ID: 1133241417

View in Genome Browser
Species Human (GRCh38)
Location 16:4416421-4416443
Sequence GGACCGGGCGCTGTCGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133241417_1133241428 4 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1133241417_1133241426 2 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241426 16:4416446-4416468 GGGCCGGACTCACCTCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 63
1133241417_1133241427 3 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241427 16:4416447-4416469 GGCCGGACTCACCTCGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 65
1133241417_1133241425 -1 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241425 16:4416443-4416465 CTCGGGCCGGACTCACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 54
1133241417_1133241430 7 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241430 16:4416451-4416473 GGACTCACCTCGCGGCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1133241417_1133241432 18 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241432 16:4416462-4416484 GCGGCGGGGCGGCCGAGCCTCGG 0: 1
1: 1
2: 1
3: 36
4: 301
1133241417_1133241433 26 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241433 16:4416470-4416492 GCGGCCGAGCCTCGGTGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133241417 Original CRISPR GGACCGGGCGCTGTCGCCTC GGG (reversed) Intronic