ID: 1133250394

View in Genome Browser
Species Human (GRCh38)
Location 16:4476737-4476759
Sequence TCTCCAGAAGTCGTCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133250391_1133250394 -10 Left 1133250391 16:4476724-4476746 CCGCGGACGCCGCTCTCCAGAAG 0: 1
1: 0
2: 0
3: 11
4: 59
Right 1133250394 16:4476737-4476759 TCTCCAGAAGTCGTCTCCCCGGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133250394 Original CRISPR TCTCCAGAAGTCGTCTCCCC GGG Intronic
900376270 1:2356184-2356206 TCCCCTGAAGGCCTCTCCCCAGG - Intronic
901396439 1:8985504-8985526 TCTCCAGAAATCTCCTCCACTGG + Intergenic
903826194 1:26147258-26147280 TCACCAGAGGTGGTCTGCCCTGG - Intergenic
906496446 1:46307394-46307416 TCTCAAGCAGTCCTCTCACCTGG + Intronic
906706917 1:47901688-47901710 TCTCCAGAAGTCTGCCCCCATGG - Intronic
912569444 1:110610719-110610741 TCCCCAGGGGTCGTCTCTCCTGG + Intronic
1063094189 10:2895027-2895049 TCTCCAGTACTGGTCTCCCAAGG - Intergenic
1064966580 10:21020720-21020742 TCTTGAAATGTCGTCTCCCCGGG + Intronic
1067413363 10:46084558-46084580 TCTGTAGAAGTCGTCCTCCCAGG + Intergenic
1073455223 10:103632656-103632678 TCTGCAGCTGTCATCTCCCCTGG + Intronic
1074683873 10:115939830-115939852 TCCCCAGAAGACCTCTCACCAGG + Intronic
1079394446 11:20049868-20049890 TCTGCAGAAGTACTCTGCCCAGG + Exonic
1080069145 11:28058417-28058439 GCTCAAGCAGTTGTCTCCCCTGG - Intronic
1081390363 11:42522203-42522225 TCTCAAGAAGACCTGTCCCCAGG - Intergenic
1082795882 11:57377531-57377553 TCTCCAGAACTCCTATCACCTGG + Intronic
1083188514 11:61032762-61032784 TCTCCAGAACTCTTCTCATCTGG - Intergenic
1083552262 11:63598796-63598818 TCTCCAGCAGTAATGTCCCCCGG + Intronic
1085764995 11:79274879-79274901 TAGCCAGAAGACTTCTCCCCGGG + Intronic
1090600245 11:128362647-128362669 GCTCAAGCAGTCCTCTCCCCTGG + Intergenic
1095049204 12:37541903-37541925 TCCCCAAAAGTCGTGCCCCCGGG + Intergenic
1098109341 12:67105278-67105300 TCTCCAGAACTCTTCTCAGCTGG - Intergenic
1106110069 13:26769144-26769166 TCTCCAGATGTTGCCTACCCAGG + Intergenic
1107690269 13:42946689-42946711 TCTCCAATAGTCCTCTCCACAGG + Intronic
1119828760 14:77681900-77681922 CCTCCAAAAGTCCTCTCCCAAGG - Intronic
1124176056 15:27425137-27425159 CCTCCAGCTGTCGTCTCCCAGGG - Intronic
1125731866 15:41896917-41896939 TCTCCCTAACTCTTCTCCCCCGG + Exonic
1128344466 15:66844759-66844781 TCTCCAGATGTCTTTTCCCTGGG - Intergenic
1129787213 15:78317384-78317406 TGTCCAGAAGAGGGCTCCCCAGG - Intergenic
1130977473 15:88788487-88788509 TCTGCAGAAGTAGCCTCCCCAGG - Intergenic
1133250394 16:4476737-4476759 TCTCCAGAAGTCGTCTCCCCGGG + Intronic
1135494827 16:22942289-22942311 TCTCCAGGAGTTGCTTCCCCTGG - Intergenic
1141775091 16:86117690-86117712 TCCCAAGAAGGCGTGTCCCCAGG - Intergenic
1150426529 17:65081670-65081692 TCTCCAGATGTTGCCTCCTCTGG - Intergenic
1152359731 17:79826176-79826198 GCTCCAGCATTCGTCTTCCCTGG + Intergenic
1155238446 18:23844046-23844068 TCTGAGGAAGTCGTCTTCCCAGG + Intronic
1159249922 18:65862687-65862709 TCTCCGGAAGCCGTTTCTCCTGG - Exonic
1161770881 19:6230126-6230148 TCTCCAGGAGTCGTGTGGCCGGG - Intronic
1162283758 19:9721951-9721973 TCTCCTGAAGTCTTATTCCCTGG + Intergenic
1163178767 19:15584156-15584178 TCTCCAGAAGACATCACCTCTGG + Intergenic
1163444149 19:17337089-17337111 TCTCCAGTACTCGTCCCTCCCGG + Intronic
1164784403 19:30918690-30918712 ACTCAAGAAGTAGACTCCCCGGG + Intergenic
1164806383 19:31120329-31120351 AATCCACAAGTCCTCTCCCCAGG - Intergenic
1167606581 19:50484383-50484405 TCTGCAGATGTCTTCTACCCCGG + Exonic
925948216 2:8886241-8886263 TTTCCAGAAGTCCTCTCCCAGGG - Intronic
928097425 2:28413154-28413176 CCTCCAGAAGCCGTCTCCGAAGG - Exonic
935669958 2:105546589-105546611 CCTGCTGAAGTCTTCTCCCCTGG - Intergenic
938973297 2:136451712-136451734 CCTCCAGAACTCTTTTCCCCTGG - Intergenic
945936151 2:215904597-215904619 TCTGAAGAAGTCATCTTCCCAGG - Intergenic
946460484 2:219864278-219864300 TCTCCAGCAGCTGACTCCCCTGG + Intergenic
948858949 2:240743623-240743645 GCAGCAGAAGTGGTCTCCCCGGG + Intronic
949042853 2:241857532-241857554 TCCCCCGCAGTCGTCTCCCTGGG + Intronic
1171341122 20:24430714-24430736 TCCACAGCAGTTGTCTCCCCAGG - Intergenic
1171543736 20:25985403-25985425 TCCCCAAAAGTCGTGCCCCCGGG + Intergenic
1172121345 20:32600779-32600801 TCTCCAGGACTCCACTCCCCAGG - Intronic
1172203082 20:33140446-33140468 TCTCCAGATGGTGTTTCCCCAGG - Intergenic
1175369816 20:58480684-58480706 GGGCCAGAACTCGTCTCCCCAGG - Intronic
1175443098 20:59004394-59004416 TCTCCTGATCACGTCTCCCCAGG - Intronic
1175476332 20:59277268-59277290 TCTCCAGACGTTTTCTCCCTGGG + Intergenic
1179822869 21:43947023-43947045 GCTCCAGAATTTGTCTCCTCTGG - Intronic
1180040990 21:45279937-45279959 TCTCCAGAAATCGCCTCACATGG - Intronic
1183192033 22:36327788-36327810 TCTCCAGGAGTCGACTTCCCTGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
955379237 3:58423154-58423176 TCTCCAGAAGTCCTCTTCAGAGG + Intronic
955962207 3:64352242-64352264 TCTCCAGAAGGCATCTCAGCAGG - Intronic
956061891 3:65356641-65356663 TCTCCAGAGACCGTCTCCGCCGG + Exonic
957091912 3:75739090-75739112 TCTCCAGACTGTGTCTCCCCAGG + Intronic
959925207 3:111913315-111913337 TCTCCAGACGCTGTCTCTCCTGG - Exonic
969697599 4:8743934-8743956 CTTCCAGAAGTAGTCTGCCCTGG + Intergenic
971372903 4:26032520-26032542 TGTGCAGAAGACTTCTCCCCTGG - Intergenic
972260503 4:37403515-37403537 TCCTCAGAAATCGTCTCCACTGG - Intronic
985646826 5:1088896-1088918 TCCCCAGATGCCGTCTCCCCTGG - Intronic
987133914 5:14883268-14883290 CCTCCAGCAGTCAGCTCCCCTGG - Intergenic
988844396 5:35113805-35113827 TCTCCCGAAGCAGCCTCCCCAGG - Intronic
999474693 5:151887852-151887874 TCTCCAGAACTTCTCTCACCTGG - Intronic
1000576230 5:162978857-162978879 TTTCCAGTTGTCCTCTCCCCGGG + Intergenic
1004455219 6:15785697-15785719 TCCCCAGAAGAGGCCTCCCCAGG + Intergenic
1005818115 6:29574113-29574135 TCACCATAAGTTGTGTCCCCGGG + Intronic
1006855519 6:37130523-37130545 TCTCCAGAGTTCTGCTCCCCTGG + Intergenic
1011054863 6:83193737-83193759 TCTCCGGCTGCCGTCTCCCCGGG + Intronic
1018803543 6:167241345-167241367 TGTCCAGAAGTCTCCTCCACAGG - Intergenic
1019077878 6:169405035-169405057 TCTCCACCAGTCTTCTCCGCTGG + Intergenic
1019168100 6:170112382-170112404 TCTTCAGGAGTTGTCTCCACAGG + Intergenic
1020244530 7:6420513-6420535 TCTCTATAAGTCGTCTCTTCTGG - Intronic
1021998926 7:26206230-26206252 TTTCCAGAAGGTGTCTGCCCTGG + Intronic
1023054304 7:36279277-36279299 TCTCCAGCAGTGGACTCCACAGG - Intronic
1025295105 7:57770476-57770498 TCCCCAAAAGTCGTGCCCCCGGG + Intergenic
1030211248 7:106997966-106997988 TCTCCATAAATCTTCTCCCCTGG - Intergenic
1030673722 7:112364128-112364150 TCTCCAGATGTGGGCTCCCCAGG + Intergenic
1032071251 7:128808635-128808657 TCTCCTGAAGGCCTTTCCCCAGG - Intronic
1032471751 7:132184119-132184141 CATGCAGAAGTGGTCTCCCCGGG - Intronic
1043564759 8:81535497-81535519 CCTCCAGAAGTCATTTCCCTAGG - Intergenic
1053046780 9:34926744-34926766 TCTCCAGCAGAAGTATCCCCAGG - Intergenic
1056659444 9:88534104-88534126 TGTCCCGCAGCCGTCTCCCCAGG - Intergenic
1061697815 9:132390742-132390764 TCTGAAGAAGATGTCTCCCCAGG - Exonic
1185713567 X:2323528-2323550 CCTCCAGCAGTCTTCTCACCTGG - Intronic