ID: 1133241418

View in Genome Browser
Species Human (GRCh38)
Location 16:4416422-4416444
Sequence AGGACCGGGCGCTGTCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133241418_1133241425 -2 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241425 16:4416443-4416465 CTCGGGCCGGACTCACCTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 54
1133241418_1133241430 6 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241430 16:4416451-4416473 GGACTCACCTCGCGGCGGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 89
1133241418_1133241426 1 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241426 16:4416446-4416468 GGGCCGGACTCACCTCGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 63
1133241418_1133241432 17 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241432 16:4416462-4416484 GCGGCGGGGCGGCCGAGCCTCGG 0: 1
1: 1
2: 1
3: 36
4: 301
1133241418_1133241433 25 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241433 16:4416470-4416492 GCGGCCGAGCCTCGGTGTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 98
1133241418_1133241428 3 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1133241418_1133241427 2 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241427 16:4416447-4416469 GGCCGGACTCACCTCGCGGCGGG 0: 1
1: 0
2: 0
3: 7
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133241418 Original CRISPR AGGACCGGGCGCTGTCGCCT CGG (reversed) Intronic