ID: 1133255777

View in Genome Browser
Species Human (GRCh38)
Location 16:4514763-4514785
Sequence AGGGAGAAGCCGGATGTGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133255777_1133255786 25 Left 1133255777 16:4514763-4514785 CCTTCCACATCCGGCTTCTCCCT 0: 1
1: 0
2: 3
3: 17
4: 350
Right 1133255786 16:4514811-4514833 CCGACCACCCCTCCATTCCTCGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133255777 Original CRISPR AGGGAGAAGCCGGATGTGGA AGG (reversed) Exonic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900693533 1:3995947-3995969 TGGGGGAAGCAGGCTGTGGAGGG + Intergenic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
902823427 1:18956829-18956851 CGGGAGAACCCGGAGGTGGGCGG - Intergenic
903186849 1:21633898-21633920 AGTGAGAAGAGGGCTGTGGAGGG + Intronic
903539231 1:24087410-24087432 AGGGAGATGCGGGACGTGGGAGG - Intronic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
905941927 1:41870182-41870204 AGGGATCAGCCAGATGAGGATGG - Intronic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906411657 1:45583970-45583992 GGGGAGGATCCGGAAGTGGATGG + Intronic
906436505 1:45801436-45801458 AGGTAGAGGCCAGATTTGGATGG + Intronic
907438455 1:54464054-54464076 TGGGAGAAGACGTAGGTGGAGGG - Intergenic
907873692 1:58465964-58465986 AAGCAGAAGCCAGATGTGCAGGG + Intronic
908098261 1:60763324-60763346 AGGGAGGAGACGGAAGGGGAGGG - Intergenic
908356446 1:63328341-63328363 AGGAAGAAGCGGGATGAGAAAGG + Intergenic
911452594 1:98083884-98083906 AGGGGGAAGACGGAAGAGGAAGG - Intergenic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912379243 1:109238200-109238222 AGGGAGCAGCCTAATTTGGAAGG - Intergenic
915662697 1:157417059-157417081 AGGGATAAAAAGGATGTGGAGGG - Intergenic
915953048 1:160202852-160202874 AGCGATAAGCAGGATGGGGAGGG + Intergenic
918106438 1:181419338-181419360 AGGCAGAGGCCTGATGTGGGAGG - Intronic
918343347 1:183585267-183585289 AGGGTGAGGCCGGGCGTGGATGG - Intronic
918925689 1:190782611-190782633 GGGGAGAAGATGGATGAGGAAGG - Intergenic
919765674 1:201125754-201125776 AAGAAGTAGCCTGATGTGGAGGG + Intronic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920266311 1:204726048-204726070 TGGGAGAAGAGGGCTGTGGAGGG + Intergenic
920455562 1:206098406-206098428 GGGTAGTAGACGGATGTGGATGG - Intronic
920836269 1:209513899-209513921 AGGGCGAAGGCAGATGTGGCAGG - Intergenic
920996192 1:210994717-210994739 AGGTAGAAGCCAGATTTTGAAGG - Intronic
921485267 1:215708076-215708098 AGTGGGAAGAAGGATGTGGAAGG + Intronic
922304160 1:224329856-224329878 AGGGAGAAGCCGGGGATGGTGGG - Intronic
922341053 1:224655396-224655418 AGGGTGAAGAGGGATCTGGAAGG + Intronic
922572185 1:226640695-226640717 AAGGAGAAGGCGGATGGGTACGG + Intronic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
923211927 1:231811263-231811285 AGGGAGAAGGGGGTTGGGGAGGG + Intronic
923482474 1:234397506-234397528 AGGGGGAAGGGGGATGGGGAAGG + Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
1062829154 10:593767-593789 AGAGGGGAGACGGATGTGGATGG - Intronic
1062941707 10:1426803-1426825 AGGGAGAAGCAGGGTATAGAAGG - Intronic
1063966976 10:11353801-11353823 AGGGAGAAGCGTGAAATGGAAGG - Intergenic
1065359090 10:24872267-24872289 AGGGAGAGGCTGGGTGTGCAGGG + Intronic
1066429156 10:35336269-35336291 AGGCAGAGGCCGGGTGGGGAAGG + Intronic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1069307484 10:66988946-66988968 AGGAAGCACCCGGATGTGTAAGG - Intronic
1071329581 10:84546425-84546447 AGGGAGATGGCCGATGGGGAGGG + Intergenic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1073476242 10:103755980-103756002 AGGGAGGAGGCAAATGTGGAGGG - Intronic
1074081264 10:110169836-110169858 AGGGAGAAGGGAGATGAGGAGGG - Intergenic
1075247256 10:120833771-120833793 AGGGAGGAGCAGGATGTTCAGGG + Intergenic
1076344952 10:129773585-129773607 AGGGTGTAGCCTGATGTGGGAGG + Intergenic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076778051 10:132709181-132709203 AGGGAGAGGCCCGAGGGGGAGGG - Intronic
1077606214 11:3614637-3614659 AGGGAGAAGCTGGGTGAGGTGGG - Intergenic
1078153461 11:8778408-8778430 AGGGGGAGGGTGGATGTGGACGG - Intronic
1079743058 11:24087697-24087719 AGTGAGAAGCAGCATATGGATGG + Intergenic
1081994520 11:47355047-47355069 GAGGCGAAGCGGGATGTGGAGGG + Exonic
1082125154 11:48423784-48423806 AGGAATGAGCTGGATGTGGAAGG - Intergenic
1082250881 11:49978858-49978880 AGGAATGAGCTGGATGTGGAAGG + Intergenic
1082558821 11:54595052-54595074 AGGAATGAGCTGGATGTGGAAGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083995310 11:66268826-66268848 GGGCAGAACCCGGATGTGGGGGG - Intronic
1084006491 11:66326190-66326212 AGGGAGACACCGGTGGTGGAGGG - Intergenic
1084881177 11:72172678-72172700 AGGGTGAAGTCAGCTGTGGAAGG + Intergenic
1086924931 11:92630069-92630091 AGGTAGAAGCCAGATGGAGAAGG - Intronic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087837591 11:102890449-102890471 AGGGTGTAGCCGGGTGTGGTGGG - Intergenic
1088543545 11:110937516-110937538 AGAGAGAACCCAGATCTGGATGG - Intergenic
1089214452 11:116827352-116827374 AGGGAGAAGCCAGTGGTAGATGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1095785242 12:46102220-46102242 TGGGGGAAGCCAGAAGTGGATGG - Intergenic
1096466276 12:51848907-51848929 GGGAAGAAGCCGGGGGTGGAGGG - Intergenic
1096553484 12:52389508-52389530 AGGAAGGAGGCGGGTGTGGATGG - Intergenic
1097144529 12:56930804-56930826 AGGGAGAAGTATGATGGGGAAGG - Intronic
1098450208 12:70610406-70610428 GGGGAGACGCTGGGTGTGGAGGG - Intronic
1100467771 12:94862657-94862679 AGGGACTAGCTGGATGTGTACGG + Intergenic
1101365217 12:104064500-104064522 AGGGAGCAGCCGGTTGAGGCGGG + Exonic
1103064893 12:117889282-117889304 GGCGAGCAGCCGGGTGTGGAGGG + Intronic
1103938356 12:124488609-124488631 AGGGAGAAGACGGGGCTGGAGGG + Intronic
1104572416 12:129936476-129936498 AGGGAGAAGACTGAGGTAGATGG + Intergenic
1104857959 12:131910596-131910618 GGGGTGTAGCCGGAAGTGGAGGG + Intronic
1106174803 13:27321034-27321056 TGGGAGAGGGCGGCTGTGGATGG + Intergenic
1106335227 13:28777774-28777796 AGGGAGAAGGCAGAAGTGGGCGG + Intergenic
1106391420 13:29338837-29338859 AGGGAGAAGGCAGAAGTGGGTGG + Intronic
1109115073 13:58371715-58371737 AGTGAGAAGCTGGAGGTGGCTGG + Intergenic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1112337835 13:98529147-98529169 AGGGAGACGGCGGGTATGGAAGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113609454 13:111632957-111632979 AGGGAGGAACCGGATCTGAAGGG + Intronic
1113793407 13:113042635-113042657 CGTGAGAAGCCAGATGTGGGAGG + Intronic
1114237442 14:20835166-20835188 AGGAAGAAGCCAGAAGTGGTTGG + Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120868778 14:89318774-89318796 AGGGAGAACCCGGATTTGAGTGG - Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1121073096 14:91043020-91043042 TGGGAGAAGCCGGATTGGAATGG - Intronic
1121777056 14:96598081-96598103 AGGGAGAAGGGGGAAGAGGAGGG - Intergenic
1121908079 14:97765727-97765749 AGGGAGGAGAGGGAAGTGGAAGG - Intergenic
1123054160 14:105561334-105561356 AGGGACAAGCCGGGGCTGGACGG - Intergenic
1123078743 14:105681751-105681773 AGGGACAAGCCGGGGCTGGACGG - Intergenic
1202862462 14_GL000225v1_random:90944-90966 AGGGAGAAGCCGGCCTGGGAGGG + Intergenic
1123415044 15:20089173-20089195 AGGGAGAAGTGGGGTTTGGATGG + Intergenic
1123524386 15:21096287-21096309 AGGGAGAAGTGGGGTTTGGATGG + Intergenic
1124991588 15:34679626-34679648 AGGGAGAATCCTGGTTTGGATGG + Intergenic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1129615888 15:77098465-77098487 AGGGAGAAGTCTGATGGGGTTGG + Intergenic
1129853758 15:78810552-78810574 AGGGAGAGGCAGGAAGTGCAAGG + Intronic
1129953774 15:79614824-79614846 AGAGAGAAGGCGGCTGAGGATGG + Intergenic
1130312122 15:82765018-82765040 AGGGAGGAGCCTAATGGGGAGGG - Intronic
1130821775 15:87503381-87503403 AGGAACAAGGTGGATGTGGAGGG + Intergenic
1131292447 15:91118490-91118512 AGGAAGAAGCCTGATGTGTAGGG + Intronic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134122780 16:11596649-11596671 GGGGAGAGGGAGGATGTGGAGGG + Intronic
1136625332 16:31458776-31458798 AGGGAGAATCCGGACGGGGCGGG - Intronic
1137433139 16:48434508-48434530 GGGGAGGAGCCAGATGTGGCTGG - Intronic
1138520300 16:57567283-57567305 AGGGAGATGGGAGATGTGGAGGG + Intronic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139604070 16:68005447-68005469 AGGCAGCAGCTGGAAGTGGAGGG - Intronic
1140663400 16:77208921-77208943 GGGGAGAAGCTGGATCAGGATGG + Intronic
1141385538 16:83619650-83619672 GGGGAGAAGCCAGGTGTAGATGG - Intronic
1141477508 16:84283700-84283722 GGGGTGAACCCGGATGTGGGTGG + Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141905906 16:87027089-87027111 TGGGACAAGCCCGAGGTGGAAGG + Intergenic
1142808779 17:2385670-2385692 CGGGAGAAGCAGGGTGTTGAGGG + Exonic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143779176 17:9220508-9220530 AGAGCCAAGCAGGATGTGGAGGG - Intronic
1143875657 17:9988785-9988807 AAGGGGATGCCAGATGTGGAGGG - Intronic
1143887534 17:10076198-10076220 AGGGAGAAGTGGGAGGGGGAGGG + Intronic
1144249823 17:13404656-13404678 AGGCAGGAGCCAGAAGTGGAAGG + Intergenic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146552368 17:33792346-33792368 AAAGAGAAGCCGGGAGTGGAGGG - Intronic
1146846920 17:36187965-36187987 AGAGAGAAGCAGGACTTGGAGGG - Intronic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1147363470 17:39945485-39945507 AGGAAGAAGCTGGTGGTGGACGG - Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147634822 17:41957374-41957396 AGGGAGAACCCGATTGTGAACGG - Intronic
1150309445 17:64115820-64115842 AGTAAGAAGCCTGAGGTGGATGG + Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1152879863 17:82808627-82808649 AGAGAGAACCCTGCTGTGGAGGG + Intronic
1153449923 18:5215743-5215765 AGGAAGAATCCAGATGTGGGAGG - Intergenic
1154055100 18:11005192-11005214 GGGAAGAAGCCTGATGTGAAGGG - Intronic
1154489358 18:14907762-14907784 AGGGGGAAGCCAGATCTGGAAGG - Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1157431153 18:47627582-47627604 AGGGAGAAGTCGGATCAGGAGGG - Intergenic
1160034342 18:75286917-75286939 AAGGAGAAGCCGCCTGTGGCTGG + Exonic
1160079505 18:75711726-75711748 AGGGAAAAGCCATATGTAGAGGG - Intergenic
1160535527 18:79589557-79589579 AGGGAGAAGGGAGATGGGGAAGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160726725 19:620829-620851 AGGGAGAAGCAGGACGGGCAGGG + Intronic
1161057550 19:2198285-2198307 AGGGAGGAGACGGGTGTGGGGGG + Intronic
1161296729 19:3523918-3523940 GGGGAGAAGGCGGCTGTGGTGGG - Intronic
1161354203 19:3810171-3810193 GGGGGGAGGCCGGGTGTGGATGG + Intronic
1161847308 19:6719119-6719141 AGGGAGAAGACAGAAGGGGAGGG + Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162494789 19:11017661-11017683 AGGGAGAAGCCGGAGGTGTGCGG - Intronic
1162916477 19:13877062-13877084 AGGGAGGAGCAGGCTGTGGGAGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163595994 19:18221207-18221229 AAGGAGAGGCCGGATCCGGAGGG + Intronic
1164870569 19:31640081-31640103 AGGGAGAAGACGGATCTGGCTGG + Intergenic
1165081624 19:33310240-33310262 GGGAAGAAGCAGGATGTGAATGG - Intergenic
1165082928 19:33320605-33320627 AAGTAGAAGCCAGATGTGGAAGG + Intergenic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166415982 19:42595290-42595312 AGGGAAGAGCCAGATGGGGATGG - Intronic
1166631354 19:44410457-44410479 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1167357337 19:49012017-49012039 AGGAAGCAGGGGGATGTGGAGGG + Intronic
1167426573 19:49432716-49432738 AGGGAGGAGCCGGTGGTGCACGG - Intronic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1167698281 19:51027398-51027420 AGGGAGAAGCGGGCAGGGGAAGG - Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
1168517112 19:57017662-57017684 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1168517152 19:57017763-57017785 AGGGAGATGGGGGATGAGGAGGG - Intergenic
1202648894 1_KI270706v1_random:163157-163179 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1202649372 1_KI270706v1_random:166431-166453 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925342878 2:3149003-3149025 AGGGAGCAGCCGGAGATGGATGG + Intergenic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
926236990 2:11053102-11053124 AGGAAGAAGGGAGATGTGGAGGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927862851 2:26570925-26570947 AGGGAGAGGTCAGATGTGGAGGG + Intronic
927886703 2:26723272-26723294 AGGGAGATGCGGGGTGGGGATGG - Intronic
928077545 2:28278936-28278958 AGGCGGAAGCCAGATGTGAATGG + Intronic
930000780 2:46860241-46860263 AGGGAGAAGGCGGAACTGAAAGG + Intergenic
933473131 2:82753017-82753039 ATGGAGAAGAGGGAAGTGGAGGG + Intergenic
933723051 2:85410347-85410369 AGTGAGAAGCCGGGTGGGGCAGG - Exonic
934523343 2:95033433-95033455 AGGGAGAAGCCGGCTGGGAGTGG + Intronic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936078822 2:109418552-109418574 AAGGAGGACCGGGATGTGGAGGG - Intronic
937905341 2:127050255-127050277 AGGAAAAAGCCCGACGTGGAGGG + Intronic
938541628 2:132288041-132288063 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
939582258 2:143964646-143964668 AAGGAGAAGATGGAAGTGGAGGG + Intronic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940101803 2:150048640-150048662 AGGGAGATGGGAGATGTGGAAGG + Intergenic
940763524 2:157764591-157764613 AGGGCGAAGGCGGATGGGGTTGG - Intronic
941347286 2:164386173-164386195 AGAGAGACGACTGATGTGGATGG + Intergenic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
948361308 2:237422393-237422415 AGGGAGAAGCCTTATGGAGATGG - Intronic
948426931 2:237894453-237894475 AGGGCGAGGCTGGCTGTGGAAGG + Intronic
1170799963 20:19582890-19582912 AAGGTGAAGTCGGATGGGGAGGG + Intronic
1171378613 20:24714667-24714689 AGGGAGGATCCGGGGGTGGATGG + Intergenic
1172617292 20:36297842-36297864 AGGGGGAGGCCGGAAGAGGATGG - Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1173876904 20:46378612-46378634 AGGGAGAAGCTGGTTCTGCAAGG + Intronic
1175141450 20:56863453-56863475 AGGGAGAAGCCAGAAGTAAAAGG + Intergenic
1175834513 20:61984970-61984992 AGGGGGAGGACGGATGTGGTGGG + Intronic
1175957326 20:62618093-62618115 GGAGAGAAGCCGGAGGTGGGTGG + Intergenic
1176218163 20:63957882-63957904 CTGGAGGAGCCGGAGGTGGAGGG - Exonic
1176602449 21:8806115-8806137 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1176602928 21:8809384-8809406 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1176611894 21:8991218-8991240 AGGGAGAAGCTGGCTGAGGCAGG - Intergenic
1178189829 21:30267583-30267605 AGGGAGAAGCCGTCTATGAATGG - Intergenic
1179549736 21:42136359-42136381 AGGGGGAAGGTGGATGGGGAGGG - Intronic
1179970619 21:44835276-44835298 AGGGAGTGTCCGGATGTGGCCGG - Intergenic
1180344734 22:11697668-11697690 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180345214 22:11700941-11700963 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180352557 22:11816662-11816684 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1180352994 22:11819182-11819204 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180385698 22:12175695-12175717 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1180870549 22:19144379-19144401 GTGGAGGAGCCGGGTGTGGACGG - Intronic
1180942686 22:19669807-19669829 AGGGACAACCCAGATGAGGAAGG + Intergenic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182545064 22:31070375-31070397 AGGGAGAAGTGGGGTTTGGATGG - Intronic
1182663766 22:31943370-31943392 AGGGATAAGCTGGATCTTGAAGG - Intronic
1183240534 22:36654641-36654663 AGTCAGAAGCCGGATTTGGCAGG + Intronic
1183864420 22:40692918-40692940 TGGGAAGAGCTGGATGTGGAGGG + Intergenic
1184100141 22:42337775-42337797 AGGCAGAGCCCAGATGTGGATGG - Intronic
1184285227 22:43466862-43466884 AGGGACAATCAGGAGGTGGAGGG - Intronic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949251103 3:1984947-1984969 GAGAAGAATCCGGATGTGGAGGG - Intergenic
952795865 3:37238634-37238656 AGGGACAAGCCTGATGGTGATGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
954007713 3:47605473-47605495 TGGAAGAAGCCAGATGTGGCCGG + Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954862417 3:53702019-53702041 AGGGAGAACTGGGTTGTGGAGGG + Intronic
955876533 3:63495786-63495808 AGGGAGATGTGGGGTGTGGAAGG + Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956312904 3:67901635-67901657 AGGGAGACCCCTGATGTGCATGG + Intergenic
959239768 3:103775509-103775531 AGGAAGAAGGAGGATGTAGAAGG - Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
961221922 3:125207930-125207952 AAGGAGATGCCATATGTGGAAGG - Intronic
961567251 3:127772633-127772655 AGGGAGAGGCTGGATTTGCAGGG + Intronic
961660270 3:128464936-128464958 AGGGAGAAGGGGGAAGGGGAGGG - Intronic
964443895 3:156740246-156740268 AGGCAGAAGCCGGCTTTGGTGGG + Intergenic
964504504 3:157383990-157384012 AGGTAAAAGCTGGATGTGGGGGG + Intronic
964756117 3:160092155-160092177 AGGGATAGGCCAGGTGTGGAAGG - Intergenic
967585054 3:191203200-191203222 ATGGAGCAGCCTTATGTGGAAGG - Intronic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
969869579 4:10096228-10096250 AGCTAGAAGCCGGCTGTGGGTGG - Intronic
969951486 4:10841162-10841184 TGGGAGAAGCAGGATAGGGAAGG + Intergenic
970228826 4:13887919-13887941 AGGGAGAAGGAGGAAATGGATGG - Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
972790264 4:42364981-42365003 GGGGAGAAGAGGGAAGTGGAGGG - Intergenic
973375099 4:49280976-49280998 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973375998 4:49286998-49287020 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973376923 4:49293161-49293183 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973377843 4:49299316-49299338 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973378787 4:49305596-49305618 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
973379431 4:49310058-49310080 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973380304 4:49316054-49316076 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973381227 4:49322220-49322242 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973382312 4:49329265-49329287 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
973385851 4:49513877-49513899 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
978214576 4:106183386-106183408 AGAGAGAAACCTGAAGTGGATGG - Intronic
981954597 4:150454724-150454746 AGGGAGAAGGCTGAGGGGGAAGG - Intronic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
983999748 4:174225605-174225627 AGGCAGAAGCCGTATCTGGCAGG - Intergenic
986445395 5:7816496-7816518 AGGCAAAGGCCGGCTGTGGAGGG + Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
991185398 5:63800796-63800818 AGGGAGTAGCTGGAGGTGCAGGG + Intergenic
991442784 5:66668811-66668833 AGGGGGAAGCCAGAGGTGGGAGG + Intronic
991707211 5:69369543-69369565 AGGGAGGAGCCGGAAGGGGCGGG + Exonic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
999051805 5:148531205-148531227 TGGGAGAAGCCAGAGGTGGAAGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1002154600 5:177266506-177266528 AGCGAGAAGCCGAACGTCGAGGG - Intronic
1002542592 5:179915867-179915889 AGGGTGAATCTGGATGAGGAGGG - Intronic
1003534766 6:6967138-6967160 GGGGAGAAGCTGGGTGTGTAAGG - Intergenic
1004199502 6:13534650-13534672 AGGGAGCAGCCCGACGTGGCTGG + Intergenic
1006512692 6:34530212-34530234 AGGGAGATGGGGGAGGTGGAGGG - Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1010911977 6:81569722-81569744 AGTAAGAAGCCTGATGTGGAGGG - Intronic
1013551328 6:111210614-111210636 AGGAAGAAGCCGAATGTGTGTGG + Intronic
1015766958 6:136728934-136728956 AGGGAGAAACCTAGTGTGGAGGG + Intronic
1017739901 6:157397725-157397747 AATAAGAATCCGGATGTGGAAGG - Intronic
1018828018 6:167422828-167422850 AGGGAGACGCCGTGTGTGGTGGG - Intergenic
1018907071 6:168081705-168081727 AGGGAGAAGCTGGATGCAAAAGG + Intergenic
1019156690 6:170044011-170044033 AGGGAGCAGCCCCGTGTGGAGGG - Intergenic
1019525243 7:1477759-1477781 GGGGGGAAGCCGGGTGCGGACGG - Exonic
1022274967 7:28846240-28846262 AGGGAGGAAGGGGATGTGGAGGG + Intergenic
1022380912 7:29859234-29859256 AGGGAGAAGACGGTTGAGCAGGG + Intronic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1024849648 7:53696463-53696485 AGGGAGAAGCTGGGAGAGGAGGG + Intergenic
1026141654 7:67712004-67712026 AGGGTGAGGCCAGATGGGGAAGG + Intergenic
1026590986 7:71695397-71695419 AGGGAGAAGCCAGCAGAGGAAGG + Intronic
1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG + Intronic
1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG + Intergenic
1027108168 7:75418587-75418609 AAGGGGAAGCAGGATGCGGAGGG - Exonic
1028223132 7:88219841-88219863 AGGGAGAAGCCGAGGGCGGAAGG + Intronic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1029485320 7:100836548-100836570 GGGCAGCAGCTGGATGTGGAAGG - Intronic
1029969603 7:104776447-104776469 AAGGAGAAGCTGGCTGTGGGGGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1030968123 7:116019015-116019037 AGGTAAAGGCTGGATGTGGAAGG + Intronic
1031179328 7:118394502-118394524 CGGGAGAAGCCAGAAGGGGATGG + Intergenic
1033656646 7:143380038-143380060 AGAGTGTAGCCGGATTTGGAGGG + Intergenic
1034282515 7:149864039-149864061 TGGGCGAAGCTGGATGTGGAAGG + Intronic
1035422647 7:158742266-158742288 AGTGATAAGCCTGGTGTGGAAGG + Intronic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039468839 8:37801419-37801441 AGGGAGAACCTGGGTGTGGGAGG + Intronic
1046057663 8:109097990-109098012 AGGGAGATACTGGATGTGGGAGG - Intronic
1046958206 8:120083281-120083303 AGGCAGAACCCGAATGTGGGTGG - Intronic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048879081 8:138858531-138858553 AGGGGAAAGCTGGATGTGGTGGG - Intronic
1049108813 8:140630019-140630041 TGGGAGAAGCAGGGTGTGGGAGG - Intronic
1049237442 8:141519160-141519182 AGGGGGCAGCAGGATGGGGAGGG + Intergenic
1049509333 8:143019551-143019573 AGGGAGTAGCCCGAGGAGGAAGG - Intronic
1050847830 9:10245748-10245770 AGGGGGAAGACAGATGTGGCAGG + Intronic
1051147681 9:14045883-14045905 AGGGGGAAGCTGGATGAGAAAGG + Intergenic
1055931000 9:81559840-81559862 AGGGAGGAGAGGGATCTGGAGGG - Intergenic
1056262099 9:84859157-84859179 TGGGAGAAGCGGGGTGTGAATGG + Intronic
1056462552 9:86822298-86822320 AGGGAAAAGTCGGGTGGGGAGGG + Intergenic
1056479678 9:86988462-86988484 AGGCAGAGGCTGGATGAGGAGGG - Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056687467 9:88778333-88778355 TGGGAGAACCCGGCTGGGGAGGG - Intergenic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057730112 9:97601161-97601183 AAGGAGAAGCCAAATGGGGATGG - Exonic
1058049448 9:100392195-100392217 AGGGGGAAGGGGGATGGGGAGGG - Intergenic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059367334 9:113796905-113796927 AGGGAACAGCAGGATGTGCAAGG + Intergenic
1060811074 9:126611829-126611851 AGGGAGAAGCCGGGCGGGCAAGG - Intergenic
1061078375 9:128355373-128355395 AGGGAGGGGCCGGATGAGGCAGG - Intronic
1061578393 9:131522167-131522189 AGGGAGCAGAAGGATTTGGAAGG - Exonic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1203698817 Un_GL000214v1:119225-119247 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203699773 Un_GL000214v1:125523-125545 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203479507 Un_GL000224v1:113-135 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203480473 Un_GL000224v1:6409-6431 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203481440 Un_GL000224v1:12737-12759 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203482404 Un_GL000224v1:19046-19068 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203548993 Un_KI270743v1:152910-152932 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203549457 Un_KI270743v1:155639-155661 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203550415 Un_KI270743v1:161951-161973 AGGGAGAAGCTGGGTGAGGCAGG - Intergenic
1203569112 Un_KI270744v1:115471-115493 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1203570061 Un_KI270744v1:121760-121782 AGGGAGAAGCTGGGTGAGGCAGG + Intergenic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1189129753 X:38485518-38485540 GGGGAAAAGCCGGGTGGGGAGGG + Intronic
1189234444 X:39476740-39476762 GGGAAGAAGCCGGCTGCGGAGGG + Intergenic
1189318111 X:40069974-40069996 AGGGATGAGCTGGAAGTGGAGGG + Intronic
1190962309 X:55264664-55264686 TGGGAGGAGCCGGACGTCGACGG + Exonic
1192624824 X:72715659-72715681 AGGGAGGAGCCGGAGATGAACGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195731281 X:107970355-107970377 GGGAAGAAGCAGGGTGTGGACGG - Intergenic
1197040939 X:121934153-121934175 AGAGAGAAGGTGGAAGTGGATGG - Intergenic
1199746993 X:150778201-150778223 AGGGAGTAGCTGTCTGTGGAAGG - Intronic
1201175462 Y:11306471-11306493 AGGGAGAAACCGGCTTGGGAGGG - Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic