ID: 1133236722

View in Genome Browser
Species Human (GRCh38)
Location 16:4390827-4390849
Sequence GCTTGCACAAAGTCGCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133236716_1133236722 22 Left 1133236716 16:4390782-4390804 CCTCCACCTGCACAAGATGGACG 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 89
1133236719_1133236722 16 Left 1133236719 16:4390788-4390810 CCTGCACAAGATGGACGTGAGGC 0: 1
1: 1
2: 0
3: 4
4: 65
Right 1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 89
1133236717_1133236722 19 Left 1133236717 16:4390785-4390807 CCACCTGCACAAGATGGACGTGA 0: 1
1: 0
2: 0
3: 4
4: 85
Right 1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG 0: 1
1: 0
2: 0
3: 7
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133236722 Original CRISPR GCTTGCACAAAGTCGCAGCT AGG Intronic
900904091 1:5538563-5538585 GTGTGCTGAAAGTCGCAGCTAGG + Intergenic
906428583 1:45735582-45735604 GCTTGCATATAGTCCCAGCTAGG - Intronic
908356454 1:63328400-63328422 GCTTGTCCAAAGTCACAGTTAGG - Intergenic
910802806 1:91162473-91162495 GCTTTCACAAAGTCCCTGCCTGG - Intergenic
913401959 1:118445937-118445959 TCTAGCACAAAGTCCAAGCTTGG + Intergenic
916877688 1:168987398-168987420 GCTTGCTCAGAGTCGCACATAGG + Intergenic
917173192 1:172201062-172201084 CCTTGCACAAAGCCTCAGCCTGG - Intronic
921321303 1:213942238-213942260 GTTTGCAGAAAGTAGCAGCAGGG - Intergenic
1068157905 10:53224278-53224300 TCTTGCAAAAAGTCCCAACTAGG - Intergenic
1076349988 10:129808953-129808975 GCTTGCACACCGTGGCAGCTGGG - Intergenic
1079658424 11:23010912-23010934 ACTTGCCCAAATTCACAGCTAGG + Intergenic
1081937167 11:46913019-46913041 GCTTGCAGCAAGTCCCAGCCAGG + Intronic
1082061469 11:47864379-47864401 CCTGGCACATAGTAGCAGCTGGG - Intergenic
1083248657 11:61450460-61450482 GCTAGCTCAAAGTCACAGATAGG + Intronic
1089037580 11:115411017-115411039 GCTTACACAAAGACACAGTTAGG - Intronic
1102441471 12:112967157-112967179 TCTTGGAAAAAGTCTCAGCTGGG - Intronic
1103041711 12:117701219-117701241 GCATGCCCATAGTCTCAGCTAGG - Intronic
1104331667 12:127852794-127852816 GCTTGCAAAAACTCACAGATGGG + Intergenic
1109249283 13:59999534-59999556 GCTTTCAGAAGGTAGCAGCTGGG - Intronic
1109317313 13:60765476-60765498 CCCTGCACAAAGTCTCAGCCTGG - Intergenic
1109392152 13:61707376-61707398 TCTTGAATAAAGTGGCAGCTGGG + Intergenic
1113106362 13:106775626-106775648 GCCTGCAGTATGTCGCAGCTAGG - Intergenic
1117903887 14:60564827-60564849 ACTTGCCCAAAGTCACTGCTAGG + Intergenic
1118197209 14:63638325-63638347 GCATGCCCATAGTCCCAGCTAGG + Intronic
1123931361 15:25173232-25173254 CCTAGCACCAAGTCTCAGCTGGG - Intergenic
1123933901 15:25184921-25184943 CCTAGCACCAAGTCTCAGCTGGG - Intergenic
1124440957 15:29686017-29686039 GTTTGCAGAAAGTCTCATCTAGG + Intergenic
1127326787 15:57903612-57903634 GCTTGCACATAGTAGGTGCTTGG - Intergenic
1128423622 15:67518695-67518717 GCTTGCAAAATGTTGAAGCTGGG - Intergenic
1129689979 15:77707682-77707704 GGTTGCAGAACGTCACAGCTGGG - Intronic
1131133291 15:89913402-89913424 GCTTGCCCAAGCTCACAGCTGGG - Intergenic
1132689481 16:1176109-1176131 GCTTGCATAATGGCTCAGCTGGG + Intronic
1133236722 16:4390827-4390849 GCTTGCACAAAGTCGCAGCTAGG + Intronic
1137467239 16:48720931-48720953 GCTTGCACACAGTTCCAGCCTGG + Intergenic
1137802481 16:51274079-51274101 TCTTGCCCAAAGTCACGGCTGGG + Intergenic
1138418139 16:56883113-56883135 AATTGCCCAAAGTCACAGCTAGG + Intronic
1143324992 17:6092876-6092898 GCCTGCCCAAAGAGGCAGCTAGG - Intronic
1147860406 17:43518046-43518068 ACTTGCCCAAAGTCGCAGTTTGG - Intronic
1153407366 18:4756169-4756191 GCTTGGACAAAGTCTCTGCCTGG + Intergenic
1156538101 18:37883215-37883237 GCTAGCATAAAGCCCCAGCTAGG - Intergenic
1162531519 19:11238780-11238802 GCTTGCACAGAGTTGCCCCTGGG - Intronic
1168443552 19:56392318-56392340 GCATGCACAAAGCCTCAGTTTGG - Intronic
925142318 2:1558782-1558804 GCTTGCTCAACTTGGCAGCTGGG + Intergenic
925685177 2:6463855-6463877 GCCTTCTCAAAGTCTCAGCTTGG - Intergenic
931959806 2:67469891-67469913 TCTGGCACAAAGTCTCAGCCAGG - Intergenic
932472042 2:71965969-71965991 TCTTGGGCAAAGTCCCAGCTGGG - Intergenic
948524896 2:238565457-238565479 GCTTTCACAAACACGAAGCTTGG + Intergenic
1168867050 20:1095644-1095666 GCTTGCTCAAGGTCGTAGCTGGG - Intergenic
1169656878 20:7934077-7934099 ACTTGCCCAAAGTCACAGCTAGG - Intronic
1173720683 20:45254935-45254957 TATTGCACAAAGTCTCAGCAGGG - Intergenic
1173856326 20:46252687-46252709 CCTGGCACAAAGTTGAAGCTTGG - Intronic
1181640077 22:24191645-24191667 GCTTGCAGAAGGAAGCAGCTTGG - Intergenic
1183515996 22:38266436-38266458 GCTTGCCCAAGGTCACAGCTGGG + Intronic
956020623 3:64929623-64929645 GCCTGCACCAAATCCCAGCTGGG - Intergenic
958468998 3:94494865-94494887 TCTTGCAGAAAGTCTAAGCTTGG - Intergenic
958870232 3:99550060-99550082 GGTTATACAAAGTCCCAGCTTGG - Intergenic
963924150 3:150933727-150933749 CCTTGCACAAGGTCATAGCTGGG + Intronic
964724121 3:159796392-159796414 GCTGGCACAAAGTGACTGCTTGG + Intronic
967363551 3:188659671-188659693 CCTTGCTCCAACTCGCAGCTTGG + Intronic
967967694 3:194974980-194975002 CCTTGCATGAAGGCGCAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
970545606 4:17127254-17127276 GCTTCCACAAAGCAGCATCTTGG + Intergenic
975611832 4:76211628-76211650 GCTTCCACTATGTCCCAGCTCGG - Intronic
975699383 4:77048401-77048423 GCTTGCACCCACTGGCAGCTGGG + Exonic
982158175 4:152541054-152541076 GGTTGCAAACAGGCGCAGCTGGG - Intergenic
987294160 5:16535576-16535598 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294174 5:16535656-16535678 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294181 5:16535696-16535718 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294188 5:16535736-16535758 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294217 5:16535896-16535918 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294224 5:16535936-16535958 GCCTTCACAAAGTGGGAGCTGGG + Intronic
988773853 5:34457803-34457825 GATTGTACAAATTCACAGCTGGG - Intergenic
997282916 5:132659806-132659828 GCCCGCACAAGGTCTCAGCTGGG + Exonic
997713116 5:136022709-136022731 GCTGGCACAACATTGCAGCTGGG + Intergenic
1001118478 5:168959219-168959241 ACTTGCACAAAGTCACAAGTTGG - Intronic
1001238877 5:170052863-170052885 GCTTGCACAAGGTCACAACTAGG + Intronic
1002490393 5:179572159-179572181 GCTTCCAGTCAGTCGCAGCTCGG + Intronic
1006627593 6:35408419-35408441 GCTTTCTCCAAGTGGCAGCTGGG - Intronic
1010687716 6:78871710-78871732 GCTTGCACACGGTCACAGCCAGG + Intronic
1019324554 7:431845-431867 GCTGGAACAAAGGAGCAGCTGGG + Intergenic
1023702909 7:42910736-42910758 TCTTGCAGAAAGTAGAAGCTGGG - Exonic
1024043103 7:45570113-45570135 ACTTGCTAAAAGTCACAGCTGGG + Intergenic
1028668628 7:93375471-93375493 ACTTGCCCAAAGTCACAGTTGGG - Intergenic
1039395665 8:37223237-37223259 ACTTGCTCAAAGCCACAGCTAGG - Intergenic
1041315648 8:56559462-56559484 GCTTCCACTAAGTACCAGCTGGG - Intergenic
1043229774 8:77787601-77787623 CCTTGCACAAAGCCTCAACTTGG - Intergenic
1048300428 8:133247428-133247450 GCTGCCACAAAGTTGCAGGTGGG + Intronic
1050008202 9:1157165-1157187 GCTTTCACAAAGTCACATTTTGG - Intergenic
1052041134 9:23740385-23740407 GCTAGCTCAAAGGAGCAGCTGGG + Intronic
1053208159 9:36205468-36205490 GCTTGCACACAGTCCCCACTCGG - Intronic
1057411891 9:94823846-94823868 GCTTCCACAAAGTGATAGCTTGG - Intronic
1061180685 9:129023447-129023469 GCTTGCCCAAGGTCACAGCCAGG + Intronic
1062127117 9:134869879-134869901 GCTTGCAGACAGTGGGAGCTCGG - Intergenic
1189735624 X:44066813-44066835 GCTTGGGCAAAGTACCAGCTCGG + Intergenic
1189751404 X:44226478-44226500 TCTTTCATAAAGTAGCAGCTAGG - Intronic
1193868864 X:86772048-86772070 GCTTGCCCAAATTCACAGCAAGG - Intronic
1200941245 Y:8784043-8784065 GCTGTGACAAAGTGGCAGCTTGG - Intergenic