ID: 1133241428 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:4416448-4416470 |
Sequence | GCCGGACTCACCTCGCGGCG GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 54 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 50} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133241415_1133241428 | 14 | Left | 1133241415 | 16:4416411-4416433 | CCGGACGGGGCCCGAGGCGACAG | 0: 1 1: 0 2: 0 3: 3 4: 56 |
||
Right | 1133241428 | 16:4416448-4416470 | GCCGGACTCACCTCGCGGCGGGG | 0: 1 1: 0 2: 0 3: 3 4: 50 |
||||
1133241418_1133241428 | 3 | Left | 1133241418 | 16:4416422-4416444 | CCGAGGCGACAGCGCCCGGTCCT | 0: 1 1: 0 2: 0 3: 5 4: 156 |
||
Right | 1133241428 | 16:4416448-4416470 | GCCGGACTCACCTCGCGGCGGGG | 0: 1 1: 0 2: 0 3: 3 4: 50 |
||||
1133241417_1133241428 | 4 | Left | 1133241417 | 16:4416421-4416443 | CCCGAGGCGACAGCGCCCGGTCC | 0: 1 1: 0 2: 0 3: 2 4: 82 |
||
Right | 1133241428 | 16:4416448-4416470 | GCCGGACTCACCTCGCGGCGGGG | 0: 1 1: 0 2: 0 3: 3 4: 50 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133241428 | Original CRISPR | GCCGGACTCACCTCGCGGCG GGG | Exonic | ||