ID: 1133246816

View in Genome Browser
Species Human (GRCh38)
Location 16:4454710-4454732
Sequence ACGTGGGCCCCTGGGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 289}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133246807_1133246816 14 Left 1133246807 16:4454673-4454695 CCCACTCTTCTTGAGGTGGCACT 0: 1
1: 0
2: 0
3: 14
4: 114
Right 1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 289
1133246806_1133246816 15 Left 1133246806 16:4454672-4454694 CCCCACTCTTCTTGAGGTGGCAC 0: 1
1: 0
2: 1
3: 12
4: 135
Right 1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 289
1133246808_1133246816 13 Left 1133246808 16:4454674-4454696 CCACTCTTCTTGAGGTGGCACTT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 289
1133246805_1133246816 16 Left 1133246805 16:4454671-4454693 CCCCCACTCTTCTTGAGGTGGCA 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG 0: 1
1: 0
2: 1
3: 27
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133246816 Original CRISPR ACGTGGGCCCCTGGGTGGCC AGG Intronic
900096674 1:942721-942743 CCGGGGGCCCCTGGGGGGGCAGG - Exonic
900151487 1:1180979-1181001 GCCTGGGAGCCTGGGTGGCCAGG - Intronic
900607691 1:3531182-3531204 CCTTGGGCTCCTGGGGGGCCTGG - Intronic
901516411 1:9749763-9749785 ACCTGCACCCCTGGGTGGCAAGG - Exonic
902107163 1:14047389-14047411 CCATGGGCTCCTGGGTGTCCAGG - Intergenic
902264567 1:15252713-15252735 CCGTGGGCCCCTCAGAGGCCAGG + Intronic
902318862 1:15645575-15645597 GAGTGGGCCACTGGCTGGCCGGG + Intronic
903683872 1:25116787-25116809 ACGTGGGCTCCTGGAGGGCCTGG - Intergenic
904317294 1:29673727-29673749 AGGTGGGCCCCAGGATGCCCAGG - Intergenic
905771665 1:40641922-40641944 ACATGGTCCCCGGGGTGGCAGGG + Exonic
905772226 1:40645757-40645779 ACATGAGCCCCTGGGTTGGCAGG - Intronic
906117258 1:43365165-43365187 AGGTGGGCCCCTGGGATGCCGGG - Exonic
907475013 1:54699794-54699816 CCCTGGGCCCTTGGGTGCCCTGG - Intronic
912057438 1:105622599-105622621 CCGTGGACCCCTGGGTGGGCAGG + Intergenic
914203387 1:145505942-145505964 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
914482509 1:148079096-148079118 CCGTGGGCTCCTGTGCGGCCGGG - Intergenic
915598812 1:156909867-156909889 ACCTGCACCCCTGGGTGGCATGG + Exonic
915651338 1:157313215-157313237 CAGTGGGCTCCTGGGTGGCTAGG + Intergenic
915997799 1:160581959-160581981 TCCTGGGGCTCTGGGTGGCCAGG + Intergenic
916284711 1:163093699-163093721 AGTTGGGCCGCTTGGTGGCCCGG - Intergenic
917824203 1:178799705-178799727 ACACGGGGCTCTGGGTGGCCAGG - Intronic
919466505 1:197926659-197926681 AGCTGTGCCCCTGGCTGGCCTGG - Intronic
922542117 1:226427464-226427486 ATGTGGGCCCCTGTGGGCCCAGG - Intergenic
922714473 1:227859791-227859813 CCGTGTGCCCCTGTGGGGCCTGG - Intergenic
1062770032 10:92061-92083 ATGTGTGGCCATGGGTGGCCCGG + Intergenic
1062829601 10:596966-596988 GAGTGGGCCCCGGGGTGCCCAGG + Intronic
1064090374 10:12378157-12378179 ACATGGGCCCCTGGGCAGCCAGG - Intronic
1064119321 10:12605512-12605534 GAGTGGGCCCCTGAGTGGCCTGG - Intronic
1065523417 10:26593977-26593999 ACTTGGGGCCCTGCGGGGCCGGG - Intergenic
1065529347 10:26653109-26653131 ACTTGGGGCCTTGGGGGGCCGGG - Intergenic
1069043436 10:63718298-63718320 ACCTGGGCTCCTGGGTGATCTGG + Intergenic
1069812191 10:71170256-71170278 ATGTGGGCTCCTGAGGGGCCAGG - Intergenic
1069828353 10:71268009-71268031 CCATGGGCCCCGGGGAGGCCAGG - Intronic
1070281379 10:75051214-75051236 ATGGGGGACCCTGGGTGGCAAGG + Intronic
1072805845 10:98423721-98423743 GTGCGGCCCCCTGGGTGGCCAGG - Intronic
1073070771 10:100791835-100791857 GTGTGGGCACCTGGGTGGACTGG + Intronic
1074762232 10:116675514-116675536 ACTTGGGCCACTGGGAGGGCAGG + Intronic
1075330416 10:121570055-121570077 TGGGGGGCCACTGGGTGGCCTGG - Intronic
1076359332 10:129875845-129875867 AGGGGGGCACCTGGGTGACCAGG - Intronic
1076529343 10:131134125-131134147 ATGTGGGCGCCTGGGTAGGCTGG + Intronic
1076595487 10:131622518-131622540 ACCTGGGGCCCTGGGTTCCCGGG - Intergenic
1076739860 10:132477808-132477830 GAGTGCGCTCCTGGGTGGCCTGG - Intergenic
1076865653 10:133165063-133165085 ACAAGACCCCCTGGGTGGCCGGG + Intronic
1077233743 11:1470144-1470166 ACGTGTGCCCCTGTCCGGCCCGG + Exonic
1077325442 11:1961999-1962021 AGGTGGGCTCCCGAGTGGCCTGG + Intronic
1077383310 11:2257462-2257484 ACGTGGGCCTCGGGGTACCCTGG - Intergenic
1077416476 11:2426464-2426486 ACGATGGCCCCTGGCTGTCCCGG - Intergenic
1077601871 11:3580264-3580286 ACGTGAGCCCCTGAGTCACCGGG - Intergenic
1078011590 11:7576689-7576711 ATGTGGCCCCCAGGGTGCCCTGG + Intronic
1080609512 11:33891948-33891970 ACAAGGGCCTCTGGGTGTCCTGG - Exonic
1083437572 11:62653177-62653199 GCGCGGGACCGTGGGTGGCCGGG + Exonic
1084030114 11:66476198-66476220 AGGTGGGGACCTGGGTGGGCAGG - Exonic
1084257784 11:67954810-67954832 ACGTGAGCCCCTGAGTTACCGGG - Intergenic
1084927051 11:72522312-72522334 ACCTGGGCTGCTGGGAGGCCTGG + Intergenic
1085255227 11:75168853-75168875 ACGGTGGCCCCTGGGTGGGGCGG - Intronic
1085306978 11:75492102-75492124 ACCTGGGCCCATGGCTGCCCTGG + Intronic
1085524689 11:77157402-77157424 AGGTGGGCCCCTGGGTAGGGGGG + Intronic
1088802649 11:113320457-113320479 AGTTGGGCCACTGGATGGCCAGG + Intronic
1088807065 11:113362188-113362210 ATATGGGCCTCTGGGTGGCAAGG + Intronic
1089611803 11:119673397-119673419 AGCTGGGACCCTAGGTGGCCCGG + Intronic
1089735825 11:120549684-120549706 TCGTGGGCCCCTGGGAGATCTGG + Intronic
1091119253 11:133043077-133043099 ACTTGGACCCCTGGGCAGCCAGG + Intronic
1202808423 11_KI270721v1_random:17178-17200 AGGTGGGCTCCCGAGTGGCCTGG + Intergenic
1092734633 12:11568716-11568738 TGTTGGGCCTCTGGGTGGCCTGG + Intergenic
1094433795 12:30398991-30399013 ATGTGGGCCCCAGGGAGGCCTGG - Intergenic
1095193704 12:39287842-39287864 ACCTGAGACCCTGTGTGGCCTGG - Intergenic
1096495567 12:52037468-52037490 AGGTGGGCCCCGGAGAGGCCGGG + Intronic
1096592193 12:52667745-52667767 GCGTGGGCCCCTGGGAGGGGTGG + Intergenic
1100444649 12:94649997-94650019 ACGCGGGGCCGCGGGTGGCCGGG + Intronic
1102371070 12:112382496-112382518 ACGAGGCCACCCGGGTGGCCTGG + Intergenic
1102540977 12:113619120-113619142 ACGTGGACCCCAGGCTGGCTTGG + Intergenic
1103564268 12:121807683-121807705 CTGAGGGCCCCAGGGTGGCCTGG - Intronic
1103980949 12:124736630-124736652 GCGTGGGTGCGTGGGTGGCCGGG - Intergenic
1104247886 12:127060792-127060814 AGTTGGGCCGCTGGGTGCCCGGG - Intergenic
1105299009 13:19116827-19116849 ACGCTGGCCACTGGGTGGCAGGG + Intergenic
1105845772 13:24292404-24292426 CCCTGCGCCCCTGGGTAGCCTGG - Intronic
1110572551 13:77022272-77022294 TCTTGGGACCCTGGTTGGCCTGG - Intronic
1113779559 13:112968566-112968588 GCGTGGGTCCGTGGCTGGCCGGG - Intronic
1114051373 14:18921554-18921576 ACGCTGGCCACTGGGTGGCAAGG - Intergenic
1114111188 14:19480371-19480393 ACGCTGGCCACTGGGTGGCAAGG + Intergenic
1118440131 14:65804551-65804573 AAGGGGGCCCCTGTGTGGTCCGG + Intergenic
1119480350 14:74954685-74954707 CCGTGGGCTCCTGGGTGGGCTGG - Intronic
1121313364 14:92946955-92946977 ATGTGGGCCCCTGGGAGGGGTGG + Intronic
1122810119 14:104283579-104283601 CCGTTGTCCCCAGGGTGGCCTGG + Intergenic
1122930807 14:104932378-104932400 GGGCGGGCCCCAGGGTGGCCAGG + Intronic
1123063750 14:105606078-105606100 CCCTGGGACCCTGGGTGCCCAGG + Intergenic
1123545080 15:21331687-21331709 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1123739769 15:23225764-23225786 ATGTGGACCCCCAGGTGGCCCGG - Intergenic
1124290994 15:28454737-28454759 ATGTGGACCCCCAGGTGGCCCGG - Intergenic
1128248693 15:66150192-66150214 CCGTTCTCCCCTGGGTGGCCTGG - Intronic
1129478348 15:75803040-75803062 ACGTGGGGCCTTGTGTGTCCTGG + Intergenic
1130095379 15:80851687-80851709 ACGTTGGACACTGGGTGGGCAGG + Intronic
1131151280 15:90048881-90048903 ACGGGAGCCCCTGGGTTGCCAGG - Intronic
1202953426 15_KI270727v1_random:58958-58980 AAGAGGGCCCCTCTGTGGCCTGG + Intergenic
1132542993 16:520068-520090 ACGGTGGCCCCTGGGAGCCCAGG + Intronic
1132833633 16:1941931-1941953 TCCTGGGCTCCTGTGTGGCCTGG - Intronic
1133246816 16:4454710-4454732 ACGTGGGCCCCTGGGTGGCCAGG + Intronic
1133370223 16:5240760-5240782 ACGTGGGCCCCTGAGTGACCGGG + Intergenic
1135423033 16:22317221-22317243 ACTGGGGCCCCCGGGTGGGCAGG - Intronic
1136707770 16:32202907-32202929 ATGTGGACCCCCGGGCGGCCCGG + Intergenic
1136760139 16:32726504-32726526 ATGTGGACCCCCGGGCGGCCCGG - Intergenic
1136807965 16:33143882-33143904 ATGTGGACCCCCGGGCGGCCCGG + Intergenic
1137509135 16:49082797-49082819 ACCTGGCCCCTTGGGTGACCAGG + Intergenic
1139713052 16:68791078-68791100 ATGTTGGCCCCCGGGTGGGCAGG + Intronic
1139922856 16:70470751-70470773 AGGTGGCCCCCAGGGTGGCAAGG + Intronic
1141788831 16:86219062-86219084 ACGTGGGCTCCAGGATGGCAGGG + Intergenic
1141881761 16:86864925-86864947 ACGTTGGCTCCTGAGTGGCCTGG + Intergenic
1141910755 16:87056944-87056966 AGGTGGGGGCCTGGGAGGCCTGG - Intergenic
1142027724 16:87823548-87823570 ACCTGGGCACCTGGCGGGCCTGG - Intergenic
1142374126 16:89698015-89698037 ACGTGGCCTCCTGTGTGGCCTGG - Exonic
1203062295 16_KI270728v1_random:986826-986848 ATGTGGACCCCCGGGCGGCCCGG - Intergenic
1142709708 17:1716325-1716347 CCGTCGGCCCCCGGGTGGGCGGG - Intergenic
1142744003 17:1946093-1946115 CCCTGGGCCTCTGGCTGGCCTGG - Intronic
1143171635 17:4933864-4933886 AGGTGGGCTCCGGGGTGGTCGGG - Exonic
1144829519 17:18123436-18123458 ACGTGGGCAGATGGGTGGGCCGG + Intronic
1145055649 17:19702272-19702294 ACCTGTGCCCCAGGCTGGCCAGG - Intronic
1145056671 17:19707733-19707755 ACGTGGGCAGGTGGGAGGCCTGG - Exonic
1145273489 17:21416872-21416894 AAGTGGCCTCCTGGGGGGCCAGG + Exonic
1145311680 17:21704316-21704338 AAGTGGCCTCCTGGGGGGCCAGG + Exonic
1145825994 17:27877723-27877745 CCGTGGGCCCCTGCATGACCGGG + Intronic
1145868443 17:28255522-28255544 GAGTGAGCCCCTGGGAGGCCAGG - Intergenic
1147546561 17:41406529-41406551 AGCAGGGCCCATGGGTGGCCCGG + Intergenic
1147643503 17:42019901-42019923 ACGCGGGCCGCTGGGTGTTCTGG - Intronic
1147998726 17:44375544-44375566 CCGTGGGTCCCGGGGAGGCCGGG + Intronic
1148101415 17:45094144-45094166 ACAAGGGGCTCTGGGTGGCCGGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150648457 17:66994538-66994560 GACTGGGCCCCTGGGGGGCCAGG - Intronic
1151478468 17:74356551-74356573 GCCTGGTCCCCTGGATGGCCAGG - Exonic
1151697214 17:75723767-75723789 GCTTGGGCCCCTGGGAGACCTGG + Intronic
1151748317 17:76023316-76023338 ACGTGGGACCCAGGGTCGACTGG - Exonic
1152363183 17:79841743-79841765 GCGTGGGCCCCTGAGGGGCCTGG - Intergenic
1152561884 17:81082745-81082767 ACTTGGGAGTCTGGGTGGCCAGG + Intronic
1152702389 17:81825487-81825509 CCTTGGGCCTCTGGGTGGGCAGG - Exonic
1156268200 18:35507447-35507469 AGGTGGGCCACTGGGTGGGTGGG + Intergenic
1157622926 18:49026580-49026602 ACAGGTGCCCCTGGGTAGCCAGG + Intergenic
1160146728 18:76371481-76371503 ATGTGGGCCCTGAGGTGGCCGGG + Exonic
1160791272 19:924887-924909 ACGTGAGCCCCAGGGGAGCCTGG - Intergenic
1160983192 19:1826161-1826183 AGCTGGGGCCCTGGGTGCCCAGG - Intronic
1161129303 19:2578890-2578912 AGCTCGGCCCCTGGGGGGCCGGG - Intronic
1161851664 19:6740601-6740623 CTGGGGGCCCCTGAGTGGCCAGG - Intronic
1162568531 19:11457516-11457538 TTGTGGGCCCCCGGGTGGCCGGG - Intronic
1163374369 19:16921425-16921447 GGGAGGGCCCCTGGGAGGCCGGG - Intronic
1163592799 19:18203875-18203897 AGGTGAGCTCCTGGGCGGCCGGG - Exonic
1165012438 19:32858625-32858647 AGGTGGGTCCCTGGGTCCCCTGG - Intronic
1165060112 19:33201070-33201092 ATGTGGGTCCCTGAGTGGACGGG - Intronic
1165716312 19:38048022-38048044 GCGTGTGCCTCTGGGTGGGCAGG + Intronic
1165902833 19:39176714-39176736 AGGTGAGCCCCGGGGTGGCTTGG + Exonic
1165939619 19:39408501-39408523 CTGGGGGCCCTTGGGTGGCCTGG + Exonic
1166671163 19:44710377-44710399 GATTGGGCCACTGGGTGGCCCGG + Intronic
1167419316 19:49393996-49394018 ACCTGGTCCCCAGGGTGGGCTGG + Intronic
1167493536 19:49805396-49805418 AGGTGGGCCCCCGGGAGGTCTGG - Intronic
1167605619 19:50480158-50480180 ACCCGGGGCCCTGGATGGCCTGG + Exonic
1168147855 19:54429771-54429793 ACCTGGACCCCTGGGTGGGGAGG + Intronic
1168688281 19:58361829-58361851 ACATGGGCCCTTGGGGGACCCGG - Intronic
925045729 2:771742-771764 ACACGGGCTCCTGGGTGGACAGG + Intergenic
925226117 2:2185643-2185665 ACGCGGGCGTCTGGGAGGCCCGG - Intronic
925226145 2:2185742-2185764 ACGCGGGCGTCTGGGAGGCCCGG - Intronic
925226179 2:2185850-2185872 ACGCGGGCGTCTGGGAGGCCCGG - Intronic
925226235 2:2186048-2186070 ACGCGGGCGTCTGGGAGGCCCGG - Intronic
925226266 2:2186147-2186169 ACGCGGGCGTCTGGGAGGCCCGG - Intronic
926123321 2:10256427-10256449 AGGTGGGCCCCAAGGTGGACAGG + Intergenic
926320032 2:11743277-11743299 AAGTGGGCCTCTGGATAGCCCGG + Intronic
926474731 2:13308385-13308407 CCGTGGGCTCCTGCGCGGCCCGG - Intergenic
927095995 2:19747985-19748007 GCCTGGGCCTCTGGGTGGGCTGG - Intergenic
927717056 2:25359806-25359828 ATGTGGGCCCCTGGGAGGTTGGG + Intergenic
932446065 2:71782364-71782386 AGGTGGGGCTCTGGGGGGCCAGG + Intergenic
934660252 2:96139329-96139351 AGGTGGGGCCCTGAGTGACCTGG - Intergenic
935146574 2:100399559-100399581 ACGTTGTCCCCTGGGAGGACAGG - Intronic
935585944 2:104800508-104800530 ACATGGGCCACTGGGTGTGCTGG - Intergenic
935983888 2:108653724-108653746 ACATGCGCCCCGGGGTGGTCGGG + Intronic
936073050 2:109384148-109384170 ACGTGGGACCCCAGGCGGCCTGG - Intronic
936136321 2:109897378-109897400 ACATGCGCCCCGGGGTGGTCGGG + Intergenic
936208376 2:110474107-110474129 ACATGCGCCCCGGGGTGGTCGGG - Intergenic
936946513 2:117935715-117935737 ACGGGGGCCCCTGGGATCCCAGG + Intronic
937925243 2:127162836-127162858 AGGTGGGCCCTTGGGAGGTCAGG - Intergenic
938079140 2:128360031-128360053 CCGTGGGACCCTGAGTGTCCAGG + Intergenic
938312559 2:130302455-130302477 ACGCTGGCCACTGGGTGGCAGGG - Intergenic
941937944 2:171001341-171001363 TCATGGGCTCCTAGGTGGCCAGG + Intronic
944728363 2:202495319-202495341 AGTTGGGCCGCTTGGTGGCCAGG + Intronic
946332625 2:219019018-219019040 AAGGGGGCCACTGGGGGGCCTGG - Intronic
947167765 2:227279870-227279892 ACCTTGGCTCCTGGGAGGCCTGG - Exonic
947619897 2:231583121-231583143 AAGCGGGGCCCTGGGTGGGCTGG - Intergenic
947739014 2:232476444-232476466 ACATGGCCCCTTGGGTGGGCTGG - Intergenic
947748357 2:232520745-232520767 AAGTGGGACCCTGGGCGGGCGGG + Intronic
948764229 2:240211356-240211378 ACGAGGGCACCTCTGTGGCCTGG - Intergenic
948916369 2:241036669-241036691 AGGTCGGCCTCTGGGTGCCCGGG - Intronic
948916457 2:241036994-241037016 ACCTGGGACCCTGGGCGCCCAGG - Intronic
1171227424 20:23453124-23453146 GCGAGGGCCCCTGGGAGTCCTGG + Intergenic
1171486178 20:25488141-25488163 ATGTGGGCTGCTGGGAGGCCTGG - Intronic
1172291639 20:33781209-33781231 ATGTTGGCCCTGGGGTGGCCGGG + Intronic
1172525936 20:35600718-35600740 ACGTGGACCCCTGCTGGGCCTGG + Intergenic
1172997837 20:39083888-39083910 CCCTTGGCCCCTGGCTGGCCTGG + Intergenic
1173595659 20:44257355-44257377 GAGTGGGCCCCTGGGTGGGGAGG - Intronic
1175637229 20:60595995-60596017 AGGTGGGTCCCTGGGTAGCCAGG - Intergenic
1175945763 20:62558016-62558038 CCGGAGGCCCCTGGGTGCCCAGG + Intronic
1179250100 21:39664943-39664965 AGGTGGGCCCCTCGGAGGACTGG - Exonic
1179880178 21:44290333-44290355 AGCTGGGCCCGTGGGTGGGCCGG + Intronic
1179885772 21:44313696-44313718 TCCTGGCCCGCTGGGTGGCCCGG + Intronic
1180167871 21:46039336-46039358 TCGGGGGCGCCTGGGTTGCCGGG - Intergenic
1180469846 22:15643929-15643951 ACGCTGGCCACTGGGTGGCAAGG - Intergenic
1180969321 22:19806876-19806898 CCGTGGGCACCTGGGAGCCCAGG + Intronic
1180969808 22:19809323-19809345 AGTTGGGCTGCTGGGTGGCCTGG - Intronic
1181009636 22:20032825-20032847 ATGTGGGCACACGGGTGGCCAGG - Intronic
1181313791 22:21959502-21959524 ACGTGGGGACCTGGGTCCCCAGG + Intronic
1181513475 22:23399106-23399128 ATGTGCCTCCCTGGGTGGCCGGG - Intergenic
1181687964 22:24542464-24542486 ACTTGGGCCCATGGGTAGGCAGG + Exonic
1181726353 22:24813767-24813789 AGGAGGGCCCCTGGCTTGCCTGG + Intronic
1182685542 22:32120043-32120065 ATGTTGGCCACTGGGTGGCAGGG + Intergenic
1182736008 22:32532694-32532716 CCGTGGGCCCCTGGGGAGCGAGG + Intronic
1182851263 22:33476519-33476541 ACATGTGCCCCAGGGTGGTCAGG - Intronic
1183217745 22:36492106-36492128 ATGGAGGCCCCTGGGAGGCCAGG + Intronic
1183731883 22:39622766-39622788 GTGTGGGCACCTGGGTGGGCGGG + Intronic
1185347369 22:50316521-50316543 CCGTGGGCTCCTGAGTGGCGAGG - Intronic
1185384206 22:50524324-50524346 CCCTGGGACCCTGGGAGGCCAGG - Exonic
949259016 3:2083916-2083938 CCGTGGGCTCCTGTGCGGCCCGG + Intergenic
950045547 3:9946814-9946836 TCGCGGACCCCAGGGTGGCCCGG - Exonic
950330779 3:12154495-12154517 ACCTGGGCCCCTGGGGCTCCAGG - Intronic
951551510 3:23879651-23879673 CCGTGGGCACCAGGGAGGCCTGG + Intronic
952382732 3:32817467-32817489 CCAGGGGCTCCTGGGTGGCCCGG - Intergenic
952965295 3:38617358-38617380 CTGTGGGCCCTTGGCTGGCCTGG - Intronic
954515769 3:51175196-51175218 CCTTGGGTCCCTGGGTGGGCGGG + Intronic
957072712 3:75579298-75579320 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
959378437 3:105613225-105613247 ACAAGGCCCCCTGGGTGCCCTGG + Intergenic
960986918 3:123286781-123286803 ACATCGGCCCCGTGGTGGCCGGG - Exonic
961281362 3:125767453-125767475 ACGTGGGCCCCTGAGTCACTGGG + Intergenic
961302978 3:125933994-125934016 AGGTGGGCCCCTGGGTAAGCTGG - Intronic
961873007 3:130002126-130002148 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
968181553 3:196599108-196599130 CCGTGGGCTCCTGTGCGGCCCGG - Intergenic
968921892 4:3526626-3526648 ACGTGTGCCCCTGCGCGGCGCGG - Intronic
968956086 4:3720343-3720365 ACGTGTGGCCCTGGGAGGCCTGG - Intergenic
969243549 4:5917881-5917903 GCCTGGGCCCCTGCTTGGCCTGG - Intronic
969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG + Intronic
969590678 4:8120245-8120267 ACGTGGGCATCTGGGGGTCCCGG - Intronic
969642141 4:8405316-8405338 ACATGGAGGCCTGGGTGGCCGGG - Intronic
969697014 4:8740736-8740758 ACTTGGGCCCCTGGGTGCGCAGG - Intergenic
969796835 4:9533277-9533299 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
972321578 4:37977421-37977443 CCGTGGGCCCGCGGGCGGCCGGG - Intronic
974004733 4:56544703-56544725 ACCTGCGCCCCCTGGTGGCCTGG + Intronic
974594865 4:64001615-64001637 AAAGGGCCCCCTGGGTGGCCAGG - Intergenic
977960230 4:103076581-103076603 ACGTGGGCCCATGGTCGGCCTGG - Exonic
979701531 4:123673619-123673641 ACGTGGCCCCATGGCTCGCCAGG - Intergenic
980863827 4:138530167-138530189 CCTTAGGCCCCTGGGTGGCATGG - Intergenic
985630762 5:1012796-1012818 GCGCTGGCTCCTGGGTGGCCAGG - Intronic
985663602 5:1169777-1169799 ACGGGGGCTCCTGGGGGGCATGG + Intergenic
988503012 5:31799177-31799199 ACGTGGGGCCCTGTGGGGTCTGG + Exonic
995224987 5:109690882-109690904 ACGCGGGCCCCGGGCTGGCGGGG - Intronic
996802582 5:127420160-127420182 ACGTGTGCACCTGGATGGCGCGG + Exonic
997713987 5:136028847-136028869 CCGTGCGCCCCTGGCTGCCCTGG - Intergenic
998926336 5:147130368-147130390 TCTTGGGCCCCTGGGCAGCCAGG + Intergenic
999517104 5:152312634-152312656 AGGTGGTCCCCTGGGGAGCCAGG + Intergenic
1000111000 5:158107994-158108016 TCCTGGCCCCCAGGGTGGCCTGG + Intergenic
1001982894 5:176048385-176048407 AGGTGGACACCTAGGTGGCCTGG - Intergenic
1002043554 5:176530346-176530368 ACGTGGGCTCCGGGGCGGCTGGG - Intronic
1002043585 5:176530442-176530464 ACGTGGGCTCCGGGGCGGCTGGG - Intronic
1002234569 5:177795672-177795694 AGGTGGACACCTAGGTGGCCTGG + Intergenic
1002710631 5:181192567-181192589 ACTTGGGTCACTGGGCGGCCAGG + Intergenic
1003955889 6:11164794-11164816 AAGGGGGCTCCTGAGTGGCCGGG + Intergenic
1008501787 6:52190763-52190785 CCATGGGCCTCTGGGTGGGCTGG - Intergenic
1012400134 6:98835618-98835640 TGGTGCGCGCCTGGGTGGCCAGG - Exonic
1015520430 6:134125049-134125071 ACATGTCCACCTGGGTGGCCAGG - Intergenic
1017446184 6:154509697-154509719 ACTCGGGCCCCCGGGTCGCCGGG + Intronic
1017807048 6:157955008-157955030 ACGTGTCCCCCTAGGTGGCTCGG - Intergenic
1019058094 6:169237134-169237156 AGGCGGGGCCCTGGGTGGGCGGG - Intronic
1019147416 6:169984219-169984241 ACGAGGGCCCCTGGGTTCCTTGG + Intergenic
1019409403 7:900066-900088 ACGTGCGGCCTGGGGTGGCCTGG - Intronic
1019481437 7:1268674-1268696 AAGAGGGCCACTGGGTGTCCTGG - Intergenic
1019540734 7:1549977-1549999 TCCTGGGCCCCTGGGGGACCTGG - Intronic
1021969336 7:25951316-25951338 ACGTGCGCCCCGGGCGGGCCCGG + Intergenic
1023052723 7:36267316-36267338 ATGGGGGCCCCTGCATGGCCAGG + Intronic
1023391385 7:39714721-39714743 ACCTGGGCCCCTTTGTGCCCTGG - Intergenic
1023758867 7:43445060-43445082 AAGTGGCCCCCGGAGTGGCCAGG - Exonic
1031629815 7:124032921-124032943 CCGGGGGCCCCTGGCGGGCCAGG - Exonic
1032119231 7:129144705-129144727 TCCTGGGCGCCTGGCTGGCCGGG + Intergenic
1032468271 7:132160520-132160542 GTGTGGGCTCCTGGGTGGACTGG + Intronic
1034439482 7:151079462-151079484 AGGTGGGCGCCTGGGGGGCTAGG - Intronic
1034976792 7:155453811-155453833 ACGCGCGCCCCTGGCAGGCCTGG + Intergenic
1035476984 7:159150768-159150790 ACCTGGGCCTCTGGGTGCCCAGG - Intergenic
1035565256 8:636773-636795 ACGTGCTCCCCTGAGGGGCCAGG + Intronic
1035719767 8:1783219-1783241 ATGTGGGCCGCTGAGTGGGCCGG - Exonic
1036182051 8:6594156-6594178 GCGGGGGCTCCTGGGAGGCCAGG - Intronic
1036242731 8:7092976-7092998 ACGTGGGCCCCTGAGTCACCGGG + Intergenic
1036829998 8:12014168-12014190 ACGTGGGCCCCTGAGTCACCGGG - Intronic
1036899086 8:12658462-12658484 ACGTGGGCCCCTGAGTCACCGGG - Intergenic
1036983534 8:13499078-13499100 CTGTGGGTTCCTGGGTGGCCAGG + Exonic
1037513889 8:19610651-19610673 AGCTGGGCCACTCGGTGGCCTGG - Intronic
1038453920 8:27659007-27659029 AGGAGGCCCCCAGGGTGGCCTGG - Exonic
1039473992 8:37829787-37829809 GTGTGGGCTCATGGGTGGCCTGG - Intronic
1040308481 8:46224380-46224402 ACTGGGGCCACTGGGTGGCTTGG + Intergenic
1040315800 8:46260265-46260287 GCGTGGGCCACAGGGTGGCGTGG + Intergenic
1040323987 8:46331979-46332001 CCGTGGGCTCCTGTGAGGCCCGG + Intergenic
1040341254 8:46442314-46442336 ACGGGGGCAGCAGGGTGGCCTGG - Intergenic
1041107139 8:54454539-54454561 CCGTGGGCCCCTGAGTGACCAGG - Intergenic
1041176906 8:55206409-55206431 AGGTGGGCTCCTGGGTGGGTGGG - Intronic
1043450034 8:80357164-80357186 ACGTGGGCAACATGGTGGCCAGG - Intergenic
1049102563 8:140590091-140590113 CCGTGGGCTCATTGGTGGCCCGG - Intronic
1049440959 8:142609556-142609578 CCTTGGGAACCTGGGTGGCCTGG + Intergenic
1049696143 8:143985188-143985210 CCCTAGGCCCCTGGGTGGACGGG + Exonic
1049744201 8:144256322-144256344 ACCTGGGCGCCTGGGTGGGATGG - Intronic
1049804838 8:144534104-144534126 ACGGGTGCGCCTGGGGGGCCGGG - Intronic
1053284730 9:36842789-36842811 ACCAGGGCCCCAGGGTGGCAAGG - Intronic
1056557654 9:87703216-87703238 AGGTGAGCCCCTGGGAGCCCAGG + Exonic
1056756599 9:89385720-89385742 AAGAGGGCCCCTGTCTGGCCGGG - Intronic
1057260105 9:93578130-93578152 ATGTGGGGACCTGGGTGGCTGGG + Intronic
1061261809 9:129484293-129484315 AGGTGGGCTCCTCGGGGGCCAGG - Intergenic
1061268749 9:129524257-129524279 GTGTGGGTCCCTTGGTGGCCAGG - Intergenic
1061866357 9:133493564-133493586 ACTTGGGGCCCTGGGTTGCCTGG + Intergenic
1062235831 9:135507126-135507148 ACCAGGGCCCCTGGATGGCTGGG + Intergenic
1062331633 9:136047482-136047504 AAGTGGGCGGCTGGGAGGCCAGG - Intronic
1062380886 9:136286043-136286065 ACGGTGACCGCTGGGTGGCCAGG - Intronic
1062387361 9:136318164-136318186 GAGTGGGCTCCTGGGAGGCCTGG + Intergenic
1062525873 9:136977929-136977951 GCGTGGGCGCGTGTGTGGCCCGG - Intronic
1062535016 9:137017645-137017667 ACGCGGTGCACTGGGTGGCCTGG - Exonic
1062636037 9:137492459-137492481 AGGTGGGACCATGGGTGGGCGGG + Intronic
1185643502 X:1601004-1601026 CCGTCGGCCTCTGGGTGGGCCGG - Exonic
1189909595 X:45796665-45796687 ACCTGGGCTCCTGGAGGGCCTGG - Intergenic
1196795102 X:119495939-119495961 ACGGGGGCCCCAGGGTTGCAGGG + Intergenic
1199904046 X:152206616-152206638 ACCTGGGCCACTGCGTGGCCAGG - Intronic
1199978613 X:152908738-152908760 ACCTGGGCCACTGCGTGGCTGGG + Intergenic