ID: 1133241428

View in Genome Browser
Species Human (GRCh38)
Location 16:4416448-4416470
Sequence GCCGGACTCACCTCGCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133241415_1133241428 14 Left 1133241415 16:4416411-4416433 CCGGACGGGGCCCGAGGCGACAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1133241418_1133241428 3 Left 1133241418 16:4416422-4416444 CCGAGGCGACAGCGCCCGGTCCT 0: 1
1: 0
2: 0
3: 5
4: 156
Right 1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1133241417_1133241428 4 Left 1133241417 16:4416421-4416443 CCCGAGGCGACAGCGCCCGGTCC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1133241428 16:4416448-4416470 GCCGGACTCACCTCGCGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133241428 Original CRISPR GCCGGACTCACCTCGCGGCG GGG Exonic