ID: 1133254603

View in Genome Browser
Species Human (GRCh38)
Location 16:4508972-4508994
Sequence CAGCAAGCAGCACTGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 4, 3: 65, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133254603_1133254610 28 Left 1133254603 16:4508972-4508994 CCGCCCACCAGTGCTGCTTGCTG 0: 1
1: 0
2: 4
3: 65
4: 390
Right 1133254610 16:4509023-4509045 CTGCTCCAGCTCACTCTCTCTGG 0: 1
1: 0
2: 13
3: 161
4: 814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133254603 Original CRISPR CAGCAAGCAGCACTGGTGGG CGG (reversed) Intronic
900465991 1:2825721-2825743 CAGAAAGCAGCAGTGGAGTGGGG + Intergenic
901780339 1:11590126-11590148 CAGCCAGCAGCTTTGGTGTGTGG - Intergenic
902313096 1:15597019-15597041 TAGCAATCAGCTCTTGTGGGAGG - Intergenic
902694057 1:18128514-18128536 GAGCTTGCATCACTGGTGGGAGG - Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
903293219 1:22327666-22327688 CAGCAGGCAGCACAGGGGAGAGG - Intergenic
903295303 1:22339675-22339697 CAGAAAGCAGCGCTGGAGGAGGG + Intergenic
904613877 1:31739445-31739467 CAGCAGGCAGCCCTGGCAGGGGG - Exonic
904936043 1:34130463-34130485 AAGCATGCAGGAGTGGTGGGAGG + Intronic
904948112 1:34214178-34214200 CAGTGAGCAGCACTGGGAGGAGG + Intronic
905029847 1:34874808-34874830 CAGCAGGCAGGAAGGGTGGGAGG + Intronic
905865755 1:41375718-41375740 CACCAGGCAGCCCTTGTGGGTGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908766871 1:67562130-67562152 CAGCAAGCAGCACTGCAGCTGGG - Intergenic
910427208 1:87129896-87129918 CAGAAAGCAGCCCCGCTGGGAGG - Intronic
910861566 1:91747376-91747398 CTGCAAGCAGCAGTGAAGGGTGG - Intronic
912447336 1:109748120-109748142 CAGGCAGCAGCATTTGTGGGTGG - Intronic
913699861 1:121364074-121364096 GAGCTAGCAGCTATGGTGGGAGG + Intronic
914137680 1:144915963-144915985 GAGCTAGCAGCTATGGTGGGAGG - Intronic
915912514 1:159923649-159923671 CAGCCAGCAGCAAGGATGGGGGG + Exonic
915919466 1:159963407-159963429 CAGCAAGCATTGCTGTTGGGAGG + Intergenic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
919133616 1:193481531-193481553 CTGCAAGCAGCTCTGTTGGGAGG + Intergenic
920208915 1:204314029-204314051 GACACAGCAGCACTGGTGGGTGG + Intronic
920487274 1:206382783-206382805 GAGCTAGCAGCTATGGTGGGAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920673896 1:208025556-208025578 CTGCAAGCAGCACTGGAGTCAGG - Exonic
921738539 1:218656668-218656690 CAGCACTGAGCACTGGTGGCAGG + Intergenic
922085891 1:222346496-222346518 TAGGAAGGAGCACTGGGGGGGGG + Intergenic
922378562 1:224996655-224996677 AATCAAGCAGAACTGCTGGGTGG + Intronic
922450821 1:225735830-225735852 CAGCAAGCAGGATTGGAGGCTGG - Intergenic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922623159 1:227006992-227007014 CACCAAGCAGAATTGCTGGGGGG - Intronic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923233421 1:232009937-232009959 CAGGACTCACCACTGGTGGGTGG + Intronic
1062896382 10:1106339-1106361 TGGAGAGCAGCACTGGTGGGAGG - Intronic
1063423839 10:5936026-5936048 CAGCCAGCAGCACGGGACGGTGG + Intronic
1064441607 10:15358883-15358905 CATAAAGCAGCACAGTTGGGGGG + Intronic
1064505719 10:16027743-16027765 CAGGAAGCAGTACTGGGAGGGGG + Intergenic
1065921445 10:30396854-30396876 CAGCAGGGTGCAGTGGTGGGAGG - Intergenic
1067065631 10:43102555-43102577 CAGCAGGCGGAACTGGTGGAAGG - Exonic
1067295338 10:44972343-44972365 CAGCAGGCAGCGCAGGTGTGGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071225926 10:83527341-83527363 CAGTAAGCTGGACTGGTGGGTGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071753126 10:88503960-88503982 CAGAAAGCAGCCCTGGAGAGAGG + Intronic
1074465612 10:113679202-113679224 CAGCAAGCTGGGCTGCTGGGTGG + Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075220919 10:120583872-120583894 CAGGAAACACCACTGGTGGTAGG + Intronic
1075222114 10:120593931-120593953 CAGAAAGCAGCTCTAGTTGGGGG - Intergenic
1075280923 10:121137552-121137574 GATCAAGCAAGACTGGTGGGTGG - Intergenic
1075777024 10:124995758-124995780 CAGCAGGCAGGACTGGACGGTGG + Intronic
1076036454 10:127202382-127202404 CAGCACACAGCGCTGGTGGGTGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076631817 10:131856253-131856275 CAGCGAACAGCACAGGTGGGTGG + Intergenic
1076784491 10:132743129-132743151 CTGAGTGCAGCACTGGTGGGTGG - Intronic
1077152044 11:1076961-1076983 CAGCAAGGGGCACTGGCAGGAGG + Intergenic
1077251375 11:1562162-1562184 CCTCACCCAGCACTGGTGGGTGG - Intronic
1077251481 11:1562804-1562826 CAGCACCCTGCACTGCTGGGTGG - Intronic
1078434709 11:11314782-11314804 GAGAAAGCAGCGCTGCTGGGTGG + Intronic
1079427157 11:20354526-20354548 GAACAAGCAGCACTGCTTGGAGG - Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1080419444 11:32096923-32096945 CTGCCATCAGCACTGGTTGGGGG + Intronic
1080794625 11:35552105-35552127 CAACAAGCAGGACTGGAGAGTGG - Intergenic
1080820012 11:35796687-35796709 AATCCAGCAGCACTGGGGGGAGG + Intronic
1080893626 11:36430638-36430660 TAGTAATCAGCACTGGTGGTAGG - Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083296752 11:61719140-61719162 AAGGAAGCAGCATGGGTGGGAGG - Intronic
1083854012 11:65383260-65383282 GAGAAAGCAGCAGGGGTGGGTGG - Intronic
1083896677 11:65623619-65623641 CAGCAAGGAGTACTGGCAGGAGG - Exonic
1084531708 11:69731353-69731375 CAGCACCCAGCCCAGGTGGGGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1086401365 11:86463452-86463474 CAGGAAGATGCGCTGGTGGGGGG - Intronic
1087686675 11:101273149-101273171 CAGCAAGCAGAAGAGGTGGGGGG - Intergenic
1087915289 11:103803028-103803050 CAGCCAGCATCACTTCTGGGAGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088834523 11:113566754-113566776 CAGCAGGCAGCCTGGGTGGGAGG - Intergenic
1089933140 11:122334632-122334654 CAGCTAGAAGCAGTGGTAGGAGG - Intergenic
1089977040 11:122741815-122741837 CAGGAAGCAGAACCCGTGGGAGG - Intronic
1089985656 11:122810431-122810453 CAGCCAGCAACACTGGTGTATGG - Exonic
1090438056 11:126703170-126703192 CAGGAAGCAGCACGGCTGGAAGG - Intronic
1091619220 12:2073526-2073548 CAGGAGACAGCACAGGTGGGAGG + Intronic
1091806669 12:3361838-3361860 CAGCAGGCAGCAAGGGTGGCAGG - Intergenic
1093370697 12:18361785-18361807 CAACTAGAAGCACTGATGGGAGG - Intronic
1093660742 12:21753719-21753741 AAGCAAGCATCCCTGTTGGGAGG + Intronic
1094234227 12:28145324-28145346 CAGCAATGAGAACTGGTAGGAGG + Intronic
1094372387 12:29751951-29751973 CAGGAAGCAAGACTTGTGGGTGG - Intronic
1094486617 12:30930437-30930459 CAGCCAGCAGCAAGGGTGGCCGG + Intronic
1095509144 12:42930269-42930291 CAACCAGGAGCACAGGTGGGAGG + Intergenic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096997537 12:55848179-55848201 GTGCAAGCTGCAGTGGTGGGTGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100986039 12:100202613-100202635 CAGCAAGAGGCCCAGGTGGGTGG + Intronic
1102144129 12:110641756-110641778 CTGCAGGCGGCTCTGGTGGGCGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104350352 12:128039812-128039834 CAGCACGGAGGACTGGAGGGAGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104856645 12:131905327-131905349 CAGAAGGCACCCCTGGTGGGGGG - Intronic
1104904911 12:132207931-132207953 GCGCAAGCAGCACTGGTGTGTGG + Intronic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108150824 13:47531897-47531919 CAGCTAGCAGAACTGGGGAGGGG + Intergenic
1108320134 13:49281644-49281666 CAGCAACCAGTACTGGTCCGTGG - Intronic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112234779 13:97625406-97625428 TGGGAAGCAGCACTGGTGGATGG - Intergenic
1113120712 13:106921248-106921270 CAGCAAGCAGCCTGGATGGGAGG + Intergenic
1113619494 13:111703338-111703360 CACAAAGCTGCACTGGTGCGGGG + Intergenic
1113625023 13:111788599-111788621 CACAAAGCTGCACTGGTGCGGGG + Intergenic
1113641235 13:111958726-111958748 CAGCCAGCACCACTGGTTGAGGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1115961556 14:38839150-38839172 CAGCAAGCAGCAGGGAAGGGAGG - Intergenic
1118571494 14:67199789-67199811 CAGGAGGCAGCACTGGGGGTGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1121106757 14:91285309-91285331 TGTCAAGCAGCACTGGCGGGTGG - Intronic
1122249767 14:100429700-100429722 CAGCCAGCAGCATTGGTGTCAGG + Intronic
1122764065 14:104053097-104053119 CACCAAGCAGCTGTGGTGGCTGG + Intergenic
1122802258 14:104237622-104237644 CAGTTAGCAGCACTGGAAGGTGG - Intergenic
1122830745 14:104394456-104394478 CAGCAAGCAGGACTGTTGCGGGG - Intergenic
1122842650 14:104473876-104473898 GAACACGCAGCACAGGTGGGTGG - Intergenic
1123795168 15:23763662-23763684 CAGCCTGGAGCAGTGGTGGGAGG + Intergenic
1124072743 15:26411152-26411174 CAGGAAGCAGCTCTGGAGTGAGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1127209614 15:56759646-56759668 AATCAAGCAGCACTGCTGGCAGG + Intronic
1129378105 15:75146931-75146953 CTACAAAAAGCACTGGTGGGAGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129799742 15:78405346-78405368 CAGCAGGCTGCAGTGGTGGTGGG - Intergenic
1130131351 15:81145475-81145497 CAACAAGAAACACTTGTGGGTGG - Intronic
1131147619 15:90024421-90024443 GAGGAAGAAGCACAGGTGGGGGG - Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132405485 15:101539767-101539789 CAGCAAGCAGCCTTCGTGGAAGG + Intergenic
1132665844 16:1080997-1081019 CAGCAGACAGCACTGCTGAGAGG + Intergenic
1133077254 16:3289448-3289470 CAGGAAGCAGCACCTGAGGGTGG - Exonic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1134015151 16:10883058-10883080 CAGCAAGCAGGACTGGCTCGTGG + Intronic
1134103939 16:11471832-11471854 AAGCAGGCAGCACTGGTCAGTGG + Intronic
1134411156 16:14004059-14004081 CAGAATGGAGGACTGGTGGGAGG + Intergenic
1137365950 16:47859559-47859581 CATCATGCAGCCCTTGTGGGTGG - Intergenic
1137696464 16:50465263-50465285 CAGGAAGAAGCACTGGGGTGAGG - Intergenic
1139392111 16:66611654-66611676 TAGCAACCAGCACTGGGGTGGGG + Intronic
1140331660 16:74063312-74063334 CAGCAGGCATCAATGGTTGGAGG + Intergenic
1140419633 16:74807676-74807698 CAGCAGGGAGCACAGGAGGGTGG + Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1142044125 16:87914359-87914381 CCGCCAGCAGCACTGAGGGGTGG + Intronic
1142072805 16:88100508-88100530 CAGCAAGGGGCACTGGTTGGGGG - Intronic
1142202921 16:88769744-88769766 CAACATGTAGCTCTGGTGGGCGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142911705 17:3098650-3098672 CAGGAAGCAGAACTGGATGGAGG + Intergenic
1143513122 17:7406622-7406644 CAGCAAACAGCTCTGGCGGCTGG + Intronic
1143950467 17:10628731-10628753 CAGCCGGCAGAAGTGGTGGGTGG - Intronic
1144672410 17:17140390-17140412 TAGTATGCAGAACTGGTGGGGGG - Intronic
1144702130 17:17346884-17346906 CCGCAGGCTGCACTCGTGGGCGG + Exonic
1144864119 17:18323930-18323952 CAGCCAGCAGCTCTCCTGGGTGG + Intergenic
1144872115 17:18377969-18377991 CAGCAAGCACAGCTGGTGAGTGG + Exonic
1145011557 17:19371141-19371163 CAGGCAGCAGCACTGGAGGGAGG + Intronic
1145289481 17:21531934-21531956 CAGCGGGCAGCACTGTTGTGAGG + Exonic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150143658 17:62750560-62750582 CAGGAAGCAGCACTGGCGGTGGG + Intronic
1150582010 17:66482646-66482668 CAGCAAGCATCACTTGTATGTGG + Intronic
1152123976 17:78435351-78435373 CAGGAAGAAGCGGTGGTGGGTGG - Intronic
1152224705 17:79087351-79087373 CAGCAGTCAGCACAGGTGCGTGG + Intronic
1152447418 17:80353907-80353929 CAGCAAACAGCACAGGGCGGCGG - Intronic
1152579239 17:81158802-81158824 CAGCAGCCAGCACTGGCGGGAGG + Intronic
1152884374 17:82840757-82840779 AAGCAAGCAGTTTTGGTGGGGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154270231 18:12912131-12912153 CAGCAAGCTGTACTGGAGGACGG + Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157446009 18:47747497-47747519 CTGCGAGCAGAACTGGGGGGCGG + Intergenic
1157962201 18:52167776-52167798 CAGGAAGCAGCACAGTTTGGAGG + Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158527344 18:58227065-58227087 CAGCAAGGAGGACTGATGTGGGG - Intronic
1158587770 18:58756267-58756289 CAGCCAGCAGCACTGGCCTGGGG - Intergenic
1158674964 18:59510016-59510038 CACCAAGCTGCACTGGTGCTGGG + Intronic
1159020343 18:63138191-63138213 GAGCAAGCCGCACTGGCGGCTGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1160200374 18:76790924-76790946 TAGCAAGCAGGACTGGGCGGGGG + Intergenic
1160322682 18:77911242-77911264 CAGCAAGCAGCATTGCTGTGTGG - Intergenic
1160325172 18:77939908-77939930 CAGCAAGGAGCACTGGTTTGTGG - Intergenic
1160778764 19:868659-868681 CAGGGAGCAGCATTGCTGGGGGG - Intronic
1160866672 19:1259326-1259348 CAGGAAGCAGCCAGGGTGGGAGG + Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165061634 19:33207710-33207732 CAGCTGGCTGCACTGGTGGGCGG + Exonic
1165826009 19:38706185-38706207 CAGCAAACAGGGCAGGTGGGAGG - Intronic
1166343784 19:42153019-42153041 CAGCCAGCAGCTCTGGGGGTGGG - Intronic
1167066528 19:47190474-47190496 CAGTTAGCAGCAGTGGAGGGGGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925260902 2:2527684-2527706 CAGCAGGCAGGGCTGGTGGAGGG - Intergenic
925988551 2:9235358-9235380 CAGGACCCAGCCCTGGTGGGTGG + Intronic
927108135 2:19845049-19845071 CAGAAGGCAGCCCTGGTGTGAGG - Intergenic
928202051 2:29253737-29253759 CAGCAAGCAGCCTGGGTGTGGGG + Intronic
928405084 2:31008656-31008678 CAGCCAGCATGAGTGGTGGGAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929158704 2:38810930-38810952 CACCAAGGAGGTCTGGTGGGTGG + Intronic
929213932 2:39390585-39390607 CAGCAAGAGGCACTGGAGGAAGG + Intronic
929455818 2:42064284-42064306 CAGCAGGCTGGACTGGGGGGTGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929569002 2:43008110-43008132 CGGCAACCAGCACTAGTGGCAGG - Intergenic
929575706 2:43050413-43050435 TTGCAGGCAGCACTGATGGGGGG + Intergenic
929619433 2:43339795-43339817 CTGCAAGCAGCAAGGGTGGCAGG + Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
931651862 2:64475859-64475881 TAGCAAGCAGCAGTGGGGTGTGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933081175 2:77988528-77988550 CAACAAGCAGCAATGGTAGCTGG + Intergenic
933779366 2:85790861-85790883 CAGGAAGCAGCATAGGAGGGAGG - Intergenic
934111493 2:88747534-88747556 CAGCCAGCAGAACTGGGGAGGGG - Intronic
935126822 2:100231548-100231570 CAGCAAGGAGGGCAGGTGGGAGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936080805 2:109431249-109431271 CAGCAGCCTGCACTGGTGTGAGG + Intronic
936573548 2:113635462-113635484 CAGCAGGCAACAGTGGAGGGAGG - Intronic
938262608 2:129906332-129906354 CAGCAAACAGCACAGGAGAGCGG - Intergenic
938336175 2:130500615-130500637 CACCAAGTAGCAGTGGTGTGAGG + Exonic
938353647 2:130620050-130620072 CACCAAGTAGCAGTGGTGTGAGG - Exonic
938542964 2:132301183-132301205 GATCAAGCAGCTGTGGTGGGAGG - Intergenic
938663567 2:133511282-133511304 CAGCAAGTAGCACCTGTGGGTGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
942545912 2:177063467-177063489 CTGCCAGCAGCACTGTTGGCTGG + Intergenic
947581655 2:231323384-231323406 CAGCAAGCTTCATTGCTGGGAGG + Intronic
948112603 2:235468769-235468791 CAGTGAGTAGAACTGGTGGGTGG + Intergenic
948581066 2:238987349-238987371 CCGCAAGCATCCCTGGTGAGGGG + Intergenic
1170893568 20:20395529-20395551 CAGCAAGGTGCCCTGCTGGGAGG + Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171303502 20:24084678-24084700 CAGCAAACACCCCTGCTGGGTGG + Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171871842 20:30534012-30534034 GATCAAGCAGCTGTGGTGGGAGG - Intergenic
1172441144 20:34967562-34967584 GACCAAGCAGCAGTGGAGGGCGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1172972121 20:38881268-38881290 CAGGGAGGAGCAGTGGTGGGTGG + Intronic
1173061001 20:39661092-39661114 CAGCAAGCAGGACTGGGGAGTGG + Intergenic
1173177214 20:40773463-40773485 GAGTTTGCAGCACTGGTGGGAGG + Intergenic
1174264582 20:49322141-49322163 CAGCTAGAAGCACTGGGGGATGG + Intergenic
1175296992 20:57915308-57915330 CAGCAGGCAGATTTGGTGGGAGG + Intergenic
1175459114 20:59137728-59137750 TAGCAACCAGCACTGGGTGGAGG + Intergenic
1176089730 20:63313483-63313505 CAGGCAGCAGCCCTGGTTGGGGG + Intronic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178041737 21:28647187-28647209 CAGAAAGTAGCACTGGGGGCCGG + Intergenic
1178676596 21:34636400-34636422 CTGCCAGCAGCACTGGGGGCTGG + Intergenic
1179455943 21:41500065-41500087 CAGCAGGCAGCACTGGGCAGCGG + Intronic
1179481255 21:41680065-41680087 AAGCAAGCAGCTGAGGTGGGTGG - Intergenic
1179778929 21:43687182-43687204 CTGCAGGGAGCACTGGGGGGCGG + Intronic
1180839421 22:18952217-18952239 CAGCAACCTGCAGGGGTGGGTGG + Intergenic
1180988397 22:19918920-19918942 CACCAGGCGGCACTGCTGGGAGG - Exonic
1181062479 22:20288267-20288289 CAGCAACCTGCAGGGGTGGGTGG - Intergenic
1181130242 22:20726930-20726952 CAGCTAGCTGCACTGCTGTGTGG + Intronic
1183582922 22:38736255-38736277 CAGTAAGCAGGGCTAGTGGGCGG + Exonic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184306757 22:43608284-43608306 TAGCAAGCAGCCTTGGTGGATGG - Intronic
1184428494 22:44427220-44427242 CAGGAAGCACCACGGGTGTGTGG - Intergenic
1184918289 22:47588337-47588359 AAGGAAGCAGCAATGGTGGCTGG - Intergenic
1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG + Intronic
949437248 3:4042916-4042938 GAATAAGCAGCACTGGTGGAGGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950127704 3:10520296-10520318 GAGCAAGCAGCAGGGGAGGGGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
952772473 3:37014721-37014743 CAGCAATGAGCACATGTGGGAGG - Intronic
952808694 3:37381870-37381892 TAGGAAGCATCCCTGGTGGGAGG - Intergenic
953369159 3:42372657-42372679 CAGCCATGACCACTGGTGGGTGG - Intergenic
953766505 3:45747262-45747284 CACCAACAAGCACTGGTGGAGGG + Intergenic
953828164 3:46272154-46272176 CAGCCAGCTGCACTGGGGGTAGG + Intergenic
954671555 3:52293897-52293919 AAGGAAACAGCACTGGGGGGTGG - Intergenic
954731819 3:52670065-52670087 CAGCAAGGAGCACTGGACTGTGG - Intronic
956100130 3:65759568-65759590 CAGCCAGCAGCAGTGGGTGGGGG + Intronic
956152601 3:66259199-66259221 GAGCAAGCAACACTGGAAGGCGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
959137177 3:102437824-102437846 CACCAAGGAGCAGTTGTGGGAGG + Intronic
959389773 3:105759541-105759563 GACCAAGGAGCACTGGAGGGAGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961360130 3:126361786-126361808 CAACAAACAGAACTGGTAGGTGG - Intergenic
962154754 3:132934494-132934516 GTGCAAGCAGCAGTGGTAGGTGG - Intergenic
962398460 3:135037617-135037639 CAGAAAGCATCACTGATGGGCGG - Intronic
965310799 3:167125787-167125809 CAGAAAGCAGCAGTGCTGGTAGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966802819 3:183780227-183780249 CAGCAAGCACCACAGGAAGGAGG + Intronic
967214874 3:187201305-187201327 CAGCAAGCTGCACTTTTGAGGGG + Exonic
968545479 4:1195590-1195612 CAGCAAGCAGGGCTGGAGGGTGG + Intronic
968552824 4:1232791-1232813 CAGCGAGCATCTGTGGTGGGGGG + Intronic
968938130 4:3624288-3624310 CAGCAGGCAGGATGGGTGGGTGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969244815 4:5925261-5925283 CAGCAAGGAGGTGTGGTGGGGGG + Intronic
969285822 4:6201074-6201096 CAGCAAGCGGCAGAGCTGGGCGG + Intergenic
969430237 4:7149724-7149746 GAGCAGGCAGCACGGCTGGGAGG - Intergenic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
971233985 4:24825048-24825070 CAGCCAGCAGCACGGATAGGTGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
974018448 4:56671547-56671569 CAACAAGCAGCATGGGTGGTTGG - Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975615782 4:76245563-76245585 CAGCAAGCTGCACTGGGGGCTGG - Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978371505 4:108034018-108034040 CTTCAGGCAGCACAGGTGGGTGG + Intronic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979469621 4:121079264-121079286 AAGCTAGCAGCAGTGTTGGGAGG + Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
981532279 4:145764198-145764220 GAGAAAGCAGCACAGGTAGGAGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
986483595 5:8213526-8213548 CGGAAAGCAGCACATGTGGGAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993938870 5:94034770-94034792 CACCAATCAGCACTGGTCTGTGG - Intronic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
997028151 5:130090521-130090543 AAGCAAGCAACAGTGGTGAGAGG - Intronic
997443499 5:133925377-133925399 GAGGCAGAAGCACTGGTGGGTGG - Intergenic
998055041 5:139067487-139067509 CATCAAGCAGAAGTGGTTGGTGG + Intronic
1000536562 5:162485597-162485619 CAGCCAGCAGCACTAATGGAGGG + Intergenic
1001025638 5:168222240-168222262 CAGCAGGCAGCACTGGGAGGTGG - Intronic
1001857492 5:175025576-175025598 AAGCAACCAGCACTGGGAGGTGG - Intergenic
1002049981 5:176565230-176565252 TACTAAGCAGCAGTGGTGGGTGG + Intronic
1002098276 5:176844801-176844823 CTGCAAGCAGTGCTGGAGGGTGG - Intronic
1003538748 6:6999892-6999914 CACTAAGCAGCACTGGTGCTGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004270702 6:14192723-14192745 CAGAAAGGAACACTGGTGGGGGG + Intergenic
1004958898 6:20762959-20762981 CATCAAGCAGCACAGTTGGCTGG - Intronic
1005044635 6:21629888-21629910 CAGCAAGAAGCGATGGTGGCCGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006506036 6:34489419-34489441 CATCCAGCAGCAGTGCTGGGTGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1012666871 6:101982158-101982180 CAGCAAATAGAATTGGTGGGTGG + Intronic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015206182 6:130642359-130642381 CAGAAAGAAGCAGTGTTGGGGGG - Intergenic
1015629774 6:135220226-135220248 CAGCAAGCATCACTGGACTGTGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016767588 6:147812099-147812121 CAGGAAGCAGCACTGATGAATGG + Intergenic
1018856061 6:167676225-167676247 CAGCAAACAGTGCTGGTGAGTGG - Intergenic
1019211351 6:170407929-170407951 CAACAGGGAGGACTGGTGGGTGG - Intergenic
1019761913 7:2819162-2819184 CTGCAAGCAAGACTGGAGGGAGG + Intronic
1020431681 7:8122096-8122118 CAGCATGCTGCACAGGTGAGTGG + Intronic
1020594635 7:10190540-10190562 CAGCAGGCAGCACTCTTTGGTGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021122904 7:16816876-16816898 CAGCCTGCAGCACTGTTGGGTGG + Intronic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021919648 7:25471949-25471971 CAGCGAGCAGAGCAGGTGGGAGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022297713 7:29071781-29071803 CAGGAAGCAGAACTGGTTTGAGG - Exonic
1022388667 7:29924889-29924911 CTGCATGAAGCAGTGGTGGGCGG - Intronic
1023362790 7:39432940-39432962 CTGCAAGCAGCTCTGGAGGGGGG - Intronic
1023861843 7:44221364-44221386 CACCCAGCAGCTCTGGTGAGGGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024339739 7:48245084-48245106 CACCAAGAAGCATTGGTGGGAGG - Intronic
1027788976 7:82615560-82615582 CAGGAAGCATGGCTGGTGGGGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032415501 7:131732553-131732575 CAGCAAGAGGCCCTGGTGGCTGG - Intergenic
1032558469 7:132862508-132862530 CAGCAAGTCACACTGGTGGAGGG + Intronic
1032708543 7:134442969-134442991 CATCAAGCAGCACATGTGTGAGG + Intronic
1033301340 7:140188832-140188854 CCGCACGCAGCACTTTTGGGAGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034415179 7:150960874-150960896 CAGAAATCAGCACGGGTTGGGGG - Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035573148 8:687582-687604 CAGGGAGCAGGACTGGAGGGAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039704289 8:39991050-39991072 CAAGAAGCAGGACTGGAGGGAGG + Intronic
1040082399 8:43300523-43300545 CAGCAAGCAAAAGTGGTGTGAGG - Intergenic
1040434871 8:47380483-47380505 CACCAAGCAGGAGTGGAGGGTGG - Intronic
1041172739 8:55161541-55161563 CAGACAGCAGCAGTAGTGGGAGG - Exonic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041833676 8:62185927-62185949 CAGAAATCAGCTCTGGTTGGTGG - Intergenic
1042337097 8:67640340-67640362 CACCAACAAGCACTGGAGGGAGG - Intronic
1042361280 8:67885861-67885883 CAGCAAGCAGCAGTGGAGTTTGG - Intergenic
1043616290 8:82129848-82129870 CAGCCAGCAGAACTGGGGAGGGG + Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046663001 8:116969102-116969124 CAGCAAGTAACACTGGAGGTGGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048981336 8:139704466-139704488 GCGCAAGCAGCCCTGGCGGGTGG + Intergenic
1049004538 8:139846311-139846333 CAGCAGGCAGCACTGCGGGAGGG + Intronic
1049024337 8:139978576-139978598 CAACAAGCAGCAATGCTCGGTGG - Intronic
1049480379 8:142819750-142819772 CAGCAGGCAGCAAGTGTGGGTGG - Intergenic
1050388287 9:5112220-5112242 CAGCACGCAGGCCTGGTTGGAGG + Intronic
1050413110 9:5386720-5386742 CAGCAGGTAGCAGTGATGGGAGG - Intronic
1050536087 9:6631957-6631979 CAGGAAGCTGCAGTAGTGGGAGG + Intronic
1050596779 9:7211990-7212012 CTGGCAGCAGAACTGGTGGGAGG + Intergenic
1051058456 9:13016624-13016646 CAGAAAGCAGCCCTGGAAGGTGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053346377 9:37381509-37381531 CAGCAGGCCCCAGTGGTGGGAGG - Intergenic
1054453041 9:65413418-65413440 CAGCAGGCAGGATGGGTGGGTGG - Intergenic
1054764957 9:69035736-69035758 CAGCACCCAGCGCTGGAGGGCGG + Exonic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1059343257 9:113611645-113611667 GAGCAAGCAGGACTGGCAGGTGG + Intergenic
1061684201 9:132261147-132261169 CTGCCAGAAGCACTGGTGGAGGG - Intergenic
1061723378 9:132567557-132567579 CAGCATGCAGCGATGGTGGGTGG - Intronic
1061761615 9:132855581-132855603 CAACAACCAGCACTGGGGGCAGG - Intronic
1062448360 9:136605084-136605106 CAGCAAGCAGCGCTGGGGCAGGG + Intergenic
1185762901 X:2701789-2701811 CAGCATGCAGAACAGGTGGGAGG + Intronic
1185982414 X:4794240-4794262 CAGCAATGGGCACAGGTGGGTGG - Intergenic
1186220268 X:7342561-7342583 GAGGAAGCAGCTCTGGTGGCTGG - Intronic
1189847747 X:45152022-45152044 CCTCAAGGAGCACTGGTGGCAGG - Intronic
1189948372 X:46203568-46203590 CAGCATGCAGGACTTTTGGGAGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190960358 X:55240879-55240901 CAGCCTGCTGCACTGGTCGGTGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192582655 X:72298034-72298056 CATCAAGCAGCAATGCTGGTGGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193211200 X:78809126-78809148 CTGCAAGCAGAAGTGGTGGTGGG - Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198089513 X:133313581-133313603 GAGCAAACAGGACTGGAGGGGGG + Intronic
1199657483 X:150010958-150010980 CAGCAGGCACCACTGGGGTGGGG + Intergenic
1199708593 X:150451911-150451933 AAGCCTGCAGCACTGGAGGGAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic