ID: 1133241415

View in Genome Browser
Species Human (GRCh38)
Location 16:4416411-4416433
Sequence CTGTCGCCTCGGGCCCCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133241415_1133241421 -4 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241421 16:4416430-4416452 ACAGCGCCCGGTCCTCGGGCCGG 0: 1
1: 0
2: 0
3: 5
4: 101
1133241415_1133241420 -8 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241420 16:4416426-4416448 GGCGACAGCGCCCGGTCCTCGGG 0: 1
1: 0
2: 1
3: 9
4: 132
1133241415_1133241419 -9 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241419 16:4416425-4416447 AGGCGACAGCGCCCGGTCCTCGG 0: 1
1: 0
2: 1
3: 5
4: 66
1133241415_1133241426 12 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241426 16:4416446-4416468 GGGCCGGACTCACCTCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 63
1133241415_1133241428 14 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1133241415_1133241430 17 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241430 16:4416451-4416473 GGACTCACCTCGCGGCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1133241415_1133241432 28 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241432 16:4416462-4416484 GCGGCGGGGCGGCCGAGCCTCGG 0: 1
1: 1
2: 1
3: 36
4: 301
1133241415_1133241427 13 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241427 16:4416447-4416469 GGCCGGACTCACCTCGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1133241415_1133241425 9 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241425 16:4416443-4416465 CTCGGGCCGGACTCACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133241415 Original CRISPR CTGTCGCCTCGGGCCCCGTC CGG (reversed) Intronic