ID: 1133244370

View in Genome Browser
Species Human (GRCh38)
Location 16:4438007-4438029
Sequence TTGGAATCTCAATGAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133244370 Original CRISPR TTGGAATCTCAATGAAGAAC AGG Intronic
901882578 1:12202878-12202900 TTGGAAGATGAATGAAGAAATGG + Intronic
905971866 1:42147718-42147740 TTTGAAGCCCAATGAAGAAAGGG - Intergenic
906351075 1:45060179-45060201 TTGGCATTTGGATGAAGAACAGG - Exonic
908723407 1:67149487-67149509 TTGTAATCTTTCTGAAGAACAGG + Intronic
909417832 1:75427371-75427393 TTGGAATTTCAATGCATGACTGG - Intronic
910109288 1:83665228-83665250 TTGGAATGTCAAAAAAGAAGTGG + Intergenic
911626609 1:100132097-100132119 TTGTAAACTCCATGAAGAAAAGG + Intronic
911748588 1:101469117-101469139 TGGTAATCTCAATGTAGAAGCGG + Intergenic
912180816 1:107217024-107217046 TTGGACTTTCAAAGAAAAACTGG - Intronic
915561221 1:156689440-156689462 TTGGAATCACAAGGAGGAAGAGG + Intergenic
915622649 1:157095360-157095382 CTGGAATCTCAATCTAGAAGTGG + Intronic
915669978 1:157480097-157480119 TTGGAAAGTCACTGAAGAAATGG + Intergenic
915904575 1:159868440-159868462 TTAGAATCTCAAAGCAGAAAGGG - Intronic
918652735 1:186985810-186985832 TTGGAATCCCAATGAATTTCAGG + Intronic
919513049 1:198490411-198490433 TTGAAATCTAAAAGAGGAACTGG - Intergenic
922087864 1:222368417-222368439 TTGAAAGCTAGATGAAGAACTGG + Intergenic
923142967 1:231176808-231176830 TTTAAATTTCAGTGAAGAACAGG + Intronic
924786102 1:247201645-247201667 TTGGGATGTCAGTGAAGAAGGGG - Intergenic
1063027530 10:2195967-2195989 GTAGAATCTCAATGGAGAATTGG + Intergenic
1066495161 10:35935412-35935434 TAGGAAACTCAATGAAAAGCTGG + Intergenic
1068135843 10:52950964-52950986 TTGGACTGACAAAGAAGAACAGG - Intergenic
1069835316 10:71304384-71304406 TTGGAATCTCAACTAAAACCAGG + Intergenic
1072204357 10:93189212-93189234 TTGAAATCTCATTGAAAAATGGG - Intergenic
1072625126 10:97106310-97106332 TTGGGACATGAATGAAGAACGGG + Intronic
1073152537 10:101321723-101321745 TTGGAAGGTCACTGAAGAGCGGG + Intergenic
1073606212 10:104898348-104898370 TTGGAAAATGAATGAAGAATAGG + Intronic
1075414613 10:122253168-122253190 TGGGAATCTCAAGGAAAAGCTGG + Intronic
1078000928 11:7494968-7494990 TTTGAAAGTCAATGAAGAAATGG - Intronic
1078182349 11:9022655-9022677 CTGGAAGCTCAGTGAAGAACTGG - Intronic
1085774527 11:79353217-79353239 ATGGAATGTCAATGACGATCTGG - Intronic
1086398090 11:86437091-86437113 GTGGAATCTCACTGGAGACCTGG - Intergenic
1090341952 11:126031603-126031625 GTGGAATCTCACAGAAGATCAGG - Intronic
1090394436 11:126409339-126409361 CTGCAATCTCCATGAAGAAGGGG - Exonic
1090670772 11:128943646-128943668 TGGGAATCTCAGTGGGGAACCGG - Intergenic
1094596257 12:31869523-31869545 TTGGCATCTGAATGGAAAACAGG - Intergenic
1098403165 12:70095231-70095253 TTCGATTCTCTCTGAAGAACTGG + Intergenic
1100685121 12:96979118-96979140 TTGGAATCTCAGATAAGGACGGG + Intergenic
1102750712 12:115291365-115291387 TTGGAATCTGAAGGAAGAGTAGG + Intergenic
1105318833 13:19297285-19297307 TTGGAGTCTCACTAAAGAAGTGG - Intergenic
1105942418 13:25160548-25160570 TAGGAATTTTAATTAAGAACTGG - Intergenic
1106510427 13:30408316-30408338 TTGGAAGCTGAATGAAGAACCGG + Intergenic
1107002630 13:35567579-35567601 TTTGAAATTCAGTGAAGAACTGG + Intronic
1109740095 13:66542323-66542345 TTGGAATCTGATTGCATAACTGG - Intronic
1112998453 13:105602667-105602689 TTGTAATCTCAATGTATATCTGG + Intergenic
1113549467 13:111181371-111181393 TTGGAATCTTAGTTTAGAACTGG + Intronic
1113634947 13:111913071-111913093 TTGGAATCCTCGTGAAGAACGGG + Intergenic
1114401901 14:22417881-22417903 TGAGAATCTCCAGGAAGAACTGG - Intergenic
1116557026 14:46324020-46324042 TTGGAATGTAAATGAATGACTGG - Intergenic
1118073086 14:62267682-62267704 TTGGAATCACAAAGATGAAAAGG - Intergenic
1124018664 15:25900661-25900683 ATGGAAACTCACAGAAGAACTGG + Intergenic
1125372738 15:38995786-38995808 TTGGAAACACAATGAGGAAAGGG - Intergenic
1125439674 15:39688701-39688723 TTGGACACTCAATGTGGAACAGG - Intronic
1126427214 15:48541569-48541591 TGGCAATCTAAATGAAGTACAGG - Intronic
1130913465 15:88286961-88286983 TTGAACTCTCATTGAAGAAATGG + Intergenic
1131675286 15:94664992-94665014 GAGTAATCTCAATGAAGAAATGG + Intergenic
1131797011 15:96029371-96029393 TTTGCATCTCATAGAAGAACTGG - Intergenic
1133244370 16:4438007-4438029 TTGGAATCTCAATGAAGAACAGG + Intronic
1134763564 16:16735610-16735632 TTTGAATCTCAAATAAGAAAAGG - Intergenic
1135400425 16:22162853-22162875 TTGGAAGTTCAGTGAAGTACAGG - Intergenic
1135572444 16:23559062-23559084 TTGTAATCTCCATTAAGAACAGG + Intronic
1139069494 16:63362896-63362918 ATAGATTCTCAGTGAAGAACAGG - Intergenic
1140852174 16:78945256-78945278 ATGGAAACTGAAAGAAGAACTGG - Intronic
1141891500 16:86929526-86929548 TTGGAATCTGAATGCAGTCCAGG - Intergenic
1146438616 17:32874520-32874542 GTGACATCTCAATGAAGACCTGG - Intronic
1149130297 17:53292360-53292382 TTGGAATCTGTACGAAGAAGTGG - Intergenic
1149590933 17:57829471-57829493 TTTAAATGTCAATAAAGAACCGG + Intergenic
1150954777 17:69845357-69845379 TTTGAATCTGAATGAACAAAAGG + Intergenic
1151043117 17:70887285-70887307 ATGAAATTTCAATGAATAACTGG + Intergenic
1154077685 18:11220400-11220422 TTGGCATCTAGGTGAAGAACTGG + Intergenic
1154284439 18:13039142-13039164 TTGGCATCTCAGTGATGAAAAGG + Intronic
1156358855 18:36366152-36366174 TGGGAACTTTAATGAAGAACAGG + Intronic
1157697715 18:49736432-49736454 TTTGAATCTCAAATGAGAACAGG - Intergenic
1158669735 18:59464018-59464040 CAGGAATCTCACTGAAAAACAGG - Intronic
1158758459 18:60355249-60355271 TTAGAATCTCATTGAATAAAAGG + Intergenic
1158967762 18:62637473-62637495 TTGGAATCCCATTGAAGCAAAGG + Intergenic
1159540962 18:69775282-69775304 TTGAACTCACAAAGAAGAACTGG + Intronic
1164063158 19:21692765-21692787 TTGGACTGACAAAGAAGAACAGG - Intergenic
1164087662 19:21918551-21918573 TTAGAATCTCAATCACGGACTGG - Intergenic
1164816246 19:31205643-31205665 TTGGAATGGCAGTGAAGGACTGG - Intergenic
1167976269 19:53228830-53228852 CTGTAATTTTAATGAAGAACGGG + Intergenic
926651415 2:15350651-15350673 TAAGAATCTCAATGAGGAAAAGG + Intronic
927066835 2:19480255-19480277 TTGGAATATCTAAGAAGAAAGGG + Intergenic
929393500 2:41497133-41497155 TGGGAAACTCAAGGAAGAATAGG + Intergenic
929433213 2:41906398-41906420 TCGGAAACTCAATGGAGAGCCGG + Intergenic
931320845 2:61173585-61173607 GTGGAATATGAAAGAAGAACTGG - Intergenic
932933042 2:76065098-76065120 TTGAAATGTCAAAGAAGATCTGG - Intergenic
934563013 2:95322985-95323007 TGGGATTCTCAAGGAAGAATGGG + Intronic
935426597 2:102925318-102925340 TTGGAATCTTAAAGATGAAGAGG - Intergenic
935712321 2:105909966-105909988 TTAGAAACTTAAGGAAGAACCGG - Intergenic
936963296 2:118099781-118099803 TTGGAAACTGGATGTAGAACGGG - Intronic
939987757 2:148848646-148848668 TTGAAATATCAATAAAGAAATGG - Intergenic
944183038 2:196916498-196916520 TGTGAACTTCAATGAAGAACTGG - Exonic
945281939 2:208043828-208043850 TTGGAAACTGAATGTATAACTGG - Intergenic
948769568 2:240243713-240243735 GTGAAATCTCAATGAATAAATGG - Intergenic
1169319246 20:4617701-4617723 GTGGAATCTCAACAGAGAACAGG - Intergenic
1172652495 20:36513788-36513810 TTGGAGTCTGAGTGAAGAAGAGG + Intronic
1174994536 20:55551091-55551113 TGGGGATGTGAATGAAGAACAGG + Intergenic
1176150587 20:63588871-63588893 TTGGACTCACAAGGAAGACCAGG - Exonic
1177486795 21:21768683-21768705 TTGAAATCTCAAAGAAGCAGAGG - Intergenic
1177863289 21:26480669-26480691 CTGGAATCTGAATGATGAATTGG - Intronic
1178200625 21:30399663-30399685 TTGGAATCTCACTGAGGAACAGG + Intronic
949788351 3:7766130-7766152 TAGGAAACTCAATCATGAACAGG - Intergenic
949869154 3:8572446-8572468 GTGGAATTTTGATGAAGAACAGG - Intergenic
950515335 3:13461261-13461283 GTGGAATCTCAAAGGAGAATGGG + Intergenic
951531723 3:23704506-23704528 ATGGAATCTCAATTGGGAACAGG + Intergenic
951829845 3:26914469-26914491 TTAGAATTTTAATGAAGATCAGG + Intergenic
952381639 3:32809894-32809916 TCAGAATCTCCATGAAGGACAGG - Intergenic
952609608 3:35192294-35192316 TTGGAGTTTCAATGAGGAAGAGG + Intergenic
953000284 3:38926154-38926176 TTGGAATCTGAATGATGAAATGG - Intronic
953752001 3:45616185-45616207 TTGGAATCAGAATTGAGAACTGG + Intronic
954929257 3:54266717-54266739 TTGGAATCTAAAGTAAGAAAGGG - Intronic
955599423 3:60629163-60629185 ATGGTATCTCACTGAGGAACAGG - Intronic
956643993 3:71438819-71438841 TGAGAATGTCAATGCAGAACCGG + Intronic
956966399 3:74466049-74466071 ATAGAAACTCAATGCAGAACTGG - Intronic
957157955 3:76569815-76569837 TTGGAATCTCAATGCTGTTCTGG - Intronic
959693675 3:109226525-109226547 TTGAGATCTCAAGGAGGAACAGG + Intergenic
960708917 3:120507642-120507664 CTGGAACCTCAAGGATGAACAGG + Intergenic
961878511 3:130042957-130042979 CTGGAATCTTAATGATGAGCTGG + Intergenic
963014290 3:140806420-140806442 TTGGCATCTCAATGAAGAATTGG - Intergenic
963367551 3:144356692-144356714 GAGGAATTTCAATGAAGAAAAGG - Intergenic
963502969 3:146151735-146151757 TTAGAATTTCAATACAGAACAGG + Intronic
965197915 3:165623578-165623600 ATGGAATCCCAATGACGAAATGG - Intergenic
965911404 3:173781963-173781985 TTGAGATCCCACTGAAGAACAGG + Intronic
967538320 3:190633690-190633712 TTGCATTTTCAATGAACAACTGG - Intronic
970377078 4:15469652-15469674 TTGCATTTCCAATGAAGAACAGG - Intergenic
972425080 4:38925296-38925318 TCAGAAACTTAATGAAGAACTGG + Intronic
972814117 4:42624921-42624943 TTAGAAACACAATGAATAACTGG + Intronic
974154401 4:58052272-58052294 GTGGAACCTCAATACAGAACTGG - Intergenic
974519240 4:62959687-62959709 TTGGATGATCAATGAAGAATTGG - Intergenic
977057847 4:92215891-92215913 TTGAAATCTCAACTAAAAACTGG - Intergenic
977265220 4:94845766-94845788 TTAGAATTTCAATTAAAAACTGG - Intronic
982532407 4:156562008-156562030 TTATAATCTCTATGAAGAATTGG - Intergenic
982634803 4:157880972-157880994 TTGGCATCTCTACCAAGAACAGG + Intergenic
984333138 4:178353059-178353081 TTGGAATCTAAATGACTAAGTGG + Intergenic
985109168 4:186530994-186531016 TTGATATCACAGTGAAGAACCGG + Intronic
986840690 5:11693597-11693619 ATGGAATCTCAATGAGGACAGGG + Intronic
991594431 5:68288436-68288458 TTGGCTTCTCAATGAGGAGCCGG + Intronic
992425409 5:76651801-76651823 ATGGAATCAAAATGACGAACTGG - Intronic
993014081 5:82516130-82516152 CTGGAAAATCAATGTAGAACAGG - Intergenic
993448763 5:88047465-88047487 TTACAATCTCACTGAAGAAGGGG + Intergenic
993806764 5:92419935-92419957 TTGGGATGTCCTTGAAGAACAGG - Intergenic
994119435 5:96097287-96097309 TTGAAATCCCAATTAAGAACTGG - Intergenic
994829476 5:104760440-104760462 TTGGAAACTCAAAGAAAAAAAGG + Intergenic
995364965 5:111348243-111348265 ATGGAATCTCATTGAAGCTCAGG - Intronic
995560002 5:113370330-113370352 TTGGGATGTCAAAGAAGAACAGG - Intronic
996150898 5:120033536-120033558 GTGGAAGCTCAGTGAAGAATGGG - Intergenic
999435609 5:151561162-151561184 CTGGAATCTGAAAGAAGAGCGGG + Intronic
999937181 5:156500169-156500191 TTGGAATCTCATGTAGGAACAGG + Intronic
1000466580 5:161586082-161586104 TTGGAGTTTATATGAAGAACTGG - Intronic
1002665201 5:180818193-180818215 TTGGCATTTCAGTGAGGAACTGG + Intergenic
1006526423 6:34609548-34609570 TTGGAAGCTGTATTAAGAACTGG + Intronic
1007286119 6:40748632-40748654 TTGAAATCTGAAGAAAGAACAGG - Intergenic
1008046055 6:46852385-46852407 TTTGAACCTCAATAAAGAAATGG + Intergenic
1009458290 6:63882580-63882602 TTGCAAACTCAATGCAAAACGGG - Intronic
1009725317 6:67530544-67530566 ATGGAATCTCAATGACGAGTTGG - Intergenic
1010165310 6:72907607-72907629 TAGGAATGTCAAGGAAGAAAAGG - Intronic
1010809326 6:80280998-80281020 GGGGAATATCATTGAAGAACAGG + Intronic
1010927400 6:81759826-81759848 TTGGAATTTCAATGGAAATCAGG - Intergenic
1011492729 6:87909173-87909195 TGGGAATCTGAACCAAGAACAGG - Intergenic
1012693659 6:102351146-102351168 GAGAAATCTCAATGAAGAATTGG - Intergenic
1016504526 6:144763962-144763984 TTTGAATCTCTTTCAAGAACTGG + Intronic
1018949244 6:168368414-168368436 TTTGAATTTCAAAGAAGAACTGG + Intergenic
1020861679 7:13501031-13501053 TTGGAATCAGGATGAAGAAAAGG + Intergenic
1021836241 7:24678537-24678559 TTGGTATCACAACTAAGAACAGG + Intronic
1023201022 7:37696701-37696723 TTGTAATCTCCTTGTAGAACAGG + Intronic
1023339874 7:39208891-39208913 ATGAAATCTTAATGAAGAAATGG + Intronic
1024298391 7:47864517-47864539 TTGGAATCCCAAAGTAGAAATGG - Intronic
1025598171 7:62958501-62958523 TTGGAAACTCATTGAGGAAAAGG + Intergenic
1027389180 7:77688587-77688609 TTGCAATCTCAATGAATTAAGGG + Intergenic
1031476481 7:122228737-122228759 CTGGAATACCAATTAAGAACTGG - Intergenic
1032721406 7:134553280-134553302 TTGGACTGACAAAGAAGAACAGG + Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037160485 8:15765502-15765524 TGTGAATTTCAATGAAGAATGGG + Intronic
1039624939 8:39039602-39039624 TTGGAATCTAAAAAAAGAAGTGG - Intronic
1040108710 8:43555902-43555924 TTGGACTGACACTGAAGAACAGG - Intergenic
1041814460 8:61952912-61952934 TGGGAATCTGAATGAATAAGTGG - Intergenic
1042133621 8:65613629-65613651 TTTGAATCTCAATGAGCCACGGG - Intronic
1043656897 8:82678924-82678946 TTTGAATCTCAATGATCATCAGG + Intergenic
1044067100 8:87712321-87712343 TTGGAATCTCTATAATGTACTGG - Intergenic
1046242791 8:111519344-111519366 TTGTATTCACTATGAAGAACAGG - Intergenic
1050868704 9:10538696-10538718 TTGGAATCTAAAAGATAAACAGG - Intronic
1053651333 9:40172921-40172943 TTTGAACCTCAATAAAGAAATGG - Intergenic
1053901726 9:42802274-42802296 TTTGAACCTCAATAAAGAAATGG - Intergenic
1054451758 9:65407044-65407066 TTGGATTCTCCAGGAAGCACTGG + Intergenic
1054533247 9:66203282-66203304 TTTGAACCTCAATAAAGAAATGG + Intergenic
1055665691 9:78550628-78550650 TTAGAAACTTAATGAAGAATAGG + Intergenic
1190311852 X:49122516-49122538 TTGGATTCTAAAGGAAGAATAGG + Exonic
1190570950 X:51780744-51780766 ATGGAATCTCCATGAGGACCAGG - Intergenic
1192099903 X:68253411-68253433 ATGGAATATCTCTGAAGAACTGG + Intronic
1194046968 X:89019757-89019779 TTGCAACCACTATGAAGAACAGG + Intergenic
1196580963 X:117378602-117378624 ATGGAATCACAAAGAAGAATTGG - Intergenic
1197706031 X:129635112-129635134 TGGGCATGTGAATGAAGAACAGG - Intergenic
1200017664 X:153179080-153179102 TTGGAATGACAATGAAGAGGGGG - Intergenic
1200946720 Y:8848415-8848437 TTGCAATATCAATGCAGAACTGG + Intergenic