ID: 1133257249

View in Genome Browser
Species Human (GRCh38)
Location 16:4524653-4524675
Sequence AGGCACTGGCCTCCATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133257249_1133257253 -9 Left 1133257249 16:4524653-4524675 CCTTGGGATGGAGGCCAGTGCCT 0: 1
1: 0
2: 4
3: 30
4: 283
Right 1133257253 16:4524667-4524689 CCAGTGCCTAGGACAGCCATGGG 0: 1
1: 0
2: 2
3: 24
4: 299
1133257249_1133257251 -10 Left 1133257249 16:4524653-4524675 CCTTGGGATGGAGGCCAGTGCCT 0: 1
1: 0
2: 4
3: 30
4: 283
Right 1133257251 16:4524666-4524688 GCCAGTGCCTAGGACAGCCATGG 0: 1
1: 0
2: 0
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133257249 Original CRISPR AGGCACTGGCCTCCATCCCA AGG (reversed) Intronic
900657159 1:3764067-3764089 GGACACTTGCCTCCAGCCCAGGG - Intronic
902230324 1:15023477-15023499 ATGCACTGGCCTCCTTCCTCGGG - Intronic
903072615 1:20734275-20734297 AGGCACTGTGCTAGATCCCAGGG + Intergenic
904254355 1:29245111-29245133 AGCCCCTGGCCCCCAGCCCAGGG - Intronic
906142256 1:43540724-43540746 AGGAACAGCCCTCCCTCCCACGG - Intronic
907212731 1:52837424-52837446 AGGCACCTGCCACCATGCCAGGG - Intergenic
908239418 1:62176424-62176446 AGCAACTAGCCTCCATCCCCAGG + Intergenic
908680206 1:66652410-66652432 AGGCACTAGCCTACACGCCAGGG - Intronic
909699866 1:78511068-78511090 AGGCACTCAACTCCAACCCATGG - Intronic
913537743 1:119790339-119790361 AGGCCCTGCCCTGCAGCCCAAGG - Intergenic
913646108 1:120855902-120855924 AGGCATTGGCCTCAAACTCATGG - Intergenic
914080536 1:144406981-144407003 AGGCATTGGCCTCAAACTCATGG + Intergenic
914175443 1:145275505-145275527 AGGCATTGGCCTCAAACTCATGG + Intergenic
914530165 1:148516981-148517003 AGGCATTGGCCTCAAACTCATGG + Intergenic
914973003 1:152328524-152328546 AGGCCCAGGCCTCCAACTCAGGG + Intergenic
916062803 1:161112575-161112597 AGGCACTTGCCACCATACCCAGG + Intronic
916659338 1:166906936-166906958 GGGCACTGGGCTGCATGCCATGG - Intergenic
917074226 1:171187096-171187118 AGGAACTGGCCTTCAAACCACGG + Intronic
917921174 1:179751207-179751229 AGGCACTCTCATCCATGCCATGG - Intronic
920049892 1:203157539-203157561 GGGCAGTGGCCTCACTCCCATGG + Intronic
920397857 1:205659748-205659770 AGACCCTTGCCTCCATCCCAGGG + Intronic
921351379 1:214239203-214239225 AGGCACCCGCCACCATGCCAGGG - Intergenic
922195346 1:223354997-223355019 AGCCACTGCCCTCCAGCCTAGGG - Intronic
922626886 1:227056427-227056449 TGCCACTGCCCTACATCCCAGGG - Intronic
922871043 1:228902200-228902222 AGACACTGGCCACAATCCCAGGG - Intergenic
924184556 1:241474725-241474747 GTGCACTGGCCTTCATCCTAAGG + Intergenic
1062858407 10:791081-791103 AGGCACTGGGGTCCAGCACATGG + Intergenic
1063250058 10:4264269-4264291 AGGCAGTGCCCCCAATCCCAGGG - Intergenic
1063648407 10:7908914-7908936 AAGTTCTGGGCTCCATCCCAGGG - Intronic
1063720414 10:8574808-8574830 ACGCAGTGTCATCCATCCCATGG - Intergenic
1065844970 10:29736442-29736464 CGGCCCTGGCCTCCAGCCCCTGG - Intronic
1067116031 10:43436468-43436490 GGCCACAGGCCTCCTTCCCAGGG - Intergenic
1067464946 10:46490869-46490891 AGGCAGAGCCCTCCAGCCCAGGG + Intergenic
1067622243 10:47893732-47893754 AGGCAGAGCCCTCCAGCCCAGGG - Intergenic
1068639188 10:59382935-59382957 AGGCTCTGGACTGAATCCCATGG + Intergenic
1069512330 10:69051806-69051828 AGGCAATGGTCTCGATGCCAGGG + Intergenic
1069567798 10:69475032-69475054 AGCCACGGGCCTGCCTCCCAAGG - Intronic
1069580359 10:69561755-69561777 AGGCACTTGCCTTCATTTCAGGG + Intergenic
1070904046 10:80056016-80056038 TAGGAATGGCCTCCATCCCAGGG - Intergenic
1072651382 10:97298496-97298518 AGGCCCTAGCCTCCATGGCAGGG + Intergenic
1073254379 10:102141450-102141472 AGGCCCTGGGCCCCATCCCAAGG - Exonic
1073350001 10:102812875-102812897 AGCCACTGGGCTCCATCCCTGGG - Exonic
1075742930 10:124706726-124706748 AGGCGCTGGGCTCCATCCCAGGG + Exonic
1075810079 10:125218840-125218862 AGGCCCTGGCCTGTCTCCCATGG + Intergenic
1078020479 11:7652504-7652526 AGGCACAGACCTCCTTCCCCAGG + Intronic
1078093861 11:8284370-8284392 ATGCACTGGGCTCCTTCCGAAGG - Intergenic
1079882042 11:25940753-25940775 AGGCACTCGCCACCATTCCTGGG + Intergenic
1080848885 11:36050538-36050560 GGCCAGTGGCCTCCATTCCAGGG - Intronic
1083180870 11:60984328-60984350 AGCCACCTGCCTCCCTCCCACGG - Intronic
1084520500 11:69659783-69659805 AAGCACAGGCCTCCATGCCACGG + Intronic
1084598751 11:70132625-70132647 AGGCACTGGCCTCCTCCTCCAGG + Intronic
1084642853 11:70436059-70436081 AGGCACTGCCTTCCTTCCCAAGG - Intronic
1085534792 11:77211411-77211433 AGACACTGGCCAGCAGCCCAGGG + Intronic
1085657326 11:78328516-78328538 CGGCACAGGCATCCATCCGAAGG + Intronic
1085852086 11:80132683-80132705 AGGCACAGGCCACCATGCCCGGG + Intergenic
1086103872 11:83128951-83128973 AGGCTCTGGGATCCCTCCCATGG + Intergenic
1088079347 11:105891785-105891807 AGGTACTGTCCAACATCCCACGG + Intronic
1089121326 11:116137662-116137684 AGGCACTGCTTTCCATGCCATGG - Intergenic
1090331001 11:125932296-125932318 GGGCAGTGGGCTCCATCACAGGG - Intergenic
1091755238 12:3047040-3047062 GGGTACTGGCCTGCAGCCCAGGG - Intergenic
1092524170 12:9299405-9299427 AGGCCCGGGCCTCCTTCCCAAGG - Intergenic
1092543098 12:9432407-9432429 AGGCCCGGGCCTCCTTCCCAAGG + Intergenic
1094105452 12:26806682-26806704 AGGCACTTGCCACCATGCCTGGG + Intronic
1094509921 12:31090031-31090053 AGGCCCGGGCCTCCTTCCCAAGG - Exonic
1097111264 12:56660128-56660150 AGCCACTGCACTCCAGCCCACGG - Intergenic
1098514417 12:71357860-71357882 CGGCACTGTGCTCCACCCCATGG + Intronic
1099693860 12:85993884-85993906 AGGCACTGGCCTCCACTACCTGG - Intronic
1100217333 12:92465775-92465797 AGGCTTTGGCCGCCATCCTAGGG + Intergenic
1101583264 12:106062883-106062905 AGGCACTCCCCTCTATCCCAAGG - Intergenic
1102629276 12:114263172-114263194 TGGCTCTGACCACCATCCCAAGG - Intergenic
1103562440 12:121799783-121799805 GGGCTCTGGCCTGCAGCCCAGGG - Intronic
1104465093 12:128983798-128983820 AGCCTCAGGCCTCCATCTCAGGG - Exonic
1106076576 13:26465802-26465824 GCCCACTGGTCTCCATCCCATGG - Intergenic
1106182391 13:27380754-27380776 AGACACAGGTCTCCCTCCCAGGG - Intergenic
1107616011 13:42168968-42168990 AGGCCCTGTTCTCCATCTCAGGG - Intronic
1108214999 13:48175263-48175285 AAGCACTGGCTCCCATCACAAGG - Intergenic
1109775026 13:67029412-67029434 AGGCTCTGTCCTCAATCCTAAGG + Intronic
1110804883 13:79742846-79742868 GGGCAGAGGGCTCCATCCCAGGG - Intergenic
1111713619 13:91849335-91849357 AGGCACTGCCCTCCCTCACCAGG + Intronic
1113552843 13:111206429-111206451 AGGCACTGGCCCCCATCCCTGGG + Intronic
1113906975 13:113823845-113823867 AGGGACAGGCCTGCGTCCCATGG - Intronic
1116009922 14:39339258-39339280 AGGTACTGGCCCGCAGCCCAGGG + Intronic
1117243674 14:53861798-53861820 AGGCACAGCCCTGCATCCCCGGG + Intergenic
1118681534 14:68246446-68246468 AGGCACTGGCATCAATCTAAAGG + Intronic
1119159527 14:72441540-72441562 AGGCACTGAGCGCCATCCCAGGG + Intronic
1122138945 14:99650674-99650696 AAGAACAGGCCTCCCTCCCATGG + Intronic
1122632389 14:103112930-103112952 AGGCAAGGGCCTCCATCCTGGGG - Intergenic
1122744466 14:103889705-103889727 AGGCACTGGCGTTCCGCCCACGG - Intergenic
1122903693 14:104792420-104792442 AGGCCGTGCCCTCCATGCCATGG + Intronic
1123035948 14:105472034-105472056 AGGTCCTGGGCTCTATCCCAAGG + Intergenic
1123505733 15:20940639-20940661 AGGCTCTAGCCTCCAGCCTATGG - Intergenic
1123806403 15:23878035-23878057 TAGCACTGGCCTCCGTCCCTTGG + Intergenic
1124004266 15:25783939-25783961 TGGCAGTGGCCCCCATCCCCAGG + Intronic
1124624265 15:31299149-31299171 TGGCACTGGCCTCCATGCAGGGG + Intergenic
1124719987 15:32103649-32103671 AGGCCCAGGCCTTCTTCCCATGG + Intronic
1126273470 15:46848671-46848693 AAGCAGTGTCCTGCATCCCAGGG - Intergenic
1127482416 15:59389900-59389922 AGGCACTTGCTTCCATCCCCTGG + Intronic
1127937362 15:63654723-63654745 AGGCACGTGCCACCATACCATGG - Intronic
1128237108 15:66075770-66075792 AGGTAATGGGCTCCTTCCCAAGG - Intronic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1128570807 15:68731517-68731539 AGGAACTGACCTTGATCCCAGGG + Intergenic
1128606166 15:69038070-69038092 GTGCACCTGCCTCCATCCCATGG - Intronic
1128911611 15:71520424-71520446 AGGCCCTGGGCCCCACCCCACGG - Intronic
1132232568 15:100194815-100194837 AGGAACTGCCCCCCATTCCATGG + Intronic
1202971319 15_KI270727v1_random:241480-241502 AGGCTCTAGCCTCCAGCCTATGG - Intergenic
1132514318 16:359251-359273 AGGCGGTCCCCTCCATCCCAGGG + Intergenic
1132654834 16:1037410-1037432 AGGCACCCCCCTCCACCCCACGG - Intergenic
1132854113 16:2037187-2037209 AGGCAGTGGCCCCGACCCCAGGG - Intronic
1132953276 16:2576985-2577007 AGACTCAGGCCTCCAGCCCAAGG - Intronic
1132961076 16:2623183-2623205 AGACTCAGGCCTCCAGCCCAAGG + Intergenic
1133060512 16:3171639-3171661 AGGCGCTGGGCTCCATCCGAGGG + Intergenic
1133257249 16:4524653-4524675 AGGCACTGGCCTCCATCCCAAGG - Intronic
1133281967 16:4671696-4671718 AGACACTGGCCCCCATTCCTGGG - Intronic
1133477465 16:6137446-6137468 AGGCACTGGCCACCACGCCTGGG + Intronic
1133711418 16:8405068-8405090 AGGCTCTGGTCTCGAACCCATGG - Intergenic
1135000345 16:18771813-18771835 AGGTACTGGCCTCAATACCCTGG - Intergenic
1137411250 16:48230198-48230220 AGGCACTGTGCTACATCACAGGG - Intronic
1137666520 16:50252728-50252750 AGGCTCTGGGCTCCATTCCCAGG + Intronic
1140102713 16:71932290-71932312 AGGCACTGGGCTCCAAACCCTGG - Intronic
1140300824 16:73755900-73755922 AGGCACTCGCCCCTCTCCCACGG + Intergenic
1140932369 16:79639725-79639747 AGGCACAGGCCACCATGCCCAGG + Intergenic
1141748465 16:85942221-85942243 AGGCCCTGGCCTCTCTCCCTTGG + Intergenic
1142611765 17:1112306-1112328 TGCCACTGTCCTCCATCCCCAGG - Intronic
1142770811 17:2095503-2095525 AGGCACTGTCCTCCAGACCCTGG + Intronic
1143782142 17:9234501-9234523 AGGCACCCGCCTCCTCCCCATGG + Intronic
1145103417 17:20095629-20095651 TAGCACTGGCCGCCATCCCCCGG + Intronic
1145267238 17:21385715-21385737 GGGTCCTGGCCTCCATCCCACGG + Intronic
1146636605 17:34510860-34510882 AGGCAGTGGCCTCCTTAACAGGG + Intergenic
1147559824 17:41501842-41501864 AGGCACTAGAGTCCAGCCCAGGG - Intronic
1148326404 17:46785789-46785811 GGGCCCTGTGCTCCATCCCAGGG + Intronic
1151153890 17:72111041-72111063 AGGCACTGTCTTCCAGCCCGTGG - Intergenic
1151349439 17:73522948-73522970 AGGGCCTGGCCTCCAGCCCAGGG - Intronic
1151892317 17:76958083-76958105 AGGGACTGGTCTGCATCCCTGGG - Intergenic
1152245149 17:79181605-79181627 CGGCAGTGGCCTGCAGCCCAGGG - Intronic
1152472999 17:80500575-80500597 AGGCACCGGCTGCCATCCCCAGG + Intergenic
1153734521 18:8051089-8051111 AGTCACAGGACTCCATCCCGTGG + Intronic
1153897610 18:9580874-9580896 AGGCACTGGTCTACCTCACAGGG + Intronic
1153951653 18:10062718-10062740 AGGCTGTGGCCTCCATTCTAAGG - Intergenic
1156970678 18:43151017-43151039 AGGCACTCGCCTCCCTACAATGG - Intergenic
1157271400 18:46279093-46279115 AGGCACTGGCTTCTGCCCCATGG - Intergenic
1157272377 18:46286030-46286052 GGGCACTCCCCTCCCTCCCAAGG - Intergenic
1157616157 18:48988913-48988935 AGGCACTGGGGGCCTTCCCAGGG + Intergenic
1159004368 18:62999472-62999494 AGGCTCTGGCCTCCATGCCTTGG - Intergenic
1159025947 18:63182326-63182348 AGGGTCTGGCCACCAGCCCACGG + Intronic
1160797795 19:953749-953771 ACGCACAGGCCCCCACCCCAGGG - Intronic
1161206935 19:3046478-3046500 AGGCTCTGGCCTCCAGCAGAGGG - Intronic
1161407051 19:4096459-4096481 AGGCACAGGACTGCACCCCAAGG - Intronic
1163309421 19:16504290-16504312 AGGCACTGGCCTCCACCCTAAGG + Intronic
1164448186 19:28335333-28335355 AGGCACTTTCCACCATGCCAGGG + Intergenic
1165365490 19:35362571-35362593 AGGCAGTGGCCTCAACTCCAAGG - Intergenic
1166023063 19:40050581-40050603 AAGCTCTCGCCTACATCCCAGGG + Intronic
1166025974 19:40084996-40085018 AAGCTCTCGCCTGCATCCCAGGG + Intronic
1168327454 19:55545528-55545550 AGGCCCTGCGCTCCATCTCAGGG + Exonic
1168644981 19:58053911-58053933 GGGCCCTGGGCTCCATCCCTGGG - Exonic
925147242 2:1589301-1589323 ATGCATTGGCCTCCAGCCCCGGG + Intergenic
925257680 2:2504009-2504031 AGGCACAGGCCTCCCTGCCCAGG + Intergenic
925451146 2:3969996-3970018 AGGCACTGCCCACCCTCACAGGG + Intergenic
925462756 2:4078357-4078379 ACGCAGTGTTCTCCATCCCAGGG - Intergenic
925698192 2:6605436-6605458 AGGCACTTGCCTCAATCCTGCGG - Intergenic
925924448 2:8660110-8660132 AGGCAGGGGCATCCAGCCCAGGG + Intergenic
927651606 2:24916900-24916922 AGGCATTGACCCCCAGCCCAGGG - Intronic
927933217 2:27059066-27059088 AGGCACAGGGACCCATCCCAAGG - Intronic
929947880 2:46383970-46383992 ACACACAGGCCCCCATCCCAAGG - Intronic
930049515 2:47204204-47204226 AGGCACTGGCCTCCATCTCCTGG - Intergenic
932947041 2:76247092-76247114 AGCAACTGGCCTCCAGCTCAGGG + Intergenic
934074472 2:88416203-88416225 AGGCACTGGGCACAATCCCCAGG - Intergenic
934712303 2:96523948-96523970 AGGCCCTGCCCTTCATCCCCTGG + Intergenic
937999241 2:127719497-127719519 ATGCAGGGGCCTCCACCCCAAGG - Exonic
938940372 2:136164468-136164490 AGGCCATGCCCTCCAACCCATGG - Intergenic
941333393 2:164208970-164208992 AGGAACCTGCCTCCATGCCATGG - Intergenic
942505953 2:176641892-176641914 AGACACAGGCCTGCCTCCCAGGG + Intergenic
945839812 2:214874021-214874043 AGGCACAGGCCACCTTGCCAAGG + Intergenic
946483774 2:220081276-220081298 AGGCACTCTCCTGCATACCAAGG + Intergenic
946866276 2:224043852-224043874 TGGCCTTGGCCACCATCCCAAGG + Intergenic
948381017 2:237550128-237550150 AGGCACTTGCCTCCACGCCTGGG + Intronic
948481299 2:238252131-238252153 AGGCCCCGCCCTCAATCCCAAGG - Intronic
948657154 2:239483563-239483585 AAGCACAGGCCACCATCCCGAGG - Intergenic
948660920 2:239505995-239506017 GGGCAGTGGACTCCATCCCTCGG + Intergenic
948899481 2:240949152-240949174 GGGCACTGAGCTCCATTCCAGGG - Intronic
1169550578 20:6697604-6697626 AGTCAGTGGCCTCCCTCCCGTGG + Intergenic
1171528652 20:25836241-25836263 AGGCACTGGCCACCATGTCTGGG - Intronic
1171548174 20:26019645-26019667 AGGCACTGGCCACCATGTCTGGG + Intergenic
1171792082 20:29536574-29536596 AGAGAGTGGCCTCCATGCCAGGG - Intergenic
1171856270 20:30346372-30346394 AGAGAGTGGCCTCCATGCCAGGG + Intergenic
1172102387 20:32493078-32493100 AAGCCCTGGGGTCCATCCCAAGG - Intronic
1172497232 20:35396331-35396353 AGGCACTGGACTCCAGCCTGGGG - Intronic
1175003294 20:55653686-55653708 AGGCACTGTCCTCCCAGCCAGGG + Intergenic
1175370240 20:58483409-58483431 TGGCACTGCCCACCATTCCAGGG + Intronic
1175773194 20:61636598-61636620 AGGCTCTGGCCTCTCTTCCACGG + Intronic
1176104045 20:63377313-63377335 AGGGAAAGGCTTCCATCCCACGG + Intronic
1176165148 20:63668925-63668947 AGGCACAGGCCTGCAGGCCATGG + Intronic
1178107278 21:29334239-29334261 AGGCGCTGGCCACCATGCCTGGG + Intronic
1178363966 21:31973057-31973079 AGCCACTAGCCTCCATGTCAAGG - Intronic
1178521372 21:33290645-33290667 AGGCATTGTCCTCCAGCCCCTGG - Intronic
1178851635 21:36217132-36217154 AGCGAAGGGCCTCCATCCCAAGG - Intronic
1180082453 21:45493142-45493164 ACGGCCTGGCCTCCATTCCAGGG + Exonic
1182657406 22:31901576-31901598 AAAGACTGGCCTCCATCCCAAGG - Intronic
1182696492 22:32202474-32202496 AGGCTCTAGCCTCCAGCCCGTGG + Exonic
1183616844 22:38950812-38950834 AGGCACTGGGCCTCATCCCAGGG + Intergenic
1184175148 22:42784834-42784856 TGACACTGGCCTCAATCTCATGG + Intergenic
1184843698 22:47067677-47067699 AGGCTGTGGCATCCATCCCCAGG - Intronic
1185044563 22:48522639-48522661 AGGGAATGGCCTTCCTCCCAGGG - Intronic
1185299108 22:50070254-50070276 AGACACTGGTCTCCTTCCAAGGG + Intronic
949841216 3:8322134-8322156 ATGCACTGTCCACCTTCCCAGGG - Intergenic
950046249 3:9950098-9950120 AGACCATGGCCTCCAGCCCATGG - Exonic
953099816 3:39812953-39812975 AAGCACCTGCCCCCATCCCACGG - Intronic
953763091 3:45709327-45709349 AGGAACTGTCCTACATCCCAGGG + Intronic
955510143 3:59671980-59672002 AGGCACTTGCCACCATGCCCAGG - Intergenic
955687922 3:61563496-61563518 AGGACTTGGCCTCCACCCCAAGG - Intronic
956735185 3:72232749-72232771 GGGCAATGGGCTCAATCCCATGG - Intergenic
958730011 3:97951456-97951478 AGTCACTGGCTTCTATCCCCCGG - Intronic
959742302 3:109734940-109734962 AGGCACTGGACTCCAGTCCCTGG + Intergenic
960298521 3:115973588-115973610 AGGCACCTGCCACCATGCCAGGG - Intronic
960794289 3:121468309-121468331 AGGCAAAGGCCTACTTCCCATGG - Exonic
964888410 3:161511087-161511109 AGGCACTAGGCTCAATGCCAGGG + Intergenic
965333420 3:167405920-167405942 AGGCACCTGCCACCACCCCAGGG - Intergenic
967876466 3:194271274-194271296 AGGCCCTCCCCTCTATCCCAGGG - Intergenic
968133998 3:196208672-196208694 ATGCACTGGCTTCCACCCCCAGG + Intronic
968244083 3:197124416-197124438 AGGCACTTGCCACCATGCCCGGG + Intronic
969049097 4:4360068-4360090 AGGCGCTGGCCACCATGCCCTGG + Intronic
969326802 4:6448798-6448820 AGCCAATGGCCACCACCCCAAGG + Intronic
969514989 4:7642163-7642185 AGGACCTGGCCTCCTTGCCAAGG + Intronic
972315865 4:37925128-37925150 AGGCCCTGGGCTCCATGCCGAGG + Intronic
972423703 4:38913115-38913137 AGACACTGGCCACCACCACAAGG - Intronic
972594463 4:40517479-40517501 AGGCATTGGACTCCATGCCAGGG - Intronic
974076317 4:57171457-57171479 AGGTAGTGGCATTCATCCCAAGG - Intergenic
978168074 4:105632755-105632777 AGGCAAGGACCTCCATCCCCAGG - Intronic
980446269 4:132912252-132912274 AGGCACTTGCCACCATGCCCGGG + Intergenic
980584332 4:134792262-134792284 AGGCACATGCCACCATGCCAAGG - Intergenic
981966669 4:150612044-150612066 AGGCACAAGCCACCATGCCAGGG + Intronic
982296424 4:153833962-153833984 AGGCATTGGCCTCCATCTTGTGG - Intergenic
983951765 4:173650253-173650275 AGCCACTGCACTCCAGCCCAGGG + Intergenic
983959303 4:173732908-173732930 AGACACTGGAATCAATCCCAAGG - Intergenic
984545128 4:181092490-181092512 TGGCACTGCCCTCCAGCCCTGGG - Intergenic
985246484 4:187984467-187984489 AGGCATGGGCCGCCATCCCTGGG - Intergenic
985704043 5:1390479-1390501 TGGCACAGGCTTCAATCCCAGGG + Intergenic
986513855 5:8540449-8540471 AGCCACTGGCCTCCATCTCTGGG + Intergenic
986667351 5:10115089-10115111 AGCCTCTGTCCTCCAGCCCATGG - Intergenic
987752419 5:22058198-22058220 AGGCACACGCCTCCATGCCCAGG + Intronic
987974257 5:24991846-24991868 AGGCACTGGCCACCATACCCAGG - Intergenic
990332645 5:54742788-54742810 AGGCACAGGCCTCCCTCCTCAGG + Intergenic
991950109 5:71939101-71939123 AGGCTCTGGCGCCCAACCCAGGG - Intergenic
994530876 5:100968781-100968803 AGAAACTGGACTCCATCGCAAGG - Intergenic
994729682 5:103477038-103477060 AGGCTCTGTCCTCCACCCAAGGG + Intergenic
998140636 5:139697644-139697666 AAGGGCTGGCCTCCATCCCACGG - Intergenic
999619978 5:153463022-153463044 AGTAGCTGGCCTCCATGCCATGG + Intergenic
1001217988 5:169873922-169873944 AGGCTTTGGCCTGCATTCCAGGG + Intronic
1001397825 5:171429367-171429389 GGGCACTTGCCCCCATGCCAGGG - Intronic
1005396147 6:25383981-25384003 AGGCATTTGCCACCATCCCCGGG + Intronic
1007884083 6:45205651-45205673 AGGCACTTGCCACCATGCCCAGG - Intronic
1007920472 6:45604955-45604977 AGGCATGAGCCTCCATGCCAGGG + Intronic
1010495887 6:76533262-76533284 AGGGACTGGCCTGGATCCCTAGG - Intergenic
1013634534 6:112016524-112016546 AAGCCCTGGCCTCCACCCTAGGG + Intergenic
1014197324 6:118575455-118575477 AGGCACTTGCCGCCAACACAGGG - Intronic
1014942840 6:127463688-127463710 AGGCACTTGCCACCATGCCCAGG + Intronic
1015804230 6:137092312-137092334 AGGTACTGGCCACCCTCCCAAGG + Intergenic
1017029251 6:150206373-150206395 AGGCACTGTCCTAGATGCCAGGG - Intronic
1018096347 6:160390352-160390374 AGGCACTGGCCTCATTCCCCAGG + Intronic
1018706894 6:166470008-166470030 AGCCTCTGGGCTCCTTCCCACGG - Intronic
1018848806 6:167573147-167573169 AGGCAGTGGCCTACATGGCAGGG - Intergenic
1019067057 6:169311104-169311126 ATGGCCTGGCCCCCATCCCATGG - Intergenic
1020151537 7:5685398-5685420 ACACCCTGGCTTCCATCCCAGGG - Intronic
1021235741 7:18140277-18140299 GGGATATGGCCTCCATCCCATGG + Intronic
1023844059 7:44111362-44111384 AGGTACTGGCCTCCTTCCTAAGG - Intronic
1024061232 7:45700084-45700106 AGCCACTGGCATCCATTCCGGGG + Intronic
1025801314 7:64789161-64789183 AGGCACTGGCCACCACACCCGGG - Intergenic
1027267686 7:76503313-76503335 ATGGGCTGGCCACCATCCCAGGG - Intronic
1027319498 7:77003176-77003198 ATGGGCTGGCCACCATCCCAGGG - Intergenic
1029669298 7:102018098-102018120 AGGCACTTGCCACCATGCCTGGG + Intronic
1029732619 7:102447901-102447923 AGCCACTGGCCTCCAGCTCTCGG + Exonic
1030266707 7:107629093-107629115 AGCCACTGGGCTGCATCCCCAGG - Intronic
1030871456 7:114760851-114760873 AAGAACTTACCTCCATCCCATGG - Intergenic
1033237981 7:139653494-139653516 AGGCAGAGGCCTCCTTCCCGAGG - Intronic
1035096617 7:156361275-156361297 CAGCAGAGGCCTCCATCCCACGG + Intergenic
1036396640 8:8376637-8376659 GGGCCCCAGCCTCCATCCCAAGG - Exonic
1037603834 8:20421168-20421190 AGTCTCTGGCCTCCAGCCCTGGG + Intergenic
1037730100 8:21517100-21517122 AGGCAGTTGTCTCCATCCCAGGG - Intergenic
1040106833 8:43546320-43546342 AGTCCCTGGCTTCCATGCCAGGG - Intergenic
1040106894 8:43546547-43546569 AGGCCCTGGCTTCCACCCCAGGG - Intergenic
1040109742 8:43562015-43562037 AGTCCCTGGCTTCCATGCCAGGG - Intergenic
1040109971 8:43562884-43562906 AGTCCCTGGCTTCCACCCCAGGG - Intergenic
1041820024 8:62020674-62020696 ATGCATTGGCCTCCATCAAAAGG - Intergenic
1042068515 8:64904790-64904812 AGGCACTTGCCACCATGCCTGGG + Intergenic
1042532782 8:69832643-69832665 AGGCACTGGACTGCAGCCCGGGG - Exonic
1045097785 8:98816365-98816387 AGGCATTGGCCACCATGCCCAGG - Intronic
1045249789 8:100473924-100473946 ATGCACAGGCCCCCATTCCAAGG + Intergenic
1045856288 8:106769349-106769371 TGGCACTGACCTTCAGCCCAGGG + Intronic
1046175978 8:110575462-110575484 ACTCACTGGCCTTCATGCCAGGG + Intergenic
1047403671 8:124567413-124567435 ACACACAGGCCTCCCTCCCAGGG + Intronic
1049616733 8:143578748-143578770 AGCCTCTGGCCTCCCTCCCCAGG - Intergenic
1050224015 9:3429898-3429920 AAGCAGTGGCTTCCAACCCACGG + Intronic
1050552172 9:6758132-6758154 AGACAGTGGCCTCCGGCCCAGGG - Intronic
1053385521 9:37684155-37684177 AGGCTTTGGCTGCCATCCCAAGG + Intronic
1054343579 9:63892149-63892171 AGAGAGTGGCCTCCATGCCAGGG - Intergenic
1055404897 9:75964204-75964226 AGGCACTGGCCAGAATACCAGGG + Intronic
1059326215 9:113505381-113505403 AGGCTCTTGCCTCTACCCCAAGG - Intronic
1059451916 9:114376243-114376265 CCCCACTGGCCTCCATCCCAGGG + Intronic
1060464147 9:123887584-123887606 GGGCACTGGCCTCCATTCTCGGG - Intronic
1060690307 9:125651871-125651893 AGGCAGTGGCCTTCAGCCTAAGG - Intronic
1060963217 9:127696190-127696212 AGGCACATGCCACCATGCCAGGG - Intronic
1061564655 9:131430266-131430288 AGGAACTGGCCTTCAACCCTGGG - Intronic
1061998799 9:134205381-134205403 AGGCAGCGGCCTTCCTCCCAGGG - Intergenic
1062183291 9:135202649-135202671 AGGCAGTGGTCTCCACCACATGG + Intergenic
1062267680 9:135694894-135694916 TGGCCTTGGCCTCCCTCCCACGG + Intronic
1186097925 X:6122380-6122402 AGGCACATGCCTCCATGCCCAGG + Intronic
1187397792 X:18933323-18933345 TGCCACTGCCCTCCATCTCATGG + Intronic
1187871520 X:23768604-23768626 AGGCACGTGCCACCATCCCCAGG - Intergenic
1189859839 X:45261242-45261264 AGGCTCTGGAGTCCTTCCCAGGG + Intergenic
1194037792 X:88899861-88899883 AGGCACTTGCCACCATGCCTGGG - Intergenic
1195021537 X:100833343-100833365 TGCCTCTGGCCTCCATCCCTCGG - Exonic
1200747698 Y:6916972-6916994 GGGCACTGGGCAGCATCCCAGGG - Intronic
1201318069 Y:12667691-12667713 AGGCACAGGCCACCATGCCCAGG + Intergenic
1201558526 Y:15290432-15290454 AGGCACTTGCCTCCATGCCCAGG + Intergenic
1202174134 Y:22081908-22081930 AGGAACTGGCCTTCAAACCAGGG - Intronic
1202217226 Y:22504474-22504496 AGGAACTGGCCTTCAAACCAGGG + Intronic
1202325960 Y:23691585-23691607 AGGAACTGGCCTTCAAACCAGGG - Intergenic
1202544811 Y:25978469-25978491 AGGAACTGGCCTTCAAACCAGGG + Intergenic
1202589781 Y:26470571-26470593 AGGCAGGGACCTCCATCCTATGG + Intergenic