ID: 1133243879

View in Genome Browser
Species Human (GRCh38)
Location 16:4433605-4433627
Sequence TACCCAAGGCTGCAAGATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133243876_1133243879 15 Left 1133243876 16:4433567-4433589 CCAGGGAGCGCAGTCTTGAGAAC 0: 1
1: 0
2: 1
3: 3
4: 88
Right 1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133243879 Original CRISPR TACCCAAGGCTGCAAGATAG AGG Intronic
901220738 1:7582367-7582389 CACCCAAGGATGCAGGGTAGGGG - Intronic
903787242 1:25869613-25869635 TACCCAAGGTTGGAGGATGGGGG + Intronic
909518915 1:76544693-76544715 TATCCAAGGCAGGAAGATACAGG + Intronic
910834896 1:91499155-91499177 TACGGAAGGGTGCAAGAAAGAGG + Intergenic
912446241 1:109739329-109739351 TACAGAAGGATGCAAAATAGGGG - Intronic
913174635 1:116262725-116262747 TTCCCTGGGCTGCAAGACAGAGG - Intergenic
913321757 1:117593549-117593571 TCACCAAGGCTGGAAGACAGTGG - Intergenic
915137192 1:153740897-153740919 TGCCCAAGGCTCCAAGAGATAGG - Intronic
915159632 1:153908834-153908856 TCCCCAAGGCTGGAACACAGTGG + Intronic
915462375 1:156077668-156077690 TATCCCAGGCTGCAAGATTAAGG - Exonic
918954364 1:191186519-191186541 GACCCCAGGCTGGAACATAGTGG - Intergenic
919172717 1:193975752-193975774 TAACCAAGACAGCATGATAGTGG - Intergenic
919191842 1:194230685-194230707 CCCCCAAGCCTGCAAGGTAGGGG + Intergenic
920674573 1:208030205-208030227 TACCCAAGGCTGCCAGAAGAAGG - Intronic
923964297 1:239119536-239119558 TACCCAAGGTTGGTAGAGAGTGG + Intergenic
924515466 1:244761865-244761887 TCACCCAGGCTGGAAGATAGCGG + Intergenic
1064390248 10:14935946-14935968 TCCCCCAGGCTGCAAGGCAGTGG + Intronic
1065546904 10:26830934-26830956 TACCCAAGGCTGGAATGCAGTGG + Intronic
1068944553 10:62716491-62716513 TACCAGGGGCTGCAGGATAGAGG + Intergenic
1071076812 10:81764571-81764593 TACCCAAAGCAGCATGATACTGG - Intergenic
1075185885 10:120256672-120256694 TAGCCCAGGCTGGAAGACAGTGG - Intergenic
1076647912 10:131966145-131966167 TGCACATGGCTGCAAGAGAGAGG - Intergenic
1077373576 11:2194968-2194990 CACCCCAGGCAGCAAGAGAGAGG - Intergenic
1079949949 11:26789488-26789510 TACCCAAGGTTACAATATAAAGG - Intergenic
1082960535 11:58914950-58914972 GCCCCAAGGCTTCAAGACAGAGG + Intronic
1082988835 11:59189986-59190008 TTCACAAGCCTGCAAGATTGGGG - Intronic
1084953494 11:72679343-72679365 TACCCATGGCTGCTAGGCAGGGG + Intergenic
1086374628 11:86187772-86187794 TAACAAAGGCTGGAAGATACTGG - Intergenic
1087409560 11:97774787-97774809 TGCCAAAAGCTGCAAGATGGAGG + Intergenic
1088443605 11:109899940-109899962 TACCAGAGGCTGCAAGGTAGGGG + Intergenic
1091627113 12:2129851-2129873 TTCCCAAGCCTGCAGGAGAGAGG - Intronic
1091667929 12:2432531-2432553 TCCCCAAGGTAGCAAGAGAGTGG - Intronic
1092798466 12:12138485-12138507 TCCCACAGGCTGCAAGATATTGG + Exonic
1098001123 12:65944487-65944509 TACCAAAGACTGCCAGATTGTGG - Intronic
1098921579 12:76306905-76306927 TACCCAAGGCTGGAAGACATAGG + Intergenic
1099904997 12:88761203-88761225 TTCACAAGGCAGCAAGAGAGAGG + Intergenic
1101926137 12:108972849-108972871 TACCAAGGGCTGCAAGGTAGAGG + Intronic
1104153311 12:126106143-126106165 AAGCCAAGGCTGCAGGATGGAGG + Intergenic
1104362371 12:128146022-128146044 TACCCATGTCTGCATGATGGTGG + Intergenic
1106556406 13:30812370-30812392 TCCCCAAGGCTGGAATACAGGGG + Intergenic
1108882142 13:55133274-55133296 TACCCAAAGCAGCATGATAGTGG - Intergenic
1111675386 13:91380871-91380893 TACCAGGGGCTGAAAGATAGAGG - Intergenic
1113816523 13:113175528-113175550 TACCCAACACTGCAAGAGAACGG + Intergenic
1114547805 14:23515032-23515054 CACCCAAGGCTCCAGGCTAGTGG + Intergenic
1115867591 14:37765200-37765222 TGCCCCAGGCTGGAATATAGTGG + Intronic
1116151540 14:41147753-41147775 TACCCAAGGCTGAAATATTCAGG + Intergenic
1117301269 14:54430869-54430891 TAACCCAGGCTGCAATATAGTGG + Intronic
1117368731 14:55056160-55056182 AATCCAAGTCTGGAAGATAGGGG - Intronic
1120512387 14:85431058-85431080 TTCACAAGGCTGCAGGAGAGAGG + Intergenic
1123462717 15:20488404-20488426 TAGCCCAGGCTGGAATATAGCGG + Intergenic
1123630073 15:22255052-22255074 TACCAGAGGCTGCAAGAGACAGG - Intergenic
1124273405 15:28304405-28304427 TAGCCCAGGCTGGAATATAGCGG + Intronic
1124309253 15:28607216-28607238 TAGCCCAGGCTGGAATATAGCGG - Intergenic
1129786323 15:78312609-78312631 TTCCCAGGGCAGGAAGATAGAGG - Intergenic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1133880936 16:9781292-9781314 TGCCTAATGCTGCTAGATAGTGG + Intronic
1134156534 16:11848562-11848584 TACCCAAGGCTGCAGTGCAGTGG + Intronic
1136469277 16:30468168-30468190 TAACCCAGGCTGCAGGACAGTGG + Intergenic
1137942354 16:52700804-52700826 GACCAAAGGCTGCAAAATGGTGG - Intergenic
1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG + Intergenic
1145819380 17:27819804-27819826 TTGCCAAGGCTGCAATACAGTGG - Intronic
1148700543 17:49584185-49584207 TATTCCAGGCTGCAGGATAGAGG - Intergenic
1149441823 17:56680549-56680571 AACCAAAGGGTGCAAGATATAGG - Intergenic
1151875553 17:76866232-76866254 TACCCAAGACTGCATGATGTGGG + Intergenic
1155015915 18:21839381-21839403 TAACCAAGGCAACATGATAGTGG - Intronic
1155238672 18:23845765-23845787 TTCCCAAGGCTGCAAGGTTATGG - Intronic
1157103837 18:44754872-44754894 TACCCAAAGCCCCAACATAGTGG + Intronic
1159985413 18:74835480-74835502 TGCCCATGGTGGCAAGATAGGGG + Intronic
1162548532 19:11345613-11345635 TTCCCAGGACTGCAAGATGGAGG - Exonic
1163209132 19:15827843-15827865 TATCCAAGGAGGCAAGAAAGAGG - Intergenic
1164802487 19:31089185-31089207 CATCCAAGGCTGAAAGAGAGTGG + Intergenic
1165507081 19:36240379-36240401 TCACCCAGGCTGCAATATAGTGG - Intronic
1167243936 19:48362771-48362793 TACCCAAGGCCACAACATAGTGG - Intronic
1167262151 19:48464814-48464836 TCCCCAAGGTAGCAAGATGGAGG + Exonic
925746327 2:7046715-7046737 TACCCAGGGGTGCAAGGAAGTGG + Intronic
926030025 2:9578307-9578329 TGCTCAATGCTGCAATATAGTGG - Intergenic
928639405 2:33282280-33282302 TACCCAAAGCAGAAAGATAAAGG - Intronic
929280635 2:40074181-40074203 TAACCAAAGCTGCATGATACTGG - Intergenic
930839595 2:55830824-55830846 TAACCAAAGCTGCATGATACTGG + Intergenic
932446358 2:71784088-71784110 GACCCAAGGCAGCAGGACAGGGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933509658 2:83223912-83223934 TCACCCAGGCTGAAAGATAGTGG - Intergenic
935083429 2:99821940-99821962 TCCCCAAGGCTGTGAGAAAGAGG + Intronic
935886527 2:107625400-107625422 TACCTAAGGCTGCAAAACCGTGG - Intergenic
937017560 2:118619590-118619612 CACCCAAGCCTGCAGGAAAGTGG - Intergenic
938006501 2:127791196-127791218 TCACCCAGGCTGCAAGACAGTGG + Intronic
944903454 2:204239260-204239282 TGCCCAAGGCTGCACAATAATGG + Intergenic
947105547 2:226664354-226664376 AACCCAAGGCAGGAAGAGAGAGG - Intergenic
947163186 2:227235037-227235059 CACCCAAGGGTACAAGATACTGG - Intronic
948657942 2:239488239-239488261 CATCCAGGGCTGCAAGACAGAGG - Intergenic
1168831647 20:848357-848379 TCCCCAAGGCTGCAGGGTTGGGG - Intronic
1173143977 20:40509384-40509406 TACACAATCCTGCAAGACAGGGG - Intergenic
1173561596 20:44009865-44009887 TACCAAAGGCGGCAACACAGTGG - Intronic
1182911014 22:33984678-33984700 CACCAAAGGCTGCAATCTAGGGG - Intergenic
1184227703 22:43139076-43139098 CACTCAAGGCTGGAAGACAGAGG + Intronic
1184301474 22:43563233-43563255 TACCCAAGGTAACAAGATAGGGG - Intronic
950095352 3:10326182-10326204 TACCCCATGCTGCTAGATATAGG + Exonic
950150979 3:10687174-10687196 TACCCAAGGCAGCAAGTAAAAGG - Intronic
951175879 3:19599392-19599414 GTTCCAAGGCTGCAAGATACGGG - Intergenic
952778554 3:37070688-37070710 TCCCCAAGGCTGGAGTATAGTGG - Intronic
953752800 3:45622205-45622227 TACCCAGGGCTGGAGGACAGCGG - Intronic
953847034 3:46435877-46435899 TACCCAAGACTGCAAGAAAGAGG + Exonic
957195387 3:77060973-77060995 TCACCAAGGCTGGAAGACAGTGG + Intronic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
965300406 3:166999824-166999846 TACCAAGGCCTGGAAGATAGTGG + Intergenic
967068550 3:185942081-185942103 TTCCCAAGGCAGCAAGAATGAGG + Intergenic
967084168 3:186079037-186079059 TACCAAAGGATGCAAGATGGTGG - Intronic
970171624 4:13296419-13296441 TTGCCCAGGCTGCAGGATAGTGG + Intergenic
970605147 4:17672921-17672943 GACACTATGCTGCAAGATAGAGG - Intronic
975739349 4:77413895-77413917 AACCCAGGGCTGCAAGAGTGAGG + Intronic
976822497 4:89222256-89222278 TAGGCAGGGCTGCAAGCTAGAGG + Intergenic
977110524 4:92947143-92947165 TACCCAAGACTGTGAGATATTGG - Intronic
977470181 4:97433612-97433634 TACCATGGGCTGCAAGAGAGAGG + Intronic
977577870 4:98693943-98693965 TACCCTAGGCTGAAAGGTGGAGG - Intergenic
978739355 4:112119709-112119731 AACCCATGGCTGCTAAATAGTGG - Intergenic
994214297 5:97120192-97120214 CACCTAAATCTGCAAGATAGTGG - Intronic
995709517 5:115020931-115020953 TTCCCCAGGCTGCAGGGTAGTGG - Intergenic
999290286 5:150420874-150420896 TACCCAAGGCTGGAATACAGTGG + Intergenic
999890454 5:155973590-155973612 TACCTAAGTCTGCAAGTTAGTGG + Intronic
1000155640 5:158548873-158548895 TACCCAAAACAGCAAGGTAGTGG - Intergenic
1000944318 5:167401702-167401724 TACCTAAAGCTGGAAAATAGGGG - Intronic
1004158806 6:13195157-13195179 TCCCCTTGGCTGCAAGAAAGAGG - Intronic
1005078914 6:21937015-21937037 TCACCAAGGCTGCAATACAGTGG - Intergenic
1007254671 6:40520485-40520507 GACCCAAGTCTGCAAGGGAGGGG - Intronic
1012873986 6:104704065-104704087 TCACCCAGGCTGGAAGATAGTGG - Intergenic
1016169092 6:140986592-140986614 TACCCAGGTGTGCAAGATAGTGG - Intergenic
1016212951 6:141562394-141562416 TACCCAATGCTGCCTGTTAGAGG - Intergenic
1016434197 6:144018992-144019014 TACCCCAGGCTGGAGTATAGTGG - Intronic
1021915109 7:25423638-25423660 TGTGCAAGGCTGTAAGATAGAGG - Intergenic
1026393432 7:69927076-69927098 TCCACAAGGCCGCAAGAAAGAGG + Intronic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1038970883 8:32633757-32633779 TACCCAAGACTGAGAGAAAGAGG - Intronic
1041066534 8:54087458-54087480 TAGCCCAGGCTGGAATATAGTGG - Intronic
1041224993 8:55689354-55689376 TGCCCAAGGCTGGAAGAAATCGG - Intergenic
1044344805 8:91092570-91092592 TCCCCCAGGCTGCAGTATAGCGG - Intergenic
1044391970 8:91662245-91662267 TGCCCAAGGTTGCACCATAGTGG - Intergenic
1048167867 8:132079715-132079737 TACCCAAGGCTGGGAGAGTGTGG + Exonic
1048177794 8:132168815-132168837 AACCCAATGCTACTAGATAGGGG - Intronic
1049084148 8:140464719-140464741 TACACAAGGCTGAAAAAAAGAGG + Intergenic
1049966971 9:788690-788712 TAACTAGGGCTGCAAGATGGAGG + Intergenic
1051025528 9:12606121-12606143 CATTCAAGGCAGCAAGATAGTGG - Intergenic
1055395213 9:75866928-75866950 TACCCAAGGATGATAGATGGTGG - Intergenic
1059787832 9:117605782-117605804 AAACCAGGGCTGCAACATAGTGG + Intergenic
1060984427 9:127811523-127811545 TCCCCCAGGCTGGAATATAGTGG + Intronic
1062097723 9:134711570-134711592 AACCCAAGGCTCCGAGATGGAGG + Intronic
1062262063 9:135667730-135667752 GAGCCAAGGCTGCCAGAAAGGGG + Intergenic
1062285878 9:135772269-135772291 CACCCCAGGCTGCCAGATGGGGG - Intronic
1185552904 X:998230-998252 TACTCAAGGCTCAGAGATAGGGG + Intergenic
1186637191 X:11419147-11419169 CAGCCAAGGCTGCAAGTCAGTGG + Intronic
1193020025 X:76781523-76781545 TACACAAGGCTGCAAAAAAGAGG - Intergenic
1193862805 X:86691856-86691878 TACCCAAGCCTTCAAAATAGTGG + Intronic
1194934865 X:99937022-99937044 TACACAGGGCTGCAAGAGGGAGG + Intergenic
1198204598 X:134453856-134453878 TGCCAAAGCCTGCAAGATACAGG + Intergenic
1198623566 X:138542096-138542118 TACTCAAGGATGCAACATGGAGG - Intergenic
1199552697 X:149076070-149076092 TAGCCAAGTCTACAACATAGTGG - Intergenic