAGAGCCCCAGCCCGG + Intergenic
1144496381 17:15748830-15748852 GTCCCAGGAGAGGCCCAGGGTGG - Intronic
1144572478 17:16408134-16408156 GACCCAGAATAGCTACAGCCAGG - Intergenic
1144605966 17:16666234-16666256 GTCCCAGGAGAGGCCCAGGATGG - Intergenic
1144877975 17:18412240-18412262 GACCCAGGAGAGTCGCTGCCAGG + Intergenic
1144905200 17:18635869-18635891 GTCCCAGGAGAGGCCCAGGATGG + Exonic
1145154254 17:20532185-20532207 GACCCAGGAGAGTCGCTGCCAGG - Intergenic
1145303618 17:21657133-21657155 GACCCAGCAGAGCCAGAGCCCGG - Intergenic
1145346424 17:22044716-22044738 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1145819845 17:27823876-27823898 CAGCCAGGAGGCCCCCAGCCAGG - Intronic
1145911824 17:28547557-28547579 GACACAGAAGAGCCCCAGGGTGG + Intronic
1146297303 17:31659927-31659949 GGCCCAGGAGATCCACAGCAGGG + Intergenic
1146377277 17:32303180-32303202 GCCCCAGGGCAGCCCCAGGCAGG - Intronic
1146622450 17:34409604-34409626 AACTCAGGAGAGAGCCAGCCGGG + Intergenic
1147862878 17:43533843-43533865 ACTCCAGGTGAGCCCCAGCCTGG - Exonic
1147947505 17:44088320-44088342 GACACAGGAGAGTACCAGGCTGG - Intronic
1148685152 17:49496720-49496742 GAGCCAGGAGAGGCTCAGACCGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149313788 17:55421229-55421251 GCCCCGGGAGACCCCCACCCTGG + Intronic
1149350678 17:55783865-55783887 GTCCCTGGAGAGCGCCTGCCAGG + Intronic
1149999699 17:61426035-61426057 GACTTAGGAGGGCCCCAGCTGGG + Intergenic
1151416989 17:73973018-73973040 GATTCAGGAGAGGTCCAGCCAGG - Intergenic
1151926025 17:77197661-77197683 GACCCAAGACTGCACCAGCCTGG - Intronic
1152569727 17:81116382-81116404 GGCCCAGGAGAGCCCCACCGAGG - Exonic
1152641182 17:81449912-81449934 CACCATGGAGTGCCCCAGCCTGG + Intronic
1152689708 17:81712404-81712426 GGCCCAGGAGAGCCCAATCCCGG - Exonic
1152697521 17:81804378-81804400 GACTGAGGAGCGCACCAGCCCGG - Intronic
1152701134 17:81820201-81820223 GACCCAGGTGAGCCCAAATCAGG + Intergenic
1152708010 17:81855339-81855361 GACCCTGTAGAGCCCAGGCCAGG + Intronic
1154165858 18:12013799-12013821 GCCCAAGGACAGCCCCAGCGAGG - Intronic
1154201902 18:12306117-12306139 GAGCCTGGAGAGCCCCAGGCCGG + Intergenic
1154452480 18:14488917-14488939 GCCCCAGGAGACCCCCAGCTTGG + Intergenic
1155058880 18:22211013-22211035 GAGCCAAGATAGCGCCAGCCTGG - Intergenic
1156391569 18:36655356-36655378 GGCCCAGGAAAGCCCCAACTAGG - Intronic
1156497304 18:37534335-37534357 GAAGAGGGAGAGCCCCAGCCTGG - Intronic
1157600505 18:48890256-48890278 GACACAGCAGGGCCCCAGCAGGG - Intergenic
1158463540 18:57668646-57668668 GCCCCAGGAGAGCAGCAACCAGG - Intronic
1159051223 18:63422681-63422703 GACCTAGGAGAGCGCAAGCGCGG + Intergenic
1160316632 18:77854005-77854027 GCCCCAGCATAGCCCCAGCCTGG - Intergenic
1161310311 19:3590204-3590226 GGCCCAGCACAGCCCCAGCCCGG + Exonic
1161322180 19:3646391-3646413 ATCCCAGCAGGGCCCCAGCCAGG - Intronic
1161404276 19:4082968-4082990 GCCCTTGGAGAGGCCCAGCCTGG - Intergenic
1161590805 19:5128349-5128371 GGCCCAGGAGGGCCCCACCTGGG - Intronic
1162397509 19:10425608-10425630 GACCTGGGAGAGCCACAGTCTGG + Intronic
1162589091 19:11578967-11578989 GACCCAGGTGAGCCCCGGCGGGG + Exonic
1162817811 19:13207194-13207216 GGCCCGGGAGAGGGCCAGCCGGG - Exonic
1164673308 19:30085500-30085522 GGCCCAGGAGAGTGACAGCCGGG + Intergenic
1165144909 19:33724746-33724768 GGCCCTGGAGCTCCCCAGCCAGG + Intronic
1165384361 19:35501822-35501844 GACCCAGGGGAGCCACGGCTGGG - Intronic
1166073130 19:40398053-40398075 GACCCAGCACATCCCCCGCCTGG - Intronic
1166084383 19:40465499-40465521 GGGCCATGAGCGCCCCAGCCAGG - Intronic
1166780685 19:45340969-45340991 GATCCCGGAGAGCCCCAGGACGG - Intronic
1167475902 19:49700873-49700895 GTCCCAGGAGAGCCTGAGCAGGG - Intronic
1167650639 19:50726754-50726776 CACCCAGGAGTCCGCCAGCCGGG + Intergenic
1168052799 19:53842183-53842205 GTCCCAGGCCAGCCCTAGCCGGG - Intergenic
1168129034 19:54305661-54305683 GTGCTAGGAGAGCCCCGGCCTGG - Intergenic
924962151 2:45458-45480 GGCCAAGGAGACCCCCAGCCAGG - Exonic
925834027 2:7925579-7925601 GACCCAGGATAGCCCTTCCCAGG + Intergenic
925970908 2:9105996-9106018 GAGCCAGGAGAACCACAGCAGGG + Intergenic
926339852 2:11895899-11895921 AACCCAGGAGAGGCCCAGTGTGG - Intergenic
926808334 2:16733762-16733784 CAGCCAGGAGAGTCTCAGCCAGG - Intergenic
927430400 2:23022283-23022305 GACCCATGACAGCCCCACCCAGG + Intergenic
927881867 2:26694602-26694624 GACCCAGAGGTGCCCCAGCTGGG - Intronic
927969754 2:27298173-27298195 GGCCCAAGAGGGCCCCAGACTGG + Intronic
928744555 2:34396333-34396355 GACCCTGGAGAGAACCAGCGAGG + Intergenic
929584008 2:43102100-43102122 TGCCCAGAAGAGCTCCAGCCAGG + Intergenic
929763820 2:44827802-44827824 GACTCAGGACAGCACCAGACTGG + Intergenic
930841076 2:55845917-55845939 AACCCAGGACAGGCCCATCCTGG - Intergenic
931926092 2:67074123-67074145 AGCCCAGGAGACCACCAGCCTGG - Intergenic
932319725 2:70812800-70812822 CTCCCAGGAGTGCCCAAGCCAGG - Intronic
932335993 2:70931703-70931725 GACCCTGGAGAGGCCCAGGCAGG - Intronic
932620066 2:73259909-73259931 GCCCAAGGAGACCACCAGCCAGG - Intronic
933715326 2:85355577-85355599 GCCCCAGGAGTGCTCCAGCCAGG + Intronic
933948617 2:87309088-87309110 GTCCCAGGAGAGGCCCACCCAGG - Intergenic
936058710 2:109280497-109280519 GCCCCAGTGGAGCCCCAGTCTGG - Intronic
936105867 2:109623877-109623899 GACCCAGGAGAGCCCAGGATGGG + Intergenic
936155078 2:110042015-110042037 GCCCCAGGAAAGCCACACCCGGG - Intergenic
936189604 2:110329399-110329421 GCCCCAGGAAAGCCACACCCGGG + Intergenic
936331582 2:111552508-111552530 GTCCCAGGAGAGGCCCACCCAGG + Intergenic
936556754 2:113503359-113503381 GACCCGCGAGAGGCCCAGGCGGG - Intergenic
937377933 2:121350482-121350504 GCCCCAGGAGAGCCTCAGTGAGG - Intronic
937869828 2:126778870-126778892 GTCCCAGGTGAGGCCCAGCCTGG - Intergenic
941007523 2:160263064-160263086 GACCCATGATAGCCACTGCCAGG + Intronic
942653645 2:178194053-178194075 GGCCCAGGAGCGCCGCAGCCGGG - Intergenic
946157762 2:217818203-217818225 CACCCCGGGGAGTCCCAGCCTGG - Exonic
946230218 2:218286678-218286700 CCCCCAGGAGAGCCCCAGCCGGG - Exonic
946302347 2:218831707-218831729 GTCCCAGGGGAGCCGGAGCCGGG - Intronic
946619948 2:221549935-221549957 GAGCCAAGATAGCACCAGCCTGG + Intronic
946737843 2:222772634-222772656 GAATCAGGAGAGCCCCAGGCAGG - Intergenic
947200639 2:227611966-227611988 CTCCCAGGTGAGCCCCAGCGTGG + Intronic
947636167 2:231681555-231681577 GAGTGAGGAGAGCCGCAGCCCGG - Intergenic
948365204 2:237450254-237450276 GAGGCAGGAGCTCCCCAGCCAGG + Intergenic
948948330 2:241233190-241233212 GAGCCAGGAAAGACCAAGCCTGG + Intronic
949003773 2:241633664-241633686 GGCCCAGGAGGCCGCCAGCCAGG - Exonic
1169226826 20:3862118-3862140 GAGCCAGGGGAGCCCTTGCCTGG - Intronic
1170267158 20:14479307-14479329 GACACAGGACAGCACCAGCACGG - Intronic
1170621016 20:17996032-17996054 GACCCAGCAGAGACACATCCAGG - Intronic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1170812459 20:19685194-19685216 GGCCCAGCAGTGCCCCAGACAGG + Exonic
1171521136 20:25774818-25774840 GACCCAGCAGAGCCCGAGCCCGG - Exonic
1171555787 20:26081660-26081682 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1172107619 20:32526240-32526262 GGCCCATGTGGGCCCCAGCCTGG + Intronic
1172353191 20:34260021-34260043 GCCCCAGGAGACCCCAGGCCTGG - Intronic
1172364025 20:34335051-34335073 GACCCAGGCCAGACCCAGCCAGG - Intergenic
1173666316 20:44765846-44765868 GACCCAGAAGCGCTCCAGGCTGG - Intronic
1175630889 20:60535350-60535372 GACCCAAGAGAGGCACAGACAGG - Intergenic
1175862725 20:62158918-62158940 GTCCCAGGAGTCCCCCAGCACGG + Intronic
1176086482 20:63297610-63297632 CACCCAGGGAGGCCCCAGCCTGG - Intronic
1176443547 21:6799375-6799397 GCCCCAGGAGACCCCCAGCTTGG - Intergenic
1176654989 21:9579936-9579958 GATCCAGCAGAGCCCGAGCCCGG - Intergenic
1176821716 21:13664418-13664440 GCCCCAGGAGACCCCCAGCTTGG - Intergenic
1176937048 21:14879594-14879616 GACCCAGGAATGACACAGCCAGG + Intergenic
1178264399 21:31129231-31129253 GACCCAGAAGCTCCCCATCCTGG - Intronic
1178494583 21:33076006-33076028 GCCCCAAGAGAGGCCCAGACTGG + Intergenic
1179545683 21:42111151-42111173 GGACCAGGGGAGCCCCAGCCAGG + Exonic
1179545688 21:42111166-42111188 CAGCCAGGTGAACCCCAGCCAGG + Exonic
1179545695 21:42111181-42111203 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545717 21:42111256-42111278 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545734 21:42111316-42111338 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545741 21:42111331-42111353 CAGCCAGGGGAGCCCCAGCCAGG + Exonic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1179545753 21:42111361-42111383 CAGCCAGGGGAGCACCAGCCAGG + Exonic
1179933263 21:44586072-44586094 GGCCCAGGAGGCTCCCAGCCTGG - Intronic
1180019899 21:45116248-45116270 TACCCAGGCCAGCCCCACCCTGG - Intronic
1180074269 21:45454851-45454873 GACCCAGCAGAGACGGAGCCCGG - Intronic
1180285669 22:10742233-10742255 GTTCCCGGGGAGCCCCAGCCCGG - Intergenic
1181065781 22:20305293-20305315 TACCCAGGAGACCCCAAGCGAGG - Intergenic
1181496338 22:23289307-23289329 GGCCCTGGAGAGCCCAGGCCTGG - Intronic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1181917690 22:26293537-26293559 AGCCCAGGAGTTCCCCAGCCTGG - Intronic
1182304067 22:29355968-29355990 GAGTCAGGTGAGCCCCAGCCAGG + Intronic
1182422766 22:30256563-30256585 GACCCAGGACTGGCCCACCCCGG + Intergenic
1182803525 22:33051619-33051641 CACCCCTAAGAGCCCCAGCCTGG + Intronic
1183484428 22:38081707-38081729 GTCCCCGGAGAGCCCCTCCCTGG + Intronic
1183617895 22:38956199-38956221 GACCCAGGAGAGCTGCAACAGGG - Intronic
1183619310 22:38963522-38963544 GACCCAGGACAGGCCCAGTCGGG + Intronic
1183624457 22:38993117-38993139 GACCCAGGACAGACCCAGTCGGG + Intergenic
1183627900 22:39015831-39015853 CACACAGGAGAGCCCACGCCGGG - Intronic
1183640201 22:39088133-39088155 GACCCAGGACAGGCCCAGTCAGG + Intergenic
1184250371 22:43256794-43256816 GGCCCGGGAGAGCCCCAGGCCGG + Intronic
1185267159 22:49910374-49910396 GACTCAGGGGAGCCCCTGCCCGG + Intronic
1185339835 22:50286339-50286361 GCCCCAGGGGAGGCCCAGCCTGG - Intronic
949491119 3:4589910-4589932 GAACCAGGAGAGCCCGAGATAGG - Intronic
952362150 3:32641532-32641554 GGCCCAGCTGAGCTCCAGCCTGG + Intergenic
953268476 3:41416391-41416413 GACCCAGGAGAGTCCCTGCCAGG - Intronic
954289534 3:49642436-49642458 GGCCCAGGAGGACCACAGCCTGG + Exonic
954298843 3:49688674-49688696 GACCCACCACAGCCCCATCCGGG + Exonic
954364156 3:50137505-50137527 GGCCCAAGAGAACCTCAGCCTGG - Intergenic
954615548 3:51967325-51967347 GCCGCAGGACAGCCCCAGCGAGG - Exonic
955226191 3:57062385-57062407 GAACCATGATAGGCCCAGCCAGG + Intronic
958905170 3:99934032-99934054 GGACTAGGAGAGCCTCAGCCGGG + Intronic
959503794 3:107136075-107136097 GACCAAAGAGAGCCCCTGCTGGG + Intergenic
959708868 3:109364337-109364359 TACCCTGGAGAGCAGCAGCCAGG - Intergenic
961200699 3:125043246-125043268 GACCCAGGGGAGGCCTGGCCTGG + Intronic
961756462 3:129130056-129130078 CTCCAAGGAGAGCCCCAGCTGGG + Exonic
962399976 3:135049967-135049989 GACCCTGAGGAGCCCCACCCTGG + Intronic
962609585 3:137063122-137063144 TTCCCAGGAAAGACCCAGCCGGG - Intergenic
962986792 3:140543610-140543632 GTGGCAGGAGAGCCCCAGCAGGG - Intronic
966711881 3:182980332-182980354 CAGGCAGGAGAGCCCCCGCCTGG + Intronic
968310304 3:197677241-197677263 GGCCCATGTGAGACCCAGCCTGG + Intronic
968601798 4:1513112-1513134 GCCCCAGGAGGGTCCCAGCACGG + Intergenic
968816174 4:2823089-2823111 CTCCCAGCAGAGCCCCAGCTGGG + Intronic
968959489 4:3735663-3735685 GACCGAGGACACCCCCAGCCTGG - Intergenic
969296186 4:6271655-6271677 GAGCCAGGAGAGACCCAACTGGG - Intronic
969486564 4:7475475-7475497 GCCACAGGAGTGTCCCAGCCTGG + Intronic
969570611 4:8006109-8006131 GCCCCAGGAGAACACGAGCCTGG - Intronic
969595091 4:8144175-8144197 CACCCAGCAGAGCCTCAGCGGGG + Intronic
969619754 4:8273128-8273150 GACCCAGGCCAGGCCCAGCCGGG - Intronic
971045779 4:22803577-22803599 GATCCAGGAAAGCTCCAGACAGG - Intergenic
972583788 4:40418549-40418571 GACCCAGCACACCCCCAGCAAGG + Intergenic
974099760 4:57403679-57403701 GACGCCAGAGAGCCTCAGCCAGG + Intergenic
974664082 4:64935644-64935666 GACCCATCAGAGCCCCACCTGGG + Intergenic
975992168 4:80268304-80268326 CACCAGGCAGAGCCCCAGCCAGG + Intronic
980830304 4:138123603-138123625 CACACAGGAGAGCACCAGCAGGG + Intergenic
980972079 4:139576335-139576357 GAGCCTGGAGAGCTCCAGCAAGG + Intronic
981018573 4:140001508-140001530 GACCCAGGACAGGGCCAGCTCGG - Intronic
981830173 4:148990477-148990499 GCCCAAGGAGAGACTCAGCCAGG - Intergenic
982972996 4:162014627-162014649 CACCCAGGAGAACCACAGCATGG - Intronic
984727761 4:183037722-183037744 GACCCAGGGGAGCCAAAGCCGGG - Intergenic
985363610 4:189202399-189202421 GCCCCAGGGGAGCCGCGGCCTGG + Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985818519 5:2144545-2144567 GATGGAGGAGAACCCCAGCCGGG - Intergenic
986007154 5:3677749-3677771 GCCCCAGCAGACTCCCAGCCTGG + Intergenic
986507996 5:8473120-8473142 GAGCCAAGAGAGGCCCAGGCAGG - Intergenic
990778177 5:59327365-59327387 GACCCAGGAAAGCCTCAGAAGGG - Intronic
992509162 5:77416411-77416433 GACCCAGGACAGCCCCAACCTGG - Intronic
994082145 5:95718868-95718890 GTCCCAGGAGAGCACAAGCAGGG + Intronic
994692289 5:103034060-103034082 GACCTAGGAGCACCCGAGCCAGG - Intergenic
996873313 5:128215674-128215696 AAACAAGGAGATCCCCAGCCAGG - Intergenic
997520742 5:134523577-134523599 GACCACTGAGAGCCACAGCCAGG + Intergenic
997582536 5:135026860-135026882 GACCCAGGCAAGCCCTAGCTAGG - Intergenic
998148831 5:139745736-139745758 AACACAGGAGACCCCCAGGCGGG - Intergenic
998897870 5:146819211-146819233 GATGCAGGAGAGCAGCAGCCTGG - Intronic
999382040 5:151128112-151128134 GAGCCAGGAGAGTCCCCGCCTGG + Intronic
1001419835 5:171578205-171578227 AGCCCAGGAAAGCCCAAGCCAGG - Intergenic
1001559371 5:172659299-172659321 GCCCCAGGAGAGCACCTGCGGGG - Intronic
1001747716 5:174104535-174104557 GACCCTGGAGAGCACCATCTTGG - Intronic
1001960761 5:175879150-175879172 GATCCAGGGGAGCCCCAGCAGGG - Intronic
1001966707 5:175914665-175914687 GACCAAGAAGAACCACAGCCAGG + Intergenic
1002250241 5:177924539-177924561 GACCAAGAAGAACCACAGCCAGG - Intergenic
1002446407 5:179292828-179292850 TACCTTGGAGGGCCCCAGCCAGG - Intronic
1002637215 5:180614389-180614411 GACCCAGGAGAACAGCAGCAGGG - Intronic
1003194151 6:3900074-3900096 GACACAGGGGAGCCACAGCACGG - Intergenic
1004045971 6:12023151-12023173 GACACAAGAGAAGCCCAGCCGGG + Intronic
1006456894 6:34137085-34137107 TAGCCAGGAGAGCTCAAGCCTGG + Intronic
1006799002 6:36747774-36747796 AAGCCAGGGCAGCCCCAGCCAGG + Intronic
1013169056 6:107619801-107619823 TACCCAGGACAGCCTCAGTCTGG - Intronic
1014045249 6:116877210-116877232 TCCCCAGCGGAGCCCCAGCCCGG - Intronic
1015914555 6:138202962-138202984 GTCCTAGCAGAACCCCAGCCAGG + Intronic
1016874002 6:148846947-148846969 CACTCAGGAGAGCCCATGCCTGG - Intronic
1018304606 6:162442278-162442300 GACCCAGGAGCCCCCCTGCGCGG + Intronic
1019276857 7:180284-180306 GACCCAGGAGCGCCCACGTCAGG + Intergenic
1019302962 7:318181-318203 GCCCCAGGCCAGGCCCAGCCAGG + Intergenic
1019336540 7:485495-485517 GACTCACTAGAGCCCCAGCCTGG - Intergenic
1019346276 7:532264-532286 GACACAGGAGTTCCCCCGCCTGG - Intergenic
1019478659 7:1256087-1256109 GACCCCAGAGAGCCCCCGGCCGG + Intergenic
1021021052 7:15599376-15599398 GACCTAGGGGTTCCCCAGCCAGG - Intergenic
1021876037 7:25050228-25050250 AACCCAGGAGTACCCCAGGCAGG - Intergenic
1023870772 7:44262008-44262030 GACCCAGCAGGACCCCAGCATGG - Intronic
1024291176 7:47805641-47805663 GACCCAGGAGTGCTCAAGGCAGG - Intronic
1025281614 7:57629761-57629783 GACCCAGCAGAGCCCGAGCCCGG - Intergenic
1025303116 7:57835754-57835776 GACCCAGCAGAGCCCGAGCCCGG + Intergenic
1026023993 7:66731012-66731034 GAACCAGGAGGCCCGCAGCCTGG - Intronic
1027583807 7:80032019-80032041 GTTCCTGGAGAGCCCCAGCTGGG + Intergenic
1029927092 7:104329257-104329279 GACCCCGGGGCGCCCGAGCCGGG + Intronic
1031142266 7:117956381-117956403 GGCCCAGGAGACCCCCAGTGGGG + Intergenic
1031484410 7:122310611-122310633 GACGCTTGGGAGCCCCAGCCCGG - Intronic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032098357 7:128951741-128951763 TACCAAGGGGAGCCCTAGCCTGG - Intergenic
1034347663 7:150397233-150397255 GCCCTGGCAGAGCCCCAGCCAGG - Exonic
1034902615 7:154916638-154916660 GCCCCAGGAGAGTCCCGGCTCGG + Intergenic
1034957579 7:155344522-155344544 GTCCCGGGAGAGCCCCAGGGAGG - Intergenic
1034958818 7:155351663-155351685 GACCCAGGAGGGCCCTGGCTGGG - Intergenic
1035205559 7:157291910-157291932 GACCCGGGAGGGCCCCGGGCTGG + Intergenic
1035466596 7:159083564-159083586 GAGCCACCAGAGCCACAGCCAGG + Intronic
1035482553 7:159198880-159198902 GACCCAGGCGAGGCTCTGCCTGG - Intergenic
1035732664 8:1863785-1863807 CACCCTGGAGAGCCACAGACAGG + Intronic
1036557958 8:9876503-9876525 GGGCCAGGTGAGCCCCAGCCTGG - Intergenic
1037834819 8:22209667-22209689 GCCACAGTAGCGCCCCAGCCTGG - Exonic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039615782 8:38953964-38953986 GACCTAGGAGATCCCTTGCCAGG - Intronic
1040571704 8:48617157-48617179 GGGCCAGGAGAGCAGCAGCCTGG - Intergenic
1040813783 8:51484833-51484855 GACCAAGAAAAGCACCAGCCAGG + Intronic
1041696508 8:60742146-60742168 GCCCCAGCAGAGTCCCAGCATGG + Exonic
1049225683 8:141449471-141449493 CACCCAGTCCAGCCCCAGCCTGG - Intergenic
1049250831 8:141588189-141588211 GCCCCAGGAGGGTGCCAGCCTGG + Intergenic
1049475898 8:142796884-142796906 GACCCTTGCGAGCCCCATCCAGG - Intergenic
1049896263 9:113979-114001 GACCCGCGAGAGGCCCAGGCGGG + Intergenic
1049988022 9:970336-970358 GACCCAGGAGAGTGCAAGACAGG + Intergenic
1051907966 9:22118122-22118144 GAGCTAGCAGAGCCCCACCCTGG - Intergenic
1053120100 9:35539831-35539853 TACCCAGGAGAGGACCAGTCAGG + Intronic
1057817036 9:98303531-98303553 GCCCCAGGAAAGCCACAGGCTGG + Intronic
1059673848 9:116517363-116517385 CACCCAGCAGAGCTCCAGGCTGG - Intronic
1060300324 9:122371251-122371273 GACCCAGGGGCGCCCACGCCAGG + Exonic
1060666222 9:125433605-125433627 GCCCCAGGAGAAATCCAGCCAGG + Intergenic
1060995252 9:127872166-127872188 GACCCAGGACAGCACCTGGCTGG - Intronic
1061272227 9:129550092-129550114 CCCCCAAGAGAGCCCCGGCCGGG + Intergenic
1061429981 9:130524660-130524682 GCCACACGAGAGGCCCAGCCAGG + Intergenic
1061482242 9:130902991-130903013 GACCCAGGCCAGGCCCGGCCCGG - Exonic
1061872971 9:133530415-133530437 GACCCAGGTGCACCCCATCCTGG + Intergenic
1061904772 9:133690987-133691009 GCCCCAGGCAGGCCCCAGCCAGG + Intronic
1061929340 9:133824423-133824445 GACATAGAAGAGACCCAGCCAGG + Intronic
1062031890 9:134365536-134365558 GCCCCAGTGCAGCCCCAGCCTGG - Intronic
1062087293 9:134655350-134655372 GCCCCGGGAGGCCCCCAGCCGGG + Intronic
1062208348 9:135349395-135349417 CAGCCCGGAGAGCCACAGCCCGG - Intergenic
1062473633 9:136717378-136717400 GACCCTGGAGAGGCAGAGCCAGG + Intronic
1062541120 9:137042005-137042027 GACCCTGCAGAGCCCAGGCCCGG + Intronic
1062541580 9:137043987-137044009 GAGCCAGGGGAACCCCAGCAGGG + Intronic
1062580076 9:137225525-137225547 GGCCCAGGAAAGCCCCCACCAGG - Intronic
1062612514 9:137381494-137381516 GAACCAGGGGAGCCCCACTCTGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1203525652 Un_GL000213v1:85152-85174 GCCCCAGGAGACCCCCAGCTTGG + Intergenic
1203632714 Un_KI270750v1:83389-83411 GATCCAGCAGAGCCCGAGCCCGG - Intergenic
1185603780 X:1355509-1355531 GGCCCAGGGGAGACCCAGCCAGG + Intronic
1186099017 X:6135182-6135204 GACCCAGGAGTGTCCCAGGAGGG + Intronic
1189336564 X:40174069-40174091 GACCCTGGAGAGGCCAAGCAGGG - Intronic
1192169060 X:68843236-68843258 GCTCCAGGAGCACCCCAGCCAGG - Intergenic
1195936066 X:110126794-110126816 CACACAGGAGTGGCCCAGCCAGG - Intronic
1197977729 X:132183103-132183125 GTCCCTGCAGAGCCCCAGCATGG - Intergenic
1199808536 X:151326738-151326760 GACCTAGGAGAGCTCCAAGCTGG - Intergenic
1200152456 X:153957941-153957963 GCTCCAGGAGAGTCTCAGCCAGG - Intronic
1200232084 X:154449110-154449132 GACGCTGCAGAGCCTCAGCCAGG - Intronic