ID: 1133241331

View in Genome Browser
Species Human (GRCh38)
Location 16:4416181-4416203
Sequence CTGCGCCGCCTCGGGGGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133241323_1133241331 -2 Left 1133241323 16:4416160-4416182 CCTGGGCCCCGGCTAGGAGGGCT 0: 1
1: 0
2: 2
3: 12
4: 189
Right 1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 166
1133241319_1133241331 7 Left 1133241319 16:4416151-4416173 CCTCGCAGGCCTGGGCCCCGGCT 0: 1
1: 1
2: 5
3: 38
4: 399
Right 1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 166
1133241325_1133241331 -9 Left 1133241325 16:4416167-4416189 CCCGGCTAGGAGGGCTGCGCCGC 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 166
1133241324_1133241331 -8 Left 1133241324 16:4416166-4416188 CCCCGGCTAGGAGGGCTGCGCCG 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 166
1133241313_1133241331 30 Left 1133241313 16:4416128-4416150 CCGGAAGCTGGGAAGGCAGGCGG 0: 1
1: 0
2: 4
3: 68
4: 802
Right 1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 166
1133241326_1133241331 -10 Left 1133241326 16:4416168-4416190 CCGGCTAGGAGGGCTGCGCCGCC 0: 1
1: 0
2: 0
3: 2
4: 93
Right 1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG 0: 1
1: 0
2: 2
3: 16
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133241331 Original CRISPR CTGCGCCGCCTCGGGGGTCC CGG Intronic
900109736 1:1000391-1000413 CCGCCCAGCCCCGGGGGTCCCGG - Intergenic
900156816 1:1206474-1206496 CAGCGCCCCACCGGGGGTCCCGG - Exonic
900168758 1:1255899-1255921 CTCCCCTGCCTCGGGGCTCCTGG + Intronic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900362068 1:2293911-2293933 CCGCGCCACCATGGGGGTCCAGG + Intronic
900503548 1:3018160-3018182 CAGCGTCGCCCCGGGTGTCCAGG + Intergenic
900972387 1:5998729-5998751 CTGCGCCCCCTCGCTGCTCCTGG - Intronic
902336853 1:15758953-15758975 GGGCGCCGCGCCGGGGGTCCCGG - Intronic
902552928 1:17229979-17230001 CTGTGCAGCCTCTGGGGTACAGG - Intronic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904769017 1:32870761-32870783 CTGCGCCGCCCCGGGCCTGCCGG - Exonic
904959714 1:34322957-34322979 GTGAGCCGCCTTGGGTGTCCAGG + Intergenic
904959776 1:34323257-34323279 CTGAGCCACCTTGGGTGTCCAGG + Intergenic
904959788 1:34323317-34323339 CTGAGCCGCCTTGGGTGTCCAGG + Intergenic
904959800 1:34323377-34323399 CTGAGCTGCCTTGGGTGTCCAGG + Intergenic
913205526 1:116534637-116534659 CAGCGCCGCCGCGGCGGGCCTGG - Intronic
915934742 1:160083922-160083944 CTAGGCGGCGTCGGGGGTCCTGG - Exonic
919640305 1:200039539-200039561 CTCCGCCTCCTCGGGGCTGCCGG - Intronic
1064059981 10:12129496-12129518 CAGCCCCGCCTCCCGGGTCCCGG + Intergenic
1065636679 10:27742267-27742289 CTGCGCTCCCTCACGGGTCCGGG + Intronic
1069756370 10:70776420-70776442 CTGCTCCGTCTCAGGGGACCTGG + Intronic
1070329131 10:75405490-75405512 CTGCCCCGCCTCGCGGTCCCTGG + Intergenic
1072741867 10:97914640-97914662 CTGCACTGCCTCCGCGGTCCAGG - Intronic
1073208855 10:101782675-101782697 CTGCCCAGCCTCAGAGGTCCCGG + Intronic
1074866417 10:117546667-117546689 CACCGCCGCCTCGGCTGTCCAGG - Intronic
1076880571 10:133237478-133237500 CTGCTCGCCCTCGGGTGTCCGGG + Exonic
1077453852 11:2666254-2666276 CTGCCCAGCCTCGGGGGTCCTGG - Intronic
1077505605 11:2928773-2928795 CTGCACCTCCTTGGGGGACCCGG - Intronic
1078884868 11:15490095-15490117 CTGCACCGACTAGGGGCTCCTGG + Intergenic
1080037295 11:27722643-27722665 CTGCCCCGCCGCCGGGGTGCCGG + Intergenic
1080802311 11:35619429-35619451 CTGCGCCCCCTCCGGGATGCCGG + Exonic
1081852325 11:46282260-46282282 CTGCACTGTCTCTGGGGTCCAGG + Intronic
1082174897 11:49048568-49048590 CTGCCCCGCTGCCGGGGTCCTGG - Intergenic
1082657715 11:55872994-55873016 CTGCCCCGCTGCCGGGGTCCTGG - Intergenic
1082821227 11:57545976-57545998 CTGCTCGGCCCCGGGGGCCCCGG + Exonic
1083721751 11:64606988-64607010 CTGCGCGGCCTCGTCAGTCCCGG - Exonic
1084190056 11:67494699-67494721 CTGCCCCGCCCCTGGGGTCCTGG - Intronic
1084284153 11:68120909-68120931 CTGCGCCGCGTCCGGGGCTCCGG + Exonic
1084888117 11:72223827-72223849 CCGCGCCGCCCCGGGGAGCCGGG - Intronic
1086690877 11:89787518-89787540 CTGCCCCGCTGCCGGGGTCCTGG + Intergenic
1086714923 11:90052137-90052159 CTGCCCCGCTGCCGGGGTCCTGG - Intergenic
1091399564 12:173886-173908 CTGCCCCGCCTTGGGGATCAAGG + Intronic
1094814050 12:34166659-34166681 CTGGGGCGCCTCCGGCGTCCTGG - Intergenic
1095099265 12:38163611-38163633 CTCGGCCGGCTCGGGGATCCCGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096981077 12:55728561-55728583 CCCCGCCGCCTCTGGGGCCCAGG + Intronic
1097664918 12:62467218-62467240 CTTCACCGCCTCGGGGCTGCTGG - Exonic
1103856449 12:123973524-123973546 CCGCGCAGCCTGGCGGGTCCCGG + Exonic
1107036641 13:35909210-35909232 CTGAGCCTCCTGGGGGCTCCTGG + Intronic
1113882929 13:113637931-113637953 CTGGGCCTCCCCCGGGGTCCAGG + Intronic
1113940431 13:114015963-114015985 CTGCGTCCCCTGGGGGGTCCCGG - Intronic
1114846104 14:26324015-26324037 GTGGGCCTTCTCGGGGGTCCAGG - Intergenic
1117722180 14:58638419-58638441 CTGCGCGGCGCCGGGGGTGCGGG + Exonic
1123024880 14:105419864-105419886 CTGCGCGGCCTCGGCGGCCTCGG + Exonic
1123710025 15:22980293-22980315 CCGCGGCGGCTTGGGGGTCCTGG + Exonic
1123964340 15:25439470-25439492 CTGCCCCGCCTCGGGGCTGGGGG - Intergenic
1126777548 15:52112604-52112626 TGGCGCCGGCTCGGGGGTGCCGG + Exonic
1128067707 15:64775139-64775161 CTGCCGCGCCTCGCGGGGCCGGG - Intronic
1128161046 15:65422977-65422999 GGGCGCGGCCTCGGGGGCCCGGG + Exonic
1131972250 15:97904323-97904345 AGGCGCCGCCTCGGGCTTCCTGG - Intergenic
1132537880 16:492365-492387 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132537893 16:492396-492418 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132537908 16:492427-492449 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132537937 16:492489-492511 CTGGGCGGCCTCGGGTCTCCCGG - Intronic
1132779293 16:1614160-1614182 CTGCGCCGCCTCGGCCGGCCGGG - Intronic
1132828709 16:1917438-1917460 GTGCGCAGACTCGGGGGTCTTGG + Intronic
1133054849 16:3140779-3140801 CTCAGCCTCCTCGGGGCTCCAGG - Exonic
1133103891 16:3494727-3494749 CTGCGCCACCTCCGGGGCCTGGG - Exonic
1133241331 16:4416181-4416203 CTGCGCCGCCTCGGGGGTCCCGG + Intronic
1134290529 16:12900786-12900808 CGGCGCCGCCTCTGCGCTCCCGG - Intergenic
1136110844 16:28063021-28063043 CCGCGCCGCCCCGGGGGAGCCGG + Intronic
1136453954 16:30370097-30370119 CGCCGCCGCCCCGGGGTTCCCGG - Exonic
1136483855 16:30558555-30558577 CTGCACCGCCTCGCCGGGCCGGG - Intergenic
1136483865 16:30558591-30558613 CTGCACCGCCTCGCCGGGCCGGG - Intergenic
1138077632 16:54058191-54058213 CTCCGCCGCCTCCAGGGTTCAGG + Intronic
1138195988 16:55052684-55052706 CTGCACAGCCTGGGAGGTCCTGG + Intergenic
1139528155 16:67528989-67529011 CGGCGCCGCCCGGTGGGTCCGGG + Intronic
1141572315 16:84941415-84941437 GTGCGCCGCCTGCGGTGTCCCGG + Intergenic
1141647175 16:85373778-85373800 CTGGGCTGCCTCGGGGATCCAGG - Intergenic
1143682941 17:8491166-8491188 GTGCACCCCCTCTGGGGTCCAGG + Intronic
1144500839 17:15786216-15786238 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1144781188 17:17809518-17809540 CTGCGCAGCCAAGGGGGCCCAGG - Intronic
1145163000 17:20588878-20588900 CGGCGGCGGCTCGGGGGTGCTGG - Intergenic
1146034059 17:29390718-29390740 CGTCGCCGCCTCGGGGGAACCGG - Exonic
1149526135 17:57357309-57357331 CTGGGTGGCCTTGGGGGTCCTGG - Intronic
1151724398 17:75876029-75876051 CTGAGCTCCCTCGGGGGTCCAGG + Exonic
1152732222 17:81977905-81977927 CTGCGCTTCCGCTGGGGTCCCGG + Intronic
1152788929 17:82267772-82267794 CTGCGCCTGCTTGGGGGTGCAGG - Intronic
1154991235 18:21600266-21600288 GCGCGCCACCTCGGGGCTCCCGG + Intronic
1157867118 18:51197006-51197028 CTCGGCCGCCTCCGGGGCCCCGG + Exonic
1160518196 18:79489891-79489913 CGGTGCCGCTTCGGGGGTCGGGG + Intronic
1161153217 19:2720409-2720431 CTCCACCGCCTGGGGGGTGCGGG + Intronic
1162205763 19:9054922-9054944 CTGGGGCGCCTCAGGGTTCCAGG - Intergenic
1162572413 19:11480876-11480898 CTGCGCGGCCCCGCGGGGCCCGG + Exonic
1162591953 19:11597719-11597741 CTGCGGCGACTCCGGGGTCTGGG + Intronic
1162932041 19:13962259-13962281 CTGCGCCGGCCCGGGGCTCAGGG + Exonic
1163622619 19:18369842-18369864 CTTCTCCGCCTGGGGGGCCCGGG - Exonic
1165266627 19:34667031-34667053 CTGTCCCTCCTCGGGGGTCGTGG - Intronic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
1165906419 19:39197149-39197171 CTGCGCCGGCTCGGGGAGCTCGG - Exonic
1166075272 19:40410480-40410502 CTGCATCTCCTAGGGGGTCCTGG + Intronic
1166100359 19:40567979-40568001 CTCCGCCGCCGCGGGGGTCGCGG - Exonic
1167437193 19:49486344-49486366 CAGCGCCGGCCCGGGGCTCCAGG - Intergenic
1167696628 19:51019085-51019107 CTCCGCCGCCTCTGGCGCCCGGG - Exonic
925022645 2:583869-583891 CGGCGCCTCCTCGGTGGTCCTGG + Intergenic
925180399 2:1813628-1813650 CTGCGCCTGCGAGGGGGTCCGGG + Intronic
927714307 2:25342158-25342180 CAGCGCCGACTGGGGGGCCCCGG + Intronic
927896518 2:26786224-26786246 CTGCGCCTCCTCGGGGCCTCGGG - Exonic
932456371 2:71852319-71852341 TTGGGCCTCCTCGGGGCTCCTGG + Intergenic
932892478 2:75609036-75609058 CTGCGCTGCCCTGGGGCTCCTGG + Intergenic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
937993354 2:127675781-127675803 CTGCGTGGACTCGGCGGTCCCGG - Intronic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
948248696 2:236507641-236507663 CTGCGCCACCGCGGGAGGCCTGG + Intergenic
948625035 2:239263488-239263510 CTGCCCTGCCTGGGGGTTCCTGG - Intronic
948806063 2:240453807-240453829 CGTCGCCGCCCTGGGGGTCCCGG - Intronic
1168750775 20:279487-279509 CTGCGCCGCCCGGGAGCTCCGGG + Intronic
1170756949 20:19213022-19213044 CTCCGGCGGCTCGGGGCTCCCGG + Intronic
1175400841 20:58699079-58699101 CTGTGCCGCGTCGGGGAGCCGGG - Intronic
1175923094 20:62459075-62459097 CCTCGCAGCCTCGGGGGTGCCGG + Intergenic
1178453605 21:32727569-32727591 CTGGGGCTCCTCGGGGGTCCCGG + Intronic
1178485877 21:33020016-33020038 CTGCGCAGCCCCGCGGGGCCGGG + Intergenic
1179052086 21:37896789-37896811 CTCCGCTGCCTCTGGGGCCCGGG - Intronic
1180195402 21:46190830-46190852 CTGTGCCTCCTCAGGGGTCACGG + Exonic
1180614811 22:17120359-17120381 CTGCGCCGCCCCGACGGCCCCGG + Exonic
1182350246 22:29695365-29695387 GAGCGCCGCCTCGGGGTGCCTGG - Exonic
1183751182 22:39721600-39721622 GTGCTCCGCCCCCGGGGTCCGGG - Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184673383 22:46027468-46027490 CTGCGCCGCCCGGCGTGTCCGGG - Intergenic
1185278624 22:49960659-49960681 CGCCGCCGCCTCGCGGGCCCCGG + Exonic
1185420193 22:50730761-50730783 CAGCGCAGCCCCGGGGGCCCGGG + Intergenic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
955060232 3:55487163-55487185 CTGCCCCAACTCGGGAGTCCAGG - Exonic
958714630 3:97764688-97764710 CCACGCCTCCCCGGGGGTCCTGG - Exonic
960586119 3:119322866-119322888 CGGCCCGGCCGCGGGGGTCCCGG + Intronic
968630760 4:1649793-1649815 CTGAGCCACCTCAGGGGTCCCGG - Intronic
968727955 4:2256900-2256922 CTGCCCCGGCTCCTGGGTCCTGG + Intronic
970333319 4:15004756-15004778 CCTCCCCGCGTCGGGGGTCCGGG - Intronic
983926053 4:173403472-173403494 CTGCGCCGCCCCGGGAATGCTGG + Intronic
986402840 5:7396196-7396218 CCGCGCCGCCTCGGCCGGCCCGG - Exonic
989071318 5:37514549-37514571 CTGGGGCCCCTCGGGGGTGCAGG - Intronic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
995650403 5:114362352-114362374 CTGCGCCTCCTCCGGTGCCCCGG + Exonic
995725970 5:115180364-115180386 CCCCGCCTCCTCGGGGGTCGCGG + Intronic
998406937 5:141879190-141879212 CTGCGCGGCCTCGCGGGGCAGGG - Intronic
1002108256 5:176891003-176891025 CTGCCCAGCCTCTGGGGTCTGGG - Intronic
1002482926 5:179515347-179515369 CTGCATCGCCACGGGGCTCCGGG + Intergenic
1002771148 6:292022-292044 CCGCGCAGCCTCGGGTGTCCCGG + Intronic
1002895583 6:1378382-1378404 CTGTGCCGCCTCGCGAGTCCTGG + Intergenic
1005328008 6:24720800-24720822 CTCGGGCGCCTCGCGGGTCCGGG + Exonic
1007347130 6:41239694-41239716 CTGCGCCCCCGCGGGAGCCCGGG - Intergenic
1007553400 6:42746742-42746764 CGGCGCGGCCTGGGGGCTCCTGG + Intergenic
1010568594 6:77449904-77449926 CTTGGCCGGCTCTGGGGTCCGGG - Intergenic
1011553880 6:88554822-88554844 CAGAGCCGCCTCGTGGGCCCTGG - Intergenic
1013737918 6:113248923-113248945 CTGCCCTGCCTCTGTGGTCCAGG + Intergenic
1017877495 6:158536711-158536733 CCGCGCAGCCTCCCGGGTCCCGG - Exonic
1018669560 6:166167708-166167730 CTGCGACGGCTCCCGGGTCCCGG + Exonic
1019151303 6:170007764-170007786 CTGCGCCGCCCCCGGGCTCACGG - Intergenic
1019165491 6:170095303-170095325 CAGCACCCTCTCGGGGGTCCAGG + Intergenic
1019248280 6:170724218-170724240 CAGTGCAGCCTCTGGGGTCCTGG + Intergenic
1019279591 7:193104-193126 CGGCGCCGCCTCGCGGGTCAAGG - Exonic
1019419813 7:945768-945790 CTGAGTCACCTCGGGCGTCCTGG - Intronic
1019545102 7:1570308-1570330 GCGCGGCGCTTCGGGGGTCCTGG - Intronic
1020037722 7:4974663-4974685 CTGGCCCGGCTCGGGGGTCCGGG + Intergenic
1020162098 7:5780964-5780986 CTGGCCCGGCTCGGGTGTCCGGG - Intronic
1025263385 7:57437703-57437725 CAGCGCCTCCTCGGAGCTCCTGG + Intergenic
1029537222 7:101163795-101163817 CAGCGCGGCCTCGGGGGTCGGGG - Exonic
1032525465 7:132576209-132576231 CTGCACCTCCGCGGGCGTCCAGG + Intronic
1033589320 7:142796943-142796965 CTGCGACGCCCCCGGCGTCCCGG - Intergenic
1035600185 8:892710-892732 CTGCCCCGCCTGGTGGTTCCCGG - Intergenic
1036454189 8:8893375-8893397 GCGCGGCGCCTCGGGGGGCCCGG + Exonic
1036766986 8:11555528-11555550 CTGCGCCGCATCCTGAGTCCAGG + Intronic
1037273746 8:17156547-17156569 CCGCGCCGGCTCGGGGCTGCGGG + Exonic
1038883580 8:31640003-31640025 CCGCGCCGCTCCGGGCGTCCCGG + Intronic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1049708234 8:144052442-144052464 CTGCGCCGCCTCCCAGGTGCGGG - Exonic
1053142686 9:35690983-35691005 CTGCGGGGCATAGGGGGTCCGGG + Exonic
1059769854 9:117414887-117414909 CGGCCCCGGCTCGGGGCTCCGGG - Exonic
1060355690 9:122905146-122905168 CCGCGCCGTCGCGGGGCTCCCGG - Intronic
1060358348 9:122931481-122931503 CTCCGGCCCCTCGGGGCTCCGGG + Exonic
1061559759 9:131394580-131394602 CGGCCCGGCCTCGGGGGTACGGG - Intronic
1062208290 9:135349161-135349183 GTGCCCCACCTCGGGGGTGCTGG + Intergenic
1062621325 9:137423681-137423703 CAGCGCGGCCTCGGGGTCCCCGG - Exonic
1192361792 X:70445265-70445287 CTGCGGCGCCTCGAGCCTCCGGG + Exonic