ID: 1133256316

View in Genome Browser
Species Human (GRCh38)
Location 16:4518545-4518567
Sequence ATGTGGATATGGAGGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 374}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133256316_1133256328 21 Left 1133256316 16:4518545-4518567 CCCTCACCCCTCCATATCCACAT 0: 1
1: 0
2: 2
3: 43
4: 374
Right 1133256328 16:4518589-4518611 GAACCCCAGCAGAGACTGCAGGG 0: 1
1: 0
2: 1
3: 26
4: 219
1133256316_1133256327 20 Left 1133256316 16:4518545-4518567 CCCTCACCCCTCCATATCCACAT 0: 1
1: 0
2: 2
3: 43
4: 374
Right 1133256327 16:4518588-4518610 TGAACCCCAGCAGAGACTGCAGG 0: 1
1: 0
2: 1
3: 14
4: 226
1133256316_1133256331 25 Left 1133256316 16:4518545-4518567 CCCTCACCCCTCCATATCCACAT 0: 1
1: 0
2: 2
3: 43
4: 374
Right 1133256331 16:4518593-4518615 CCCAGCAGAGACTGCAGGGCAGG 0: 1
1: 0
2: 2
3: 78
4: 475

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133256316 Original CRISPR ATGTGGATATGGAGGGGTGA GGG (reversed) Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
900993209 1:6107260-6107282 ATGGAGAGATGGAGGGATGATGG + Intronic
900993232 1:6107366-6107388 ATGGAGAGATGGAGGGATGATGG + Intronic
900993311 1:6107702-6107724 ATGGAGAGATGGAGGGATGATGG + Intronic
900993321 1:6107746-6107768 ATGGAGAGATGGAGGGATGATGG + Intronic
900993413 1:6108074-6108096 ATGGAGAGATGGAGGGATGATGG + Intronic
901052607 1:6432795-6432817 GGGTGGACATGGACGGGTGAAGG - Intronic
901195941 1:7439766-7439788 AGGTGCAGATGAAGGGGTGAAGG + Intronic
901677536 1:10895130-10895152 CTGTGAATATGTAGGGGTTAGGG - Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902481639 1:16715251-16715273 GGGTGGACATGGACGGGTGAAGG + Intergenic
902944689 1:19826349-19826371 ATGAGGATATTGAGGGTTGAGGG - Intergenic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903610617 1:24609008-24609030 AAGGGGAGATGGAGTGGTGAGGG + Exonic
903741637 1:25561962-25561984 AGTTGGGTTTGGAGGGGTGAGGG + Intronic
904782363 1:32960282-32960304 ATGTGCATTTGGTAGGGTGAGGG - Intronic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
907848153 1:58228545-58228567 GTGTGGATATGGCAGGGGGAGGG + Intronic
908148913 1:61279190-61279212 ATGTTGGTATTGTGGGGTGAAGG + Intronic
910218194 1:84863583-84863605 ATGTGGATATGAAGGAGAGGAGG - Intronic
910700590 1:90069894-90069916 GTGTTGATATGGAGGAGTAATGG + Intergenic
911050384 1:93665915-93665937 GTTTGGATATGGTGGGGTGGGGG - Intronic
911378651 1:97084473-97084495 AAGAGGATATGGAGGAGAGAGGG - Intronic
911465367 1:98245773-98245795 ATCTGGAAATGGAGTAGTGAGGG + Intergenic
912154306 1:106898512-106898534 ATGTGTATGGGGAGGGGTGTTGG - Intergenic
912704243 1:111900122-111900144 ATATGGATATGCAGGGCTGCTGG + Intronic
912738347 1:112170208-112170230 ATGTGGACCTGCAGAGGTGAGGG - Intergenic
912774861 1:112499737-112499759 AGGTTGCTATGCAGGGGTGAAGG + Intronic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
913583519 1:120250310-120250332 ATGTGGATAGGGAGAGCTGGAGG - Intergenic
913624657 1:120648009-120648031 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914565506 1:148862147-148862169 ATGTGGATAGGGAGAGCTGGAGG - Intronic
914607319 1:149268102-149268124 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
916058696 1:161084827-161084849 GTGTGGGTTTGGGGGGGTGAGGG + Intronic
918311936 1:183291270-183291292 ATGTGTATGTGGTGGGGTGGTGG - Intronic
920209835 1:204320189-204320211 AGGTGGACATGGAGGCATGAAGG - Intronic
920273177 1:204782548-204782570 ATGTGGCTATGGCTGGATGAAGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924366871 1:243303539-243303561 ATGTGAAGATGGTAGGGTGAAGG + Intronic
924430960 1:243995984-243996006 ATCTGGATATGGATGGCTAATGG + Intergenic
924795769 1:247291261-247291283 CTGGGGTGATGGAGGGGTGAGGG - Intergenic
924946297 1:248849149-248849171 ATGTGGGTATGGAGGTGGGTGGG + Exonic
1065642890 10:27803375-27803397 ATGTGTATATGGGGGAGGGATGG - Intergenic
1065941726 10:30570855-30570877 ATGTTGAAATGGAGTGATGAGGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1068028182 10:51674903-51674925 AAGAGGATATGGAGGAGGGAAGG + Intronic
1068488685 10:57694348-57694370 ATGTGGAAATGAATGGGTGGAGG - Intergenic
1068531038 10:58186900-58186922 AGGTGGATATGTAGGTTTGAAGG + Intergenic
1068634792 10:59336901-59336923 ATGTGGAAAGGATGGGGTGATGG - Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1070032871 10:72693445-72693467 ATGTGTTTATTGAGGGTTGAAGG - Intronic
1070252479 10:74785004-74785026 ATGTGTACATTGAGGTGTGAGGG - Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071748806 10:88451728-88451750 ATGTGTATATTGAGGGTTGATGG - Intronic
1073116910 10:101096462-101096484 AGGGGGTTGTGGAGGGGTGAAGG - Intronic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1075677872 10:124308736-124308758 GTGTGTATATGGAGGGGGTAGGG - Intergenic
1076290706 10:129343457-129343479 GTGTGGAGATAGAGGGGTGAGGG - Intergenic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077316083 11:1919957-1919979 ATGCGGACATGGTGGTGTGATGG + Intronic
1079426440 11:20346752-20346774 ATGTTGAAAAGGAGTGGTGAGGG - Intergenic
1080096083 11:28408456-28408478 AAGTGGAAATGGTGGAGTGAAGG - Intergenic
1080250535 11:30228480-30228502 TTGTGGATGGGGAGGAGTGATGG - Intergenic
1081291438 11:41330522-41330544 GTGTTCATATGAAGGGGTGAAGG - Intronic
1081525986 11:43928147-43928169 ATGTTGAGCTGGAGGGGAGACGG + Intronic
1082030356 11:47599115-47599137 AAGTGGAGATGGAGGAGTGAGGG + Intergenic
1082755503 11:57072086-57072108 GAGTGGTTAGGGAGGGGTGATGG - Intergenic
1084004319 11:66315111-66315133 ATGGGGATGTGTAGGGCTGATGG + Exonic
1084410161 11:69002260-69002282 ATGTGGGAAGGGTGGGGTGAAGG - Intergenic
1084426284 11:69086093-69086115 ATGTGGCTATGCAGGGGGCAGGG - Intronic
1084445115 11:69199148-69199170 ATGGAGATATGGATGGATGATGG - Intergenic
1084494902 11:69498041-69498063 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1084495032 11:69498541-69498563 ATGTGTAGGTGGAGGGGTGCAGG + Intergenic
1085152135 11:74260811-74260833 ATGTGCATATGGAGGTGTGAAGG - Intronic
1086015745 11:82165265-82165287 ATGTTGATTAGGAGTGGTGAAGG - Intergenic
1086684375 11:89713971-89713993 ATGTAAATATGGAGGTTTGAGGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087685598 11:101259928-101259950 AAATGTACATGGAGGGGTGAAGG - Intergenic
1088652435 11:111969823-111969845 ATGTTGAGAAGGAGTGGTGAAGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1096912241 12:54996268-54996290 GTGTGGATTTAGAGGAGTGAGGG + Intergenic
1096942701 12:55365244-55365266 ATGGGGATCTGAAAGGGTGAGGG - Exonic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098171187 12:67748931-67748953 ATGTGGAAGGGGTGGGGTGAAGG + Intergenic
1098614193 12:72502856-72502878 ATGTGAATATGGAGAAATGAGGG + Intronic
1098705465 12:73684072-73684094 ATGTGGATATGTAAAGGTGATGG + Intergenic
1100271356 12:93028432-93028454 ATGGAGATTTGGAGGGGCGATGG + Intergenic
1101157737 12:101943760-101943782 ATGGGTATATGGAGGGGTAGAGG + Intronic
1101305011 12:103519718-103519740 AGGGGTAGATGGAGGGGTGAGGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103951933 12:124556035-124556057 ATGGCGAAATGGAGGCGTGAAGG + Intronic
1104006772 12:124898540-124898562 GTGCGGAGATGGAGGGGTGCAGG + Intergenic
1104632034 12:130411386-130411408 ATGTGGAAAAGGAGTGGTGAGGG + Intronic
1104849218 12:131863293-131863315 AAGTGGGGAGGGAGGGGTGAAGG + Intergenic
1106933510 13:34692704-34692726 ATATGAATTTGGAGGGGTGGGGG + Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1109831310 13:67792795-67792817 AAGTGTATATGGAGATGTGAAGG + Intergenic
1110781454 13:79470552-79470574 ATGTGAATTTGGAGGGTGGAGGG - Intergenic
1113504161 13:110801703-110801725 ATGTGGATGTGCAGGGGTCCTGG + Intergenic
1114242110 14:20877606-20877628 ATTTGCATATGTAGGGGTAAAGG - Intergenic
1115668237 14:35578041-35578063 AGGTGGATATGGAGGAGGGAAGG - Intronic
1115836605 14:37412677-37412699 ATGAGGATATGTGAGGGTGATGG + Intronic
1116214232 14:41990594-41990616 AGGGGGATCTGGAGGTGTGAAGG - Intergenic
1116809105 14:49522313-49522335 CAGTGGAAATAGAGGGGTGAAGG + Intergenic
1116931931 14:50699449-50699471 ATGTTGAATAGGAGGGGTGAAGG + Intergenic
1116993647 14:51301209-51301231 GAATGGATATGGAGGGGTGAAGG - Intergenic
1118321876 14:64758133-64758155 GGGTGGATAGGGAGGGGTGAAGG - Intronic
1118645474 14:67834375-67834397 ATTTGGATATCCAGGGGTGGGGG + Intronic
1118890654 14:69905723-69905745 AGTTGGATGTGGAAGGGTGAAGG + Intronic
1119099635 14:71867998-71868020 ATCTGGATATGGATGGATGATGG - Intergenic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121679990 14:95785818-95785840 TTGTGGATACCGAGGGATGACGG + Intergenic
1122268683 14:100558620-100558642 CTGTGGATTTGTAGGGGCGATGG - Intronic
1122844628 14:104486075-104486097 ATGTGTATATGTGGGGGTGGGGG - Intronic
1125368418 15:38943838-38943860 GTTTAGATATAGAGGGGTGAAGG + Intergenic
1125535705 15:40440524-40440546 AAGGGGATGCGGAGGGGTGATGG + Intronic
1126101920 15:45123203-45123225 ATGGGGAGATGGATGGCTGAGGG - Intronic
1127331398 15:57943553-57943575 ATGTGGAAATGAAGGGTTGCTGG + Intergenic
1128469685 15:67941744-67941766 CTGTGGATATGGAGTGGTCAGGG + Intergenic
1128533482 15:68471270-68471292 CTGTGGATATGGGGTGGTGCTGG - Intergenic
1128560085 15:68658970-68658992 ATGTGGATATTGGTGGGCGAGGG - Intronic
1128732726 15:70032050-70032072 ATCTAGATGTGGAGAGGTGAAGG + Intergenic
1129063055 15:72876392-72876414 ACATGGATATGGAGAGGTGGGGG - Intergenic
1129984106 15:79901599-79901621 ATGTGGATATGTTAGGGTGATGG + Intronic
1129991092 15:79964011-79964033 ATGTGGATATGTTAGGGTGATGG + Intronic
1131229166 15:90647470-90647492 GTGTGGAGGAGGAGGGGTGAGGG - Intergenic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131354419 15:91732285-91732307 TTGTGGAGATGGAGGGTTTAGGG + Intergenic
1131540375 15:93270373-93270395 AGGTGGATTTGGAGGGGTCGGGG + Intergenic
1131601788 15:93856744-93856766 ATGTGGGTATGGGATGGTGAGGG + Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133677995 16:8093663-8093685 GTGTGGAAATGGTGGGTTGATGG - Intergenic
1136115813 16:28093605-28093627 AGGAGGCTTTGGAGGGGTGAGGG + Intergenic
1136899785 16:34022762-34022784 ATGTTGAAAAGGAGTGGTGAGGG - Intergenic
1136998694 16:35208897-35208919 ATGTGGACGTGGAGGCATGAGGG + Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1138024429 16:53511651-53511673 ATGAGGATATGGACAGGTGGTGG - Intergenic
1138197544 16:55062701-55062723 ATGTGGAGATGGAAGGGGAAAGG + Intergenic
1138207619 16:55136261-55136283 ATGTGGAGAGAGAGGGGTGTGGG + Intergenic
1138441585 16:57038220-57038242 GTTTCAATATGGAGGGGTGACGG + Intronic
1139631290 16:68233491-68233513 ATGTGTCTATGGAGGGGAGTTGG - Intronic
1140621967 16:76746047-76746069 GTGTGTATATGTGGGGGTGAGGG + Intergenic
1141308662 16:82891540-82891562 ATGAGCAGTTGGAGGGGTGATGG - Intronic
1142363727 16:89639100-89639122 ATGTGAATGTGCAGGGGTGGGGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1143432612 17:6898291-6898313 GTATGGAAATGGATGGGTGAAGG + Intronic
1143892902 17:10115989-10116011 ATGATGATCTGGAGAGGTGAGGG - Intronic
1144162061 17:12569406-12569428 ATGCGGATAGGGAGAGGAGATGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144307184 17:13979265-13979287 AGCTTGATATTGAGGGGTGAGGG + Intergenic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1145010639 17:19365679-19365701 ATTTTGAGCTGGAGGGGTGAGGG - Intronic
1146630008 17:34463038-34463060 GTGTTGATATGGAGGGGAGTTGG + Intergenic
1146732644 17:35207640-35207662 ATGGGGAAATGGGGAGGTGATGG + Intergenic
1148700616 17:49584543-49584565 ATGGGGATGTGGGGGAGTGAGGG + Intergenic
1149109906 17:53016175-53016197 GTGTGGATTTAGAGGGGAGAGGG - Intergenic
1149416337 17:56463849-56463871 ATGTGGACATGGGAAGGTGAAGG - Intronic
1149441278 17:56676489-56676511 ATGTGTATATGCTGGGGGGATGG + Intergenic
1149754731 17:59177389-59177411 ATGTGGAAATTGCGGGGTGGTGG + Intronic
1151547705 17:74803369-74803391 ATGTGGATGGGGAGAGGGGAAGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1152575191 17:81136753-81136775 AGGTGGATGTGTAGGGGTGGGGG + Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152677200 17:81647794-81647816 GTGTGGCCATGGAAGGGTGAAGG + Intronic
1153371331 18:4319859-4319881 ATGTGTATATGAAGGAATGAGGG - Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1153655627 18:7279747-7279769 ATGGGGATGCGGAGGGGTGGCGG + Intergenic
1154000327 18:10477157-10477179 GTGTGGATTTGCAGAGGTGATGG + Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1154950075 18:21201554-21201576 TTGTGGATGTCAAGGGGTGAGGG - Intergenic
1155930533 18:31702861-31702883 GAGTGGATATGGAGGGGAAATGG + Intergenic
1156483898 18:37452817-37452839 ATGTGGCTATGCAGAGGCGAAGG - Intronic
1156569365 18:38235527-38235549 ATGTGGATGGAGAGGGCTGATGG + Intergenic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157394307 18:47329062-47329084 ATCTACATATGAAGGGGTGAAGG + Intergenic
1157873369 18:51250089-51250111 ATGTGAATTTTGAGGGGAGAGGG + Intergenic
1158384077 18:56969232-56969254 AACTGGATATGGACAGGTGAAGG - Intronic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1159453442 18:68631593-68631615 ATGTGATTTGGGAGGGGTGAGGG + Intergenic
1161608456 19:5227991-5228013 AAGGGGATAAGGAGGGGTGACGG + Intronic
1162087988 19:8260019-8260041 ATGGGGAGATGGTGGGGTGCGGG + Intronic
1163238267 19:16042571-16042593 ATGTGGGAAGGGAAGGGTGATGG - Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1164449156 19:28345066-28345088 AGGTGGGAATGGAGGGGTGTGGG + Intergenic
1164848192 19:31452380-31452402 AGGTGGACAGGGAGGGATGAGGG + Intergenic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166175001 19:41061588-41061610 ATGTGGACATGAAGCAGTGAAGG - Intergenic
1166365581 19:42276754-42276776 GTGGGCATATGGGGGGGTGAAGG - Intronic
1168309098 19:55451836-55451858 ATGTGGAGACAGAGGGGTGACGG - Intergenic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
1202715678 1_KI270714v1_random:41163-41185 GGGTGGACATGGACGGGTGAAGG + Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926300114 2:11596374-11596396 ATGTGTATAGTGAGGGGGGACGG + Intronic
926968766 2:18445104-18445126 ATGTGAATATGTAAGGATGAGGG - Intergenic
928426016 2:31178405-31178427 AGGTGGATATAAAGGGCTGAAGG + Intronic
930376509 2:50573950-50573972 ATGTGGATGAGGAGGGGTCATGG + Intronic
930842651 2:55864662-55864684 ATGAGGGTGGGGAGGGGTGAGGG + Intergenic
930877229 2:56232732-56232754 ACCTGGATGTGGAGTGGTGAGGG - Intronic
931185727 2:59949277-59949299 ATGTTCATATGGAGGGGGCAAGG - Intergenic
931263871 2:60643318-60643340 ATGTTGATCTGGATGTGTGAGGG + Intergenic
935515095 2:104026676-104026698 AGGTGAACAGGGAGGGGTGAGGG + Intergenic
935635111 2:105243955-105243977 AAGTGGATTTGGTGGGTTGAAGG - Intergenic
937840798 2:126522553-126522575 ATGTGGATGTGGACTTGTGAGGG - Intergenic
938292469 2:130157399-130157421 GGGTGGAGAAGGAGGGGTGAGGG + Intronic
938464085 2:131515577-131515599 GGGTGGAGAAGGAGGGGTGAGGG - Intergenic
938992370 2:136642813-136642835 AGGTGGAACTGGAGGGCTGAGGG - Intergenic
939875025 2:147568215-147568237 ATGAGTATATGGAGGGATGGAGG + Intergenic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
943587348 2:189757278-189757300 ATTTGGATGTGGAATGGTGAGGG + Intronic
943733280 2:191325958-191325980 ATCTGGAAATGAAGGGGAGATGG + Intronic
945000409 2:205344294-205344316 ATGTGGATATGGAGTGGATGAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946543134 2:220707616-220707638 ATGTGGATGTGGATGGGAGTAGG - Intergenic
948271002 2:236673125-236673147 ATGTGAATATGGAAGTGTGAGGG + Intergenic
948856374 2:240732317-240732339 ATGAGGAAATGAGGGGGTGAAGG + Intronic
1169268041 20:4179367-4179389 TTGTGGATATGGAGTGGATATGG + Intronic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1170582391 20:17709276-17709298 ATGTGGACCTGGAGGGCTGGAGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1171262875 20:23748655-23748677 ATGTGCAGATGGGGTGGTGAGGG - Intronic
1172480655 20:35269499-35269521 GTGTGGAAAAGGAGGTGTGAGGG - Intronic
1172780795 20:37436085-37436107 ATGGGGACATGGATGGATGATGG - Intergenic
1173062494 20:39675734-39675756 ACATGGACATGGAGGGGTTAGGG - Intergenic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1174118068 20:48241567-48241589 AAGTGGAAAGGCAGGGGTGAGGG + Intergenic
1174125635 20:48303088-48303110 ATGTGCATATGGAAGGATGATGG - Intergenic
1174198423 20:48789873-48789895 GTGGGGAGATGGATGGGTGATGG + Intronic
1175934806 20:62509746-62509768 GGGTGGAGATGGAGGGGTGGAGG - Intergenic
1177473546 21:21589795-21589817 ATGTGGATATGCAAGTGTTATGG + Intergenic
1178415772 21:32403868-32403890 CTGTGGATACGGGGTGGTGATGG + Intergenic
1178885319 21:36480268-36480290 ATGTGGAGCTGGACGGGTCAAGG + Intronic
1179502659 21:41819886-41819908 CTGAGGACCTGGAGGGGTGAGGG + Intronic
1179608149 21:42531619-42531641 GTGTGGCTATGCAGAGGTGAGGG + Intronic
1181824920 22:25507327-25507349 ATATGTATATGGATGGGTGAAGG - Intergenic
1182307729 22:29382605-29382627 AGGAGGATAGGGAGGGGAGAGGG + Intronic
1182515465 22:30856208-30856230 ATGGAGAGATGGAGGGGTGAAGG - Intronic
1182666596 22:31964664-31964686 ATGTGTGTGTGGTGGGGTGAGGG + Intergenic
1182698622 22:32212738-32212760 ATGTGGAGATGCAGGGCTGTTGG + Intergenic
1182789404 22:32937155-32937177 ACGTGGAAATGGAGAGATGATGG + Intronic
1182995212 22:34805967-34805989 ATCTGGAGATGCAGGGCTGAGGG - Intergenic
1183799196 22:40147358-40147380 TTGTGGAGATGGATGGTTGATGG + Intronic
1184855161 22:47142598-47142620 ATGTGCAGATGGATGGATGATGG - Intronic
950472618 3:13195838-13195860 ATGTGGATAAGATGGGGGGATGG + Intergenic
950909690 3:16576242-16576264 ATTTGGGGATGGAGTGGTGAAGG - Intergenic
951026620 3:17837873-17837895 ATGTGGGTAAAGAGGGCTGAAGG + Intronic
951435713 3:22661252-22661274 ATTGGGAGAGGGAGGGGTGAAGG + Intergenic
953229486 3:41051991-41052013 AAGTAGGTATGGAGGAGTGATGG - Intergenic
953496714 3:43393856-43393878 ATCTGGAAATGGAGGGGTTAGGG - Intronic
954449889 3:50566183-50566205 AGGTGGATATGGGGAGGTGGGGG - Intronic
954774761 3:53006716-53006738 TTTTGGATATGGAGGGGTCCTGG + Intronic
955085501 3:55698513-55698535 CTTTGGATATGGCAGGGTGAGGG - Intronic
955558480 3:60163424-60163446 ATGTGTACGTGGAGGGGTGGTGG - Intronic
956072726 3:65471643-65471665 ATGTGGACCTGGAGTGGGGAGGG - Intronic
956127331 3:66023231-66023253 ATATGGAAATGGAGGGGGAAAGG + Intronic
957651231 3:83007798-83007820 ATGAGGAAATGGAGGCTTGAGGG + Intergenic
958057484 3:88430807-88430829 ATGTGGATGAGGAAGGGTGCAGG - Intergenic
958610800 3:96423678-96423700 ATGTGGATATTAAAAGGTGAAGG - Intergenic
958698116 3:97553211-97553233 TTGTGGATTAGCAGGGGTGAAGG - Intronic
959595683 3:108126162-108126184 ATGTGCATGTGGTGGGGTGTGGG + Intergenic
960264081 3:115600036-115600058 ATGTGGATCTGATGGGGTCAGGG - Intergenic
960271324 3:115677530-115677552 CTGTGGATGTGTTGGGGTGAGGG - Intronic
961000623 3:123371786-123371808 GTGTAGATATGCAGGGGTGGGGG - Intronic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
963130056 3:141849619-141849641 AAGTGGATGTTGAGGGCTGACGG + Intergenic
964606936 3:158570309-158570331 ATTTGGATATGGTGGGGCGGAGG - Intergenic
964750696 3:160051291-160051313 TTGTGGTTTTTGAGGGGTGAAGG + Intergenic
965019095 3:163203121-163203143 ATGGGCATATGGAGGGTTGGGGG + Intergenic
965149328 3:164949695-164949717 ATGTGTTTATGGAGGGGTGTGGG + Intergenic
965461871 3:168975797-168975819 GTTTGGATAAGGAGGGGAGAGGG + Intergenic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
966053485 3:175652376-175652398 ATTTGTATTTGGTGGGGTGAGGG - Intronic
967264237 3:187676087-187676109 ATGTGCAAATGGAGGTGGGAGGG - Intergenic
967458068 3:189712670-189712692 ATATAGATTTGGTGGGGTGAGGG + Intronic
968062403 3:195735605-195735627 AAGTGGATATGTAGAGGAGAAGG - Intronic
968133175 3:196204012-196204034 ATGTGGAGCAGGAGTGGTGAGGG - Intronic
970554828 4:17220692-17220714 ATGTGAAGATGGAAGGGGGATGG + Intergenic
970560935 4:17281775-17281797 AGGTGGATATGGACGGATAAAGG + Intergenic
970838552 4:20439655-20439677 ATGTGAATTGGGAGGTGTGAGGG + Intronic
971119258 4:23685890-23685912 ATGTGAATAGGGATGTGTGAGGG - Intergenic
971163422 4:24157683-24157705 ATATGGATTTGGGAGGGTGAAGG - Intergenic
972857456 4:43124142-43124164 ATGTTTATTTGGATGGGTGAGGG + Intergenic
974232722 4:59137486-59137508 ATGTGGATATTTTGGGGGGAGGG + Intergenic
975477073 4:74835459-74835481 ATTTGGTTATGCAGGGGTGATGG - Intergenic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
981002324 4:139839819-139839841 TAGTGGATATGAAGGGGAGATGG + Intronic
982271112 4:153589454-153589476 ATGTGGATATGCTGGGCAGAGGG + Intronic
983481928 4:168285713-168285735 ATGTGGATATGCATGGGGGATGG + Intronic
984391458 4:179139220-179139242 ATGTTGGAATAGAGGGGTGATGG - Intergenic
984961566 4:185102610-185102632 AGGTGGATGTGCGGGGGTGAAGG + Intergenic
985902872 5:2810543-2810565 ATCTGGAGATGAAGGGGTGTGGG - Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987374274 5:17218747-17218769 TTCTGGAAATGGAGGGGGGACGG - Intronic
987437758 5:17917402-17917424 ATATAGATATGCTGGGGTGATGG - Intergenic
987804053 5:22739702-22739724 GGGAGGAAATGGAGGGGTGATGG - Intronic
988998554 5:36737922-36737944 ATGTGGAGAAGGAGAGGTGGAGG - Intergenic
989503589 5:42199003-42199025 ATATGTATATGGAGGGGTGTGGG - Intergenic
989820972 5:45795732-45795754 ACCTGGATAGGGAGGAGTGAAGG - Intergenic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
990968356 5:61474989-61475011 ATGTGCTTTTGGAGGGCTGAAGG - Intronic
991494572 5:67214684-67214706 AATTGGATATGGAGGGGTGGGGG + Intergenic
991772347 5:70051815-70051837 ACGTGGATATGAAGAAGTGAGGG + Intronic
991851640 5:70927233-70927255 ACGTGGATATGAAGAAGTGAGGG + Intronic
992154855 5:73945152-73945174 AGGTGGATGTGGAAAGGTGAGGG - Intergenic
992992494 5:82298432-82298454 ATGGGGAGCTGGAAGGGTGATGG + Intronic
993216306 5:85027127-85027149 AAGTGGACATGGCTGGGTGAAGG + Intergenic
994892320 5:105652010-105652032 ATGTTGATTAGGAGTGGTGAAGG - Intergenic
995145145 5:108779823-108779845 ATGTTGAGAAGGAGAGGTGACGG + Intronic
997101730 5:130977025-130977047 ATGTGGATGTTTTGGGGTGATGG - Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
999943471 5:156569743-156569765 AGGTGGATATGGAGGACAGAGGG + Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1003328849 6:5112891-5112913 GTGTGGATAGAGAAGGGTGAGGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1009943006 6:70311001-70311023 ATGTGCATATGGAAGGGAGAAGG - Intergenic
1010977588 6:82333241-82333263 GTGTGGCAGTGGAGGGGTGAGGG - Intergenic
1011130089 6:84043641-84043663 GTGTGTGTATGGGGGGGTGAGGG + Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013678988 6:112501860-112501882 AAGTGGAAATGGAGGGGGAAGGG - Intergenic
1013954063 6:115819762-115819784 AAGTGGGTATGGACGGGTGGCGG + Intergenic
1015490761 6:133823162-133823184 ATGAGGATATAGATGGGTGTGGG - Intergenic
1015499286 6:133915285-133915307 TTGTGGATATGGAGGGCTGGTGG - Intergenic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017523400 6:155221764-155221786 ATCTGGAAATAGAGGGCTGAGGG - Intronic
1018767403 6:166945028-166945050 ATGTGGACGTGGGTGGGTGAGGG - Intronic
1018767422 6:166945098-166945120 GTGTGGACGTGGATGGGTGAGGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1020283538 7:6663771-6663793 ATGTGGAGGTGGGGGGGTGAAGG + Intergenic
1021901923 7:25293943-25293965 ATGGGGCTATGGAGTGGTGGAGG + Intergenic
1023781900 7:43663722-43663744 ATGGGGAAATGGAGAGTTGATGG - Intronic
1024932984 7:54684035-54684057 ATGAGAATATGCTGGGGTGACGG - Intergenic
1025710268 7:63901452-63901474 ATGTGGATATTGAGGGGGCAGGG + Intergenic
1026747482 7:73024450-73024472 ATGTGGAAATTGCGGGGTGGAGG + Intergenic
1026751132 7:73052589-73052611 ATGTGGAAATTGCGGGGTGGAGG + Intergenic
1026754781 7:73080703-73080725 ATGTGGAAATTGCGGGGTGGAGG + Intergenic
1026758433 7:73108737-73108759 ATGTGGAAATTGCGGGGTGGAGG + Intergenic
1027033688 7:74909742-74909764 ATGTGGAAATTGCGGGGTGGAGG + Intergenic
1027088972 7:75284748-75284770 ATGTGGAAATTGCGGGGTGGAGG - Intergenic
1027092615 7:75312676-75312698 ATGTGGAAATTGCGGGGTGGAGG - Intergenic
1027096258 7:75340643-75340665 ATGTGGAAATTGCGGGGTGGAGG - Intergenic
1027323084 7:77027049-77027071 ATGTGGAAATTGCGGGGTGGAGG + Intergenic
1028961432 7:96753700-96753722 ATGTATATATTTAGGGGTGAGGG + Intergenic
1029397263 7:100316913-100316935 ATGTGGAAATTGCGGGGTGGAGG - Intronic
1029658921 7:101946031-101946053 TTGTGGATTTGGAAGGGTGGAGG + Intronic
1030107122 7:105996584-105996606 TTTTGGATATGGTGGGGAGAAGG + Intronic
1030701199 7:112643124-112643146 ATGTTGAATTGGAGTGGTGAGGG + Intergenic
1030750111 7:113222108-113222130 GTGTGTCTATGGAGTGGTGATGG - Intergenic
1031108593 7:117577228-117577250 AGGTGGATATAGAGGAGTGCTGG + Intronic
1031134134 7:117867541-117867563 AAGTGTATATGGTGGGGTGGGGG - Intronic
1032417449 7:131747319-131747341 GTGTGTGTATGGAGGGGTGGGGG + Intergenic
1032948633 7:136881598-136881620 ATGAGGATATGGTGGGTTAAAGG - Intronic
1033597416 7:142867374-142867396 GTGTGGATGTGGAGGGCTGTGGG + Intronic
1036793140 8:11736607-11736629 ATGTGGACCTGGAGGAGTGGTGG + Intronic
1037606431 8:20441550-20441572 AAGTGGATATGCAAGGGGGAAGG + Intergenic
1038379709 8:27081122-27081144 ATGTGTATATGGAAGGGAAAAGG + Intergenic
1041433754 8:57815508-57815530 ATGAGGAAATGGAGGTATGAAGG + Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1042381458 8:68119026-68119048 ATGTGGATGTTGAGGATTGAGGG + Intronic
1043514903 8:80986796-80986818 AAGTGAATAGGGAGGGGGGAGGG + Intronic
1043815108 8:84792279-84792301 ATGGGGAGATGGAAGGGGGATGG + Intronic
1044008501 8:86964720-86964742 ACCTGGATAGGGAGGAGTGAAGG + Intronic
1045773017 8:105767119-105767141 CAGTGGAGATGGAGGGGTTAGGG + Intronic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049272905 8:141705528-141705550 ATGTGGAGATGATGGGGAGATGG + Intergenic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052748959 9:32469199-32469221 ATGTGGATAGGTAGGGGTGGGGG - Intronic
1056552145 9:87660638-87660660 ACGGGGACTTGGAGGGGTGAAGG - Intronic
1056625881 9:88252708-88252730 ATGTGATTATGGAAGGGTCAGGG + Intergenic
1057507036 9:95643188-95643210 ATGTGGATATCTTGGGGTGAGGG + Intergenic
1057762619 9:97888965-97888987 TTATGGACATGGAGGGGTTACGG + Intergenic
1057877565 9:98769386-98769408 AGGTGAATATGGAGGCATGAAGG + Intronic
1059093659 9:111389258-111389280 ATGTGGATAGGGACTGTTGATGG - Intronic
1059517017 9:114905500-114905522 AGCTGAATAAGGAGGGGTGAGGG + Intronic
1059859760 9:118446902-118446924 AGGTGGATAGGGAGGGGAGGAGG - Intergenic
1060151408 9:121290995-121291017 ATGAGGATATGGAGGGTGCAAGG - Intronic
1060463020 9:123876476-123876498 TCCTGGATATGCAGGGGTGAAGG + Intronic
1060557672 9:124517462-124517484 ATTTGGTCATGGAGGGTTGATGG + Exonic
1060841498 9:126796862-126796884 ATGTACACAGGGAGGGGTGAAGG - Intergenic
1061127166 9:128684317-128684339 GGCTGGATGTGGAGGGGTGAAGG - Intronic
1061623637 9:131827583-131827605 TTCTGGAGATGGATGGGTGATGG + Intergenic
1062049552 9:134440142-134440164 ACTTGGATATGGCGGGGGGAGGG + Intronic
1062598582 9:137310097-137310119 ATGTGGAAATGGACAGGTCAGGG - Intronic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1187611510 X:20948639-20948661 ATGTGTATATGGATTGATGATGG - Intergenic
1189747844 X:44188526-44188548 ATGTAGATATTGAGGGTTGGGGG - Intronic
1190102191 X:47530245-47530267 ATGTGAATTTGGCGGGGGGAGGG + Intergenic
1192908611 X:75579247-75579269 CTGAAGTTATGGAGGGGTGATGG + Intergenic
1193320999 X:80121055-80121077 AAGTAGATATGGAGGGATGCAGG - Intergenic
1193716226 X:84937409-84937431 AAGGGGAGATGGAGGGATGAAGG + Intergenic
1194672563 X:96752628-96752650 ATGTGAATTTGGAGGGGGCAAGG + Intronic
1195678449 X:107525264-107525286 AGGTGGAGATGGAGGAGAGAGGG - Intronic
1195831207 X:109060956-109060978 ATGTGGAGATGTAGGGGTTTTGG + Intergenic
1197659548 X:129155376-129155398 ATTTGGGGGTGGAGGGGTGAGGG + Intergenic
1197978235 X:132188002-132188024 ATGTGGCTATGCAAGTGTGAGGG + Intergenic
1198495058 X:137183954-137183976 ATGTGTGTATAGAGGGGTGGTGG - Intergenic
1199047789 X:143197474-143197496 AGATGCATATGGAGTGGTGAGGG + Intergenic
1199545627 X:149005110-149005132 GTTTGCATGTGGAGGGGTGAGGG - Intergenic
1200790066 Y:7291727-7291749 ATATGGAGATGGAGGGTTAATGG - Intergenic
1201720473 Y:17090723-17090745 ATGTAGAGATGGAGAGCTGATGG - Intergenic
1202275795 Y:23118545-23118567 ATTTGGGGATGGAGTGGTGAAGG - Intergenic
1202290233 Y:23302146-23302168 ATTTGGGGATGGAGTGGTGAAGG + Intergenic
1202428789 Y:24752264-24752286 ATTTGGGGATGGAGTGGTGAAGG - Intergenic
1202442002 Y:24917825-24917847 ATTTGGGGATGGAGTGGTGAAGG + Intergenic